ID: 901451682

View in Genome Browser
Species Human (GRCh38)
Location 1:9339931-9339953
Sequence CATCAGAAGGAAAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 625}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901451682_901451687 4 Left 901451682 1:9339931-9339953 CCCTCCACCTTTTCCTTCTGATG 0: 1
1: 0
2: 4
3: 66
4: 625
Right 901451687 1:9339958-9339980 TTTCCTCCAGCCCCCCACCTCGG 0: 1
1: 0
2: 6
3: 38
4: 297
901451682_901451690 8 Left 901451682 1:9339931-9339953 CCCTCCACCTTTTCCTTCTGATG 0: 1
1: 0
2: 4
3: 66
4: 625
Right 901451690 1:9339962-9339984 CTCCAGCCCCCCACCTCGGGAGG 0: 1
1: 0
2: 2
3: 18
4: 219
901451682_901451688 5 Left 901451682 1:9339931-9339953 CCCTCCACCTTTTCCTTCTGATG 0: 1
1: 0
2: 4
3: 66
4: 625
Right 901451688 1:9339959-9339981 TTCCTCCAGCCCCCCACCTCGGG 0: 1
1: 0
2: 6
3: 68
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901451682 Original CRISPR CATCAGAAGGAAAAGGTGGA GGG (reversed) Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901410626 1:9080942-9080964 CATCAAAATGAAAAAGTGGTGGG + Intronic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
902099335 1:13973041-13973063 GACAAGGAGGAAAAGGTGGAGGG - Intergenic
902170299 1:14604760-14604782 CATCAGAAAGTAAAGGGGCAGGG - Intronic
902199105 1:14820700-14820722 GAGCAGAAGGTAAAGGTAGAAGG + Intronic
902518840 1:17004588-17004610 CAACAGAACTAAAAGGTGGTGGG + Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903118835 1:21200524-21200546 CTTCAGAAGGCCAAGGTGGGTGG + Intergenic
903455014 1:23481611-23481633 AATCTGAAGGCAAAGGAGGATGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904947229 1:34208304-34208326 CACCAGCTGGAAAAGGAGGAGGG - Intronic
905619526 1:39431267-39431289 CATTAGATGGAAGAGGGGGAAGG + Intronic
906042297 1:42797275-42797297 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
906268287 1:44452106-44452128 AATCAGTAGGAAAAGGATGATGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907581657 1:55577826-55577848 CAACAGGAGGAAAGGGTGGGTGG + Intergenic
907676004 1:56518530-56518552 GATCAGAATGGAAAGGCGGATGG + Intronic
908009762 1:59764208-59764230 CATCAGTCAGAAAAGGAGGAAGG + Intronic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908397028 1:63735098-63735120 AATCAGGAGGCTAAGGTGGAAGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908468459 1:64417781-64417803 CATCTGAAGGCAAAGTTGGATGG + Intergenic
908482864 1:64559699-64559721 CTTCAGAAAGTAAAGGAGGAAGG - Intronic
909308951 1:74121287-74121309 CATGACATGGAAAAGTTGGATGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911040145 1:93584753-93584775 CCACACAAGGAAAAGGTGGAAGG + Intronic
911065022 1:93780277-93780299 AAGCAGAAGGAAGAGGTAGATGG - Intronic
912021478 1:105112612-105112634 CATTAGAAGGACAATTTGGAAGG + Intergenic
912311192 1:108622989-108623011 CTTCAGGAGGTCAAGGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915065349 1:153220053-153220075 CCTCATGAGGAAGAGGTGGAGGG + Intergenic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
916803499 1:168236286-168236308 CATTTGAATGAAAAGATGGATGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917414830 1:174797770-174797792 CATAAGAAGGAAAAGGTTCTGGG - Intronic
917696515 1:177530849-177530871 CCTCAGAAGGCCGAGGTGGATGG - Intergenic
918248170 1:182679044-182679066 CATGGGAAAGAATAGGTGGAAGG - Intronic
918426332 1:184413822-184413844 AGTCAAAAGGAAAAGGAGGAAGG + Intronic
918456911 1:184730336-184730358 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
919914451 1:202130892-202130914 CAGCAGGAGGGAGAGGTGGAGGG - Exonic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920744240 1:208611036-208611058 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
921048746 1:211495854-211495876 CAGCAAAGGGGAAAGGTGGAAGG - Intergenic
921122132 1:212146438-212146460 CATCAGGACAAAAATGTGGATGG - Intergenic
922113322 1:222584274-222584296 CATTGGAGGGAAAAGGAGGAAGG - Exonic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
923470305 1:234284395-234284417 CATGAGCAGGAGTAGGTGGAGGG - Intronic
924542939 1:244998452-244998474 CTTCAGGAGGCCAAGGTGGAAGG - Intronic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1062897069 10:1111602-1111624 CATCAAAAGGAAAAGGTGACTGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063181126 10:3601426-3601448 CCTCTCATGGAAAAGGTGGAAGG + Intergenic
1063798787 10:9546189-9546211 CATCAGAGAGAAAAGCTGAAGGG + Intergenic
1064005798 10:11697988-11698010 CTTAGGAGGGAAAAGGTGGAAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064141439 10:12794071-12794093 CGTTGGAAGGAAAATGTGGAAGG + Intronic
1064492169 10:15870561-15870583 ACTCAGGAGGCAAAGGTGGAGGG + Intergenic
1064956551 10:20917420-20917442 CAACAGAAGCAAAGGGTAGAAGG + Intronic
1065097645 10:22297436-22297458 CTTTGGAAGGCAAAGGTGGAAGG + Intergenic
1065874891 10:29989020-29989042 AATCAGGAGGCTAAGGTGGAAGG - Intergenic
1065886644 10:30083729-30083751 CATAAGAAAGAAAAGGTGGCTGG + Intronic
1066302327 10:34107990-34108012 CCACAGAAAGAGAAGGTGGATGG + Intergenic
1067090689 10:43264630-43264652 CCTCAGGAGAAAAAGGGGGAAGG + Intronic
1067497238 10:46772482-46772504 CATCTGAAAGAGAAGGTTGATGG + Intergenic
1067597414 10:47567933-47567955 CATCTGAAAGAGAAGGTTGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1070225902 10:74505232-74505254 AACCAAAAGCAAAAGGTGGAAGG - Intronic
1070404903 10:76085967-76085989 CATGAGAAGGAGGAGGTGGGAGG - Intronic
1070753822 10:78979378-78979400 CATCCGCTGGAAAGGGTGGAAGG - Intergenic
1070940332 10:80339710-80339732 CTTTAGAATGAAAAGGTAGATGG - Intronic
1071416347 10:85445221-85445243 CATCAATAGCAAGAGGTGGAAGG + Intergenic
1071897237 10:90080961-90080983 CTTCAGATGGCAAAGGGGGAAGG - Intergenic
1071997075 10:91160141-91160163 CAACAGATGGAAATGGAGGAAGG - Intergenic
1072504617 10:96052746-96052768 CATCAGCAGAAAAAGGAGGGAGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073192768 10:101663546-101663568 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
1073972821 10:109063889-109063911 CCTCAGAAGGGAAAGGGGAAGGG - Intergenic
1074153536 10:110779422-110779444 CACCAGATGGAAGAGGTGCATGG - Intronic
1074256770 10:111810872-111810894 CAAGAGAAGGAAAAAGTGGGTGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074431004 10:113394673-113394695 GATGAGAAGGAAGAGGCGGAAGG - Intergenic
1075025440 10:118980252-118980274 CACCAGGAGGAACAGGTGGGGGG + Intergenic
1077233355 11:1468474-1468496 CATCAGAAGACAAGGGTGGGTGG + Intergenic
1077357339 11:2124535-2124557 CTGCAGCAGGAAGAGGTGGAGGG - Intergenic
1077907883 11:6547810-6547832 CCCCAGTAGAAAAAGGTGGAAGG - Intronic
1077963655 11:7103242-7103264 CACTAGAAAGAAAAGGTGAAAGG - Intergenic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078259671 11:9693829-9693851 CATCAGAAAGAAAAGTGGGGTGG - Intronic
1078449948 11:11433356-11433378 CAACATGAGGAAAAGGTAGAAGG + Intronic
1078566723 11:12421127-12421149 CATGAGATGGACAAGGTGGTGGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079826686 11:25204294-25204316 CATCACAAGCAAAAGGTGTCAGG - Intergenic
1080297353 11:30745454-30745476 AATCAGAAGGAAAAAGAGGTAGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080821838 11:35814863-35814885 CAGCAGTAGGAAAACGAGGAGGG + Exonic
1080926838 11:36766382-36766404 CCTAAGAAAGAAAAGGAGGATGG - Intergenic
1081411715 11:42766533-42766555 GATAAGGAGGAAGAGGTGGAGGG - Intergenic
1081466150 11:43319654-43319676 CTTCAGAAGGCCAAGGTGGGAGG - Intronic
1081644481 11:44780133-44780155 AATCTGAAGGAAAATGTGTAGGG - Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083054086 11:59803085-59803107 CAACAGAAGGAAAAAGGAGATGG - Intergenic
1083457734 11:62790186-62790208 CAGCTGCAGGAAGAGGTGGAGGG - Exonic
1084122198 11:67076187-67076209 CAGCAGAAGGAACAGGTGCTGGG + Intergenic
1084617941 11:70248914-70248936 CATCAGGAGCAACAGGAGGATGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085887185 11:80534805-80534827 TATCAGAAGGAAAAGCTGACAGG + Intergenic
1086404440 11:86487932-86487954 CTTCGGAAGGCCAAGGTGGAAGG + Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087589146 11:100162860-100162882 CATCAGAAGAGAAAGATAGATGG + Intronic
1087820285 11:102704042-102704064 CATCTCAAGGAAAAGGGGGCAGG - Intronic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088492729 11:110402964-110402986 CATTGGAAGGACAATGTGGAAGG + Intergenic
1090143232 11:124289004-124289026 ATTCAGAAGGCTAAGGTGGAAGG - Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090753112 11:129764428-129764450 CATCCCTAGGAAAAGGCGGAGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091134910 11:133179913-133179935 GAGCAGAAGGTAAAGCTGGAAGG + Intronic
1091324408 11:134675119-134675141 CACCAAAAGTAAGAGGTGGATGG - Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092112052 12:5970860-5970882 GGTCAGAAGGATAAGGTGGGTGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092966689 12:13650539-13650561 CAGCAGAAAGAAAGGGTGGCTGG - Intronic
1093010602 12:14102445-14102467 CATCCATAGGAAAAGGGGGAGGG + Intergenic
1093172662 12:15876479-15876501 CATCCATAGGAAAAGGGGGAGGG + Intronic
1093287061 12:17276906-17276928 CATTATAAGGAAAAGGTGAAGGG - Intergenic
1093580411 12:20779714-20779736 CATTAGAAGGACAATTTGGAAGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1094339977 12:29400339-29400361 TATCAGAAAGAAAAGGTGAAGGG + Intergenic
1094476034 12:30841370-30841392 CATGAAAGGGAAAAGGTTGAGGG - Intergenic
1094477273 12:30850881-30850903 CATTAAAAGGATAAGGTGGGAGG + Intergenic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1095156112 12:38857111-38857133 CATTTGAAGGAAAAGTTTGAAGG - Intronic
1095227646 12:39695870-39695892 CATCTGAAGCTAAGGGTGGAGGG - Intronic
1095294929 12:40516817-40516839 CATAAGGAGGAAAAGTTGAAAGG - Intronic
1095579070 12:43774779-43774801 CATCATCAGGAAAAGTAGGAGGG + Intronic
1095722008 12:45411189-45411211 CATCAGAAGGGAAAGTTATATGG + Intronic
1096973006 12:55682366-55682388 CACCAGCAGGTAGAGGTGGATGG - Intronic
1097971153 12:65634373-65634395 CAGCAAAAGGAAAAGGTGCATGG - Intergenic
1098002066 12:65955265-65955287 CTTCAGTAGGAAATGGTGGTAGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098424826 12:70350585-70350607 CATCAGAAAGCAAAGGTGTCAGG - Intronic
1099567181 12:84266861-84266883 CATGAGAAGAAAAGAGTGGATGG + Intergenic
1099705708 12:86150765-86150787 CAACAAAGGGAAAAGGTGCAAGG + Intronic
1100855477 12:98753724-98753746 CATCAGAATGAAAACTTGGATGG - Intronic
1101599435 12:106196207-106196229 CATGAGAAGGAAAAAGAGCATGG + Intergenic
1103138769 12:118530535-118530557 CATCAGAAAGAAAAGAAAGAAGG + Intergenic
1103399468 12:120633274-120633296 CATAAAAATGAAAAGGTGTATGG - Intergenic
1103576788 12:121883417-121883439 AATCAGGAGGAAGAGGTGGCGGG + Intergenic
1103844460 12:123891836-123891858 CAGCAGAGGGAAAAAGTGCATGG + Intronic
1104681495 12:130755076-130755098 CACCAGAAGGAAAAGCTTCAAGG + Intergenic
1105727376 13:23177912-23177934 CATCAGTAGAAAAAGATGGGAGG + Intergenic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106741105 13:32642692-32642714 TGACTGAAGGAAAAGGTGGAAGG - Intronic
1109149152 13:58823140-58823162 GAGCAGAAGAACAAGGTGGAAGG + Intergenic
1109341283 13:61062773-61062795 AAGCATAAGGAAAAGGTTGATGG - Intergenic
1109779320 13:67086572-67086594 CATCAGAAGTAAAATTTGGATGG + Intronic
1110687177 13:78388845-78388867 CATAAGAAGAAAAAAGTGCAGGG + Intergenic
1111706446 13:91755359-91755381 CAGAAGAAGGAAATGTTGGAAGG - Intronic
1111903131 13:94224556-94224578 AATCAGAACCATAAGGTGGATGG + Intronic
1112046388 13:95602244-95602266 AGTAAGAAGGAAAAGGTGGCAGG - Intronic
1112065095 13:95784355-95784377 CAGCACAGGGAAAAGGTGCAAGG + Intronic
1112105444 13:96234694-96234716 CATCGGAAGGATATGGTGGGAGG - Intronic
1112142964 13:96666269-96666291 CATCAGAGGGACCTGGTGGAAGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114230442 14:20776844-20776866 CTTCAAAAGGAAAATATGGAAGG - Intergenic
1114241796 14:20874793-20874815 CAAAAGGAGGAAAAGGAGGAGGG + Intergenic
1114718504 14:24854287-24854309 CCTCAGAATGGAAATGTGGATGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116369523 14:44111312-44111334 CCTCAAGAGGATAAGGTGGAAGG - Intergenic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1118723269 14:68609052-68609074 CAGGAGAAGGAACAGGTGAAGGG - Intronic
1119387272 14:74265573-74265595 CAGCACAAAGGAAAGGTGGAGGG + Intergenic
1119732750 14:76961535-76961557 CATTAGGAGGAAAAGAGGGATGG + Intergenic
1120868862 14:89319312-89319334 TAGCAGAGGGAAAAGGTGCATGG + Intronic
1121114056 14:91331320-91331342 CTTCAGGAGGAAAAGGTGCTTGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122599528 14:102914473-102914495 GATTAGAAGTTAAAGGTGGAGGG + Intergenic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126411655 15:48378173-48378195 GATCAGGAGGATAAGGGGGAGGG + Intergenic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126825648 15:52545371-52545393 CTTCAGGAGGCCAAGGTGGATGG - Intergenic
1127512019 15:59651925-59651947 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127890279 15:63244329-63244351 AATCTGAAGAAAAAAGTGGAAGG + Intronic
1127910714 15:63413844-63413866 TATCAGTAGGAAAATGAGGATGG + Intergenic
1128316778 15:66664979-66665001 ATTCAGAAGGCAGAGGTGGAAGG - Intronic
1128513352 15:68327018-68327040 GAGCAGAAGGAAGAAGTGGAGGG + Intronic
1128806407 15:70534290-70534312 CAACAGAAGGAAGAAGAGGAGGG + Intergenic
1128882338 15:71255198-71255220 AATCAGAAGGAAAAGGAGCCTGG - Intronic
1130456712 15:84117736-84117758 CATCAGCAAGAAATGGAGGATGG - Intergenic
1130792122 15:87166712-87166734 CATCAGAAAGCAAAGGTGTCAGG + Intergenic
1131078367 15:89513467-89513489 AATCAGAAGTTAAAGGTGCAGGG + Intergenic
1131726395 15:95230394-95230416 TGTTAGGAGGAAAAGGTGGAAGG + Intergenic
1132339406 15:101068588-101068610 CCTCAGAAGGCACAGGGGGAGGG + Intronic
1132364381 15:101246204-101246226 TGTCAGAAGAAAGAGGTGGATGG - Intronic
1132403870 15:101530595-101530617 CATCAGAATGCCAAGGAGGAAGG - Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133411118 16:5569749-5569771 CATCAGAAAGATCAGATGGAGGG - Intergenic
1133609265 16:7417882-7417904 CATCTGCAGGAAAAGGGAGATGG - Intronic
1134479163 16:14602668-14602690 CATCAGGAGGGAAGGGTGGGAGG + Intronic
1135097734 16:19578514-19578536 CATCAGCAGGGACTGGTGGAGGG - Intronic
1135513006 16:23104247-23104269 CATTAGAAGGAAAATGTGCCAGG - Intronic
1136231810 16:28890209-28890231 CTTCAGGAGGCCAAGGTGGAAGG + Intronic
1136282727 16:29223324-29223346 CACCAGAAGTAAGAGCTGGAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136582632 16:31162702-31162724 CTTCAGGAGGCAAAGGTGGGAGG - Intergenic
1137235379 16:46612702-46612724 TACCAGGTGGAAAAGGTGGAAGG - Intronic
1137348251 16:47685037-47685059 CAGAAGAAAGAAAATGTGGAAGG - Intronic
1138335923 16:56252780-56252802 CACAAGAAGGAACAGCTGGATGG - Intronic
1138542761 16:57698441-57698463 CTTTAGAAGGAAAAGGTGGGAGG + Intronic
1138894862 16:61191079-61191101 CTTCAGGAGGCAAAGGTGGGTGG - Intergenic
1138982694 16:62289477-62289499 CATGAGAATGTAAAGGTAGATGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1140913666 16:79475946-79475968 CATTAGATAGAAAAGGTGCAGGG + Intergenic
1141555759 16:84835643-84835665 CAACAGAAGGAAAAGGGGAGAGG - Intronic
1142087105 16:88189247-88189269 CACCAGAAGTAAGAGCTGGAGGG + Intergenic
1142732672 17:1872019-1872041 AATCAGAAGAAAAAGCTGGGTGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142883553 17:2898668-2898690 GATCAGAAGGCAGAGGTGGACGG - Intronic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146598661 17:34192303-34192325 CATCAGCTGGAAGAGGTTGATGG + Intergenic
1147818613 17:43228442-43228464 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1147831896 17:43303144-43303166 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1148381967 17:47206370-47206392 CCTCAGAAGAAAAAGCTGGAAGG - Intronic
1148396885 17:47315521-47315543 CTTTAGGAGGTAAAGGTGGAAGG - Intronic
1148669875 17:49402551-49402573 AAACAGCAGGAAAAGGAGGAAGG + Intronic
1149492233 17:57093304-57093326 CCTCAGGAAGCAAAGGTGGAAGG - Intronic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1149578304 17:57729247-57729269 GAAGAGAAGGAACAGGTGGAAGG - Intergenic
1149790993 17:59477039-59477061 CTTCAGGAGGCCAAGGTGGAAGG - Intergenic
1150065348 17:62104356-62104378 CCTGAGAAGGCAAAGATGGATGG + Intergenic
1150282761 17:63938859-63938881 CTTCTGAAGGAAGAGATGGAAGG + Exonic
1150581561 17:66478495-66478517 CTTCAGAAGGCCAAGGTGGGTGG - Intronic
1150934707 17:69622943-69622965 CATATGAAGGAAAATGGGGAGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152495737 17:80670071-80670093 CATCTGAAAGATAAGGTGGTGGG + Intronic
1153268474 18:3295578-3295600 CATCCAAATGAAAAGGTGCAGGG - Intergenic
1156100241 18:33585117-33585139 TGTCAGAAGGAAAAGAGGGAAGG - Intronic
1157239535 18:45996685-45996707 ACTCAGGAGGCAAAGGTGGAAGG + Intronic
1157917458 18:51680225-51680247 CATCAAGAGAAAAAGGAGGAAGG + Intergenic
1158015139 18:52775047-52775069 TACCAGCAGGAAAAGGTGGCAGG + Intronic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1158894310 18:61898705-61898727 CATCAGAGGGAACAAGTGGGGGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159616522 18:70586418-70586440 CATCAAAAACAAAATGTGGAGGG + Intergenic
1160057977 18:75503900-75503922 CATCAAAAAGCAAAGGTGGCAGG - Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160353612 18:78207053-78207075 AATCTGAAGGAAAAGATGAAAGG + Intergenic
1161658258 19:5529454-5529476 CATCAGAAGGATGGGGTGGGAGG + Intergenic
1162199891 19:9012177-9012199 CAACAGAAAGGAAAGCTGGAAGG + Intergenic
1162375632 19:10303671-10303693 CTTCAGAAGGCAGAGGTGGGAGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163078185 19:14915257-14915279 AATAAGAAGGAAAGTGTGGACGG - Intergenic
1163308036 19:16494703-16494725 CCTCAGAAGGAAAAGGTTAGTGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163661567 19:18581017-18581039 CATTAGAAGGACAATTTGGAGGG + Intronic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164433215 19:28206555-28206577 CTTCAGTAGGCCAAGGTGGAAGG + Intergenic
1164586730 19:29480448-29480470 GATCAGGAGGGAAAGGAGGAGGG + Intergenic
1164873442 19:31666596-31666618 CATCAGAAAGTGAAGGTGGATGG - Intergenic
1165251804 19:34544204-34544226 TATCAGAAATAAAATGTGGAAGG + Intergenic
1165274877 19:34740323-34740345 TATCAGAAATAAAATGTGGAAGG - Intronic
1165671057 19:37679501-37679523 CACCAGAAAGAAAAGGTACATGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167178331 19:47881731-47881753 CATCAGAAAAAAATGGCGGAAGG + Intronic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167977906 19:53246073-53246095 CTTCAGAAGGCCAAGGCGGATGG + Intronic
1168697888 19:58415756-58415778 CATAAGACAGGAAAGGTGGAAGG - Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925572065 2:5323070-5323092 CATGAGAGGGAAAATGTGCACGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
926186153 2:10692445-10692467 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
926772575 2:16391549-16391571 ACTCAGGAGGAAAAGGTGGGAGG - Intergenic
926893826 2:17662144-17662166 CATGAGGAGGAAAATGTGCAAGG - Intergenic
927503768 2:23599954-23599976 CTGCAGAATGAAAAGGGGGATGG - Intronic
927679317 2:25129621-25129643 CTTCAGAAGGAAAAGGAGATGGG - Intronic
927810985 2:26180039-26180061 CAACAGAGGAAAAATGTGGAGGG - Intronic
927860002 2:26554793-26554815 AGTAAGAATGAAAAGGTGGAGGG + Intronic
927906824 2:26864512-26864534 CACGGAAAGGAAAAGGTGGATGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928026404 2:27742963-27742985 CATCAAAAATAAATGGTGGAGGG - Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928942641 2:36742161-36742183 CTCCAGAAGGAAAAGGTCCAAGG - Intronic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929805609 2:45142461-45142483 CAGCAGAAGGGATCGGTGGAAGG - Intergenic
930303853 2:49652880-49652902 CAGCAGAAGTAAAATGTGTAGGG + Intergenic
930450094 2:51525054-51525076 AATCAGAAGAACAAGATGGAAGG - Intergenic
930570156 2:53076430-53076452 CATCAAAAGGAAAAGGAACATGG + Intergenic
931316834 2:61140854-61140876 CAGAGGAAGGAATAGGTGGAAGG + Intergenic
931517418 2:63058191-63058213 CACCAGAAAGAAGAGGGGGAGGG + Intergenic
932811901 2:74833338-74833360 GCTCAGAAGGCTAAGGTGGAAGG - Intergenic
932900991 2:75699818-75699840 CTTCGGAAGGCCAAGGTGGAAGG - Intronic
935155275 2:100478982-100479004 CATCCAAGGGAAAAGGTGGAGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936016849 2:108965852-108965874 GCACAGAAGGGAAAGGTGGAGGG - Intronic
936097585 2:109543995-109544017 CATCAGAAAGCAAAGGTGTCGGG + Exonic
937546929 2:123033767-123033789 CATAAAGAGGAAGAGGTGGAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938779403 2:134571653-134571675 CGGCAGAAGGAAAAGGTGCATGG + Intronic
938886309 2:135652674-135652696 CATCAGAAAATAAAGGAGGAGGG - Intronic
938894591 2:135737683-135737705 CCTCAGGAGGCTAAGGTGGAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940745186 2:157559856-157559878 CAGCAGGAAGAAAAGGGGGAAGG + Intronic
941106385 2:161359075-161359097 ACTCAGAAGGTTAAGGTGGAAGG - Intronic
942430839 2:175909734-175909756 AATAAGAAAAAAAAGGTGGAGGG + Intergenic
942504934 2:176631855-176631877 TATCAGAAGGAAAATATGGATGG + Intergenic
943272160 2:185820125-185820147 CGTGAGAAGGACCAGGTGGAAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
944125149 2:196284044-196284066 CATAAAAAGGAAAAGATGGTAGG - Intronic
944797749 2:203205927-203205949 CACCACATGGAACAGGTGGAAGG + Intronic
944873099 2:203933808-203933830 AATCAGCAGGAAAAGGGAGAAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946218562 2:218205977-218205999 AATAAGCAGGAAAAGGTAGAAGG + Intergenic
946698277 2:222383963-222383985 CATCAGAAGGACACTGTGGTAGG - Intergenic
947004810 2:225498846-225498868 CATTAGAGGGAAAAGGGAGATGG + Intronic
947070636 2:226284209-226284231 CTTCAGAAGGAATAGCTGGAGGG - Intergenic
947329671 2:229015415-229015437 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
947783639 2:232794134-232794156 CTTAAGAAGGAAAAGGGGGATGG - Intronic
947862323 2:233369592-233369614 CATCAGAACAGAAAGGGGGAGGG - Intronic
947865488 2:233395411-233395433 CTTCAGAAGGCCAAGGTGGGTGG - Intronic
947914430 2:233822373-233822395 CTTCTGAATGAGAAGGTGGATGG - Exonic
948158023 2:235800342-235800364 CTTCAGGAGGACAAGGTGGGAGG - Intronic
948702364 2:239768418-239768440 CATCAGTGGGAAGAGGTGGGAGG - Intronic
948936727 2:241170294-241170316 CAACAGAAGGAAATGTTGGATGG + Intronic
949016029 2:241711428-241711450 GATCTGAAGGACAAGATGGAGGG + Exonic
1168957761 20:1846490-1846512 AATGGGAAGGAAAAAGTGGATGG + Intergenic
1169010704 20:2247701-2247723 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169593764 20:7175293-7175315 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
1169965703 20:11214915-11214937 CGACAGAAGGAAAAGGAGGGAGG + Intergenic
1170075226 20:12411454-12411476 AAACAGAAGGCAAAGGGGGAGGG - Intergenic
1170942658 20:20862042-20862064 CTTCAGGAGGACAAGGCGGATGG - Intergenic
1170973756 20:21141276-21141298 TATCAGTAGGAAATGGGGGAAGG + Intronic
1171166837 20:22979488-22979510 AATCAGAAGGCAATGCTGGAAGG - Intergenic
1173767076 20:45621833-45621855 CAACAAAGGGAAAAGGTGCAAGG - Intronic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1174777189 20:53354841-53354863 GGTCAGAAGAAAAATGTGGATGG - Intronic
1175415165 20:58796219-58796241 CATGAGGAGCAAGAGGTGGACGG - Intergenic
1176202564 20:63868935-63868957 CATCAAAAAAAAAAGGTGGAAGG + Intronic
1177504697 21:22005186-22005208 CATCAGCAAATAAAGGTGGAAGG + Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1177923340 21:27182613-27182635 AAACAGAACAAAAAGGTGGAGGG - Intergenic
1178952666 21:36998058-36998080 CCTCATAAGAAAAAGGCGGAAGG - Intergenic
1178973775 21:37204707-37204729 TATCAGAAGGAGAAGCTGGGAGG + Intergenic
1179236725 21:39554093-39554115 GAGCAGAAGGAAGAGGAGGAGGG - Intergenic
1179625747 21:42648677-42648699 CATAAAAAGAAACAGGTGGAGGG + Intergenic
1180231111 21:46427118-46427140 CAGCAGCAGGAAAAGAGGGAAGG + Intronic
1181577174 22:23802435-23802457 AGACAGAAGGAAAAGGAGGAGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181947645 22:26530645-26530667 AATCAGCAGGAGCAGGTGGAAGG + Intronic
1182026373 22:27122416-27122438 CTTCAGAAGGCAGAGGTGGGTGG - Intergenic
1182247744 22:28973439-28973461 CATCAGAAATAAAAGCAGGATGG + Intronic
1182511611 22:30824201-30824223 CAACAGAAGGATAAGATGGAAGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182773989 22:32817590-32817612 GACCAGAAGAAAAAGGAGGAAGG + Intronic
1182951894 22:34383884-34383906 CATCAGAGGGAACTGGTGGGAGG + Intergenic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183516449 22:38269586-38269608 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
949294217 3:2501892-2501914 CATCAGAAAGCAAAGGTGTCAGG - Intronic
949310347 3:2690301-2690323 CATCAAGAGGCAAAGGTGGCTGG + Intronic
949706664 3:6826213-6826235 CACCTGAAGGAAAAGGGGGAGGG + Intronic
950600630 3:14032199-14032221 CTACAGATGGCAAAGGTGGAAGG + Intronic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
952208381 3:31203352-31203374 CATCAGGAGGCTGAGGTGGAAGG + Intergenic
952261126 3:31741504-31741526 CTTCAGGAGGCCAAGGTGGATGG - Intronic
953165471 3:40460951-40460973 CTTCAGGAGGCCAAGGTGGAGGG + Intronic
954378817 3:50208886-50208908 CATCAGGAAGAAAAGGCAGAGGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954816077 3:53281734-53281756 GATAAGATGGAAAAGGTGGCTGG - Intergenic
955309913 3:57875278-57875300 CTTCAGGAGGCAAAGGTGGGAGG + Intronic
955607731 3:60723662-60723684 CAACATAGGGAAAAGGTGCATGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956591903 3:70924161-70924183 CATCAGAGGGAAAAGCTGCAGGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957127489 3:76180545-76180567 TGTCAGAAGGAATAGGAGGATGG - Intronic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957518176 3:81283264-81283286 CTTAAGGAGGCAAAGGTGGATGG + Intergenic
957867978 3:86049689-86049711 TAGCAGAAGGCAAAGGGGGAAGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959695362 3:109244085-109244107 ACTCAGAAGGGAGAGGTGGAAGG - Intergenic
960296087 3:115945661-115945683 CATTAGAAGGGAAAAGTGGTTGG - Intronic
960303714 3:116035455-116035477 CAAGAGAAGGAAAAGGGGGTGGG + Intronic
960304799 3:116047997-116048019 CATCAAACGGTAAAGGTGCATGG - Intronic
960333240 3:116388287-116388309 CACCCAAAGGAAAAGGTGGAGGG + Intronic
960334431 3:116399082-116399104 CAAGAGAAGGTAGAGGTGGAAGG + Intronic
960571607 3:119190237-119190259 CATCAGAATGAAATACTGGAAGG - Exonic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961127456 3:124433047-124433069 CATCAGAAGGAAAATATGCCAGG + Intronic
962050681 3:131811571-131811593 GGACAGAAGGAAAATGTGGAAGG - Intronic
962366727 3:134791682-134791704 CTTCAGCAGGAAAAGAAGGAGGG - Intronic
962638053 3:137351147-137351169 CATCAGATAGAAAAGTTGGACGG - Intergenic
963027128 3:140931089-140931111 CCTCAGCAGGAATAGGTGGTGGG + Intergenic
963322598 3:143825388-143825410 CACCATTAGGAAAAGTTGGATGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964219708 3:154329189-154329211 AAGTAGAATGAAAAGGTGGAAGG + Intergenic
964331405 3:155607548-155607570 ACTCAGAAGGCTAAGGTGGAAGG - Intronic
965551656 3:169971902-169971924 CAACAGAAAGGAAATGTGGAAGG - Intronic
965901499 3:173645973-173645995 TGTCACAAGGAAAAGGGGGAGGG - Intronic
966157442 3:176932323-176932345 CATCAAAAAAAAAAGGTGGGGGG - Intergenic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966365239 3:179178736-179178758 CAGCAAAGGGAAAAGGTGAATGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967669914 3:192220490-192220512 CTTCAGAAGGAAATGGTGTTTGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969118060 4:4886361-4886383 CATCAGAAAGCAAAGGTGCAGGG - Intergenic
969415176 4:7053230-7053252 CGGCAGAAGGAAAAGATTGAGGG + Intronic
969438521 4:7202815-7202837 CATCAGAAGCAGAAGCTGGGAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971140881 4:23923725-23923747 CCTCAGATGGAAAAGGAAGAGGG + Intergenic
971878019 4:32329152-32329174 CATCAAAAGGAAAAGGTGTATGG + Intergenic
972510219 4:39762303-39762325 CTTCAGGAGGCCAAGGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973160570 4:47011174-47011196 CATTAGCAGAAAAAGGTGGGAGG + Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973268901 4:48240379-48240401 CAACACAAGAAAAAGGTGGATGG + Intronic
973758820 4:54099521-54099543 CATCAGCATGAAAAGCTTGACGG + Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974520588 4:62976167-62976189 CAACAGAAGGATAATATGGATGG + Intergenic
974522667 4:63004708-63004730 CATAAGAAGGAAAATATGGCAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976764103 4:88581054-88581076 CATCAGAGGGCAAAGGAGGAAGG + Intronic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
977529341 4:98181894-98181916 CAGCAAAAGGAAAATGTGCATGG + Intergenic
978105189 4:104893449-104893471 GAACAGAAGGAAAAGAAGGAAGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979090110 4:116472325-116472347 CTTCAGAAGGCCAAGGTGGGCGG - Intergenic
979101986 4:116629552-116629574 CAGGAGGAGGAAGAGGTGGATGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980444331 4:132886294-132886316 CAACAGAAGGACAATATGGACGG + Intergenic
980591097 4:134890649-134890671 CAGCAGAAGGAAAAGGTGCATGG + Intergenic
981021534 4:140034490-140034512 GATCAGAAGGAAAGGCTGGGTGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982512034 4:156294808-156294830 CAGCAAAAGGAAAACATGGAAGG + Intergenic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
983586622 4:169362589-169362611 AATCAAAAGGAAAAAATGGAAGG + Intergenic
984057583 4:174948893-174948915 CATCACAAGGAAGGGGTGGCTGG + Intronic
984523322 4:180826424-180826446 AATAAGGAGGAAAAGATGGAAGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984850693 4:184149992-184150014 AACTAGAAGGATAAGGTGGAGGG + Intronic
985016661 4:185643241-185643263 CATGTGAAGGAAGAGGTGGTGGG + Intronic
985286056 4:188337114-188337136 CAGCAGATGGGAAAGGTGGGCGG - Intergenic
985659708 5:1150976-1150998 CATCAGAAGGCAAAGGCTGAGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986671771 5:10148897-10148919 CATCAGGAGGAAAGGGGGGGAGG + Intergenic
986814117 5:11389826-11389848 CATCAGAAAGCAAAGGTGTCAGG - Intronic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
987254517 5:16136811-16136833 AATCAGAAAGAAAGGATGGAAGG + Intronic
988092940 5:26566806-26566828 AATAAAAAGGAAAAAGTGGAAGG + Intergenic
988256090 5:28822241-28822263 GAGCAGAAGGAAGAGGTGAAGGG - Intergenic
988883350 5:35529495-35529517 AATGAGAAGGGAAAAGTGGAAGG - Intergenic
989040079 5:37218468-37218490 CAGCAAAGGGAAAAGGTGCATGG - Intronic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990363198 5:55042521-55042543 CATGAGCAGGACAAGCTGGAAGG - Intergenic
991323205 5:65399655-65399677 TATCACAAGGGAAAGGAGGAAGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992116006 5:73539177-73539199 CATCAAGAGGAAAAGGGGGAAGG - Intergenic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
993054220 5:82963096-82963118 CATCAGAAAAAAAAGATGAAGGG + Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
994520231 5:100824649-100824671 CATCTGAAAAAAAAGGTGGAGGG + Intronic
995897301 5:117029832-117029854 CAGCTGAAGGAAGAGGAGGAAGG - Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996946458 5:129075668-129075690 TGGCAGAAGGAAAAGGTGGGGGG + Intergenic
997457195 5:134026160-134026182 CATCTGCAGGAAAAGGGAGAGGG + Intergenic
997650124 5:135510958-135510980 TATCAGAATGAAATGGTGGCAGG - Intergenic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
998562679 5:143186029-143186051 GCTCAGAAGGAAAAGGAGGGAGG + Intronic
998941796 5:147291359-147291381 CATCAGAAGCAAAATTGGGATGG + Intronic
999092986 5:148954006-148954028 CATCAGAAGGAAAAGATAGGAGG - Intronic
999364775 5:151015217-151015239 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
999677170 5:154015554-154015576 CATCCTTAGGAAAAGGGGGAAGG + Intronic
999880553 5:155859167-155859189 CCTCAGGAGGCTAAGGTGGAAGG - Intergenic
999930261 5:156424764-156424786 CAGCAGAGGAAAAAGGTGCATGG + Intronic
1000304085 5:159980085-159980107 CAGCAAAAGAGAAAGGTGGAAGG + Intergenic
1000803528 5:165759084-165759106 TATCAGAAGGAAAGGAAGGAAGG + Intergenic
1000906753 5:166973550-166973572 CATCAGAAAGTAAAGGTGTCAGG + Intergenic
1001219459 5:169887187-169887209 TTTCAGAATGAAAATGTGGAGGG - Intronic
1001685119 5:173588374-173588396 CATCAGAAGATAAAGGAGAACGG + Intergenic
1002958829 6:1895232-1895254 CATCATGAGTAAATGGTGGACGG - Intronic
1004335470 6:14760449-14760471 CATGATGAGGCAAAGGTGGAGGG + Intergenic
1004456079 6:15792619-15792641 CATCAGCAGGAACACATGGAGGG + Intergenic
1004482633 6:16035460-16035482 ACTCAGAAGGCTAAGGTGGAAGG + Intergenic
1004902686 6:20208660-20208682 CATCAGCAGAAAAAGGGGCAAGG - Intronic
1005807302 6:29486924-29486946 CCTCAGAAAGAAAAGGCTGAAGG - Exonic
1006759232 6:36444460-36444482 CCTCAGAAGGAAAAGATTAATGG - Intronic
1007446453 6:41910038-41910060 CATAAGCAGGGAAAGGTAGATGG + Intronic
1007649438 6:43409186-43409208 CATTAGAAGGCCGAGGTGGATGG + Intergenic
1008154274 6:47994590-47994612 GATCACAAGTAAGAGGTGGAAGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008672856 6:53791412-53791434 ACTCAGAAGGCTAAGGTGGAAGG - Intergenic
1009164857 6:60328557-60328579 CTTCAGGAGGCAAAGGTGGGAGG + Intergenic
1009346871 6:62624332-62624354 ACTCAGAAGGATAAGGTGGGAGG - Intergenic
1010494055 6:76512016-76512038 CTTCAGAAGGCCAACGTGGAAGG - Intergenic
1011413859 6:87096104-87096126 CATCACTAAGAAAAGGTGAATGG - Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1012924148 6:105250796-105250818 CAGCAGAGGGAAAAAGTGCATGG + Intergenic
1013041718 6:106440789-106440811 CATCAGAAAGAGATGGTGGGTGG - Intergenic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013454242 6:110315761-110315783 AATCAGGAGCAAAAGGTGGGAGG + Intronic
1015556390 6:134465918-134465940 GCTCAGGAGGAAAAGGAGGAGGG - Intergenic
1015652177 6:135475764-135475786 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1016050436 6:139524772-139524794 CAACACAAGGAAAATGAGGAAGG - Intergenic
1016078613 6:139828607-139828629 CTTCAGAAGGAAAAGAAGGAAGG - Intergenic
1016724007 6:147339141-147339163 CAACGGAAGGAATAGGTAGATGG - Intronic
1017007738 6:150040072-150040094 CCTCAGGAGGCTAAGGTGGAAGG - Intergenic
1019320318 7:412157-412179 CAGCAGCAGGAACAGGTGGGAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019720377 7:2566921-2566943 CATCAGAAGGAATGGGTGGGTGG - Intronic
1020088123 7:5322607-5322629 CGCCAGAAAGAAAAAGTGGATGG - Intronic
1020356749 7:7285039-7285061 TAACAGAAGGAAAATCTGGAAGG + Intergenic
1021223275 7:17999171-17999193 TATCAGAAGCAAGGGGTGGATGG - Intergenic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1021521066 7:21539514-21539536 CAAGAGAAGGAAAAGGTGAATGG + Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021934540 7:25616738-25616760 CACAAGAAGGAAAAGGAGAAAGG + Intergenic
1022238674 7:28488146-28488168 GATCAGAGGGAAAGGGAGGAAGG - Intronic
1022726961 7:32990073-32990095 CTTCAGAAGGCCAAGGTGGGAGG - Intronic
1024515940 7:50256138-50256160 GGGCAGAAGGACAAGGTGGAAGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1024965242 7:55018653-55018675 CAAAAGAAGGGAAAGGGGGAAGG + Intergenic
1025031258 7:55558969-55558991 CTTCAGAAGGAAATGCAGGATGG - Intronic
1025046620 7:55697560-55697582 CTTCAGAAGGCCAAGGTGGGAGG + Intergenic
1025206185 7:56994518-56994540 CACCAGAAAGAAAAAGTGGATGG + Intergenic
1025279497 7:57616459-57616481 CCTCAGAAGGAAGAGGTAGAGGG - Intergenic
1025305234 7:57849041-57849063 CCTCAGAAGGAAGAGGTAGAGGG + Intergenic
1025665754 7:63582421-63582443 CACCAGAAAGAAAAAGTGGATGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026564944 7:71481935-71481957 CATCAGAAGGAAAGGAAAGAAGG + Intronic
1026690543 7:72546762-72546784 CAAGAGAGTGAAAAGGTGGAGGG + Intergenic
1027957308 7:84897223-84897245 GAAGAGAAGGAAAAGGTGAATGG + Intergenic
1028109796 7:86926274-86926296 CATCAGTAAGAAAAGGAGTAGGG + Intronic
1028669387 7:93383789-93383811 CATCAGCAGAAAATGGTGGGTGG + Intergenic
1028840306 7:95422620-95422642 CATAAAAAGAAAAAGATGGAAGG + Intronic
1029125759 7:98294234-98294256 CATTAGGAGGCCAAGGTGGAAGG - Intronic
1030216655 7:107050144-107050166 AGTCAGAAGGGAAAGGGGGAGGG + Intronic
1030354650 7:108528477-108528499 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1031014514 7:116558502-116558524 CCTCAGAAGGCCAAGGTGGGTGG + Intronic
1031138945 7:117919683-117919705 CATCCCTAGGAAAAGGGGGAGGG + Intergenic
1031181613 7:118425106-118425128 AATTAGAAGGAAGAGGTGGAAGG - Intergenic
1031278446 7:119763299-119763321 TATCATAAGGCAAAGGTGGCAGG + Intergenic
1031688798 7:124764533-124764555 GATCTGAAGGAAGAGCTGGAGGG + Exonic
1032355346 7:131205767-131205789 CATGAGAAGGAAAACATGCAAGG - Intronic
1032409699 7:131685895-131685917 CATTAGGAGGAAAAGGTATATGG + Intergenic
1032541541 7:132706892-132706914 CATCCGAAGGCAAAGGTGTCAGG - Intronic
1032597193 7:133253353-133253375 CCCCAGAAAAAAAAGGTGGAGGG - Intronic
1032739281 7:134722767-134722789 TAGCAGAAAGGAAAGGTGGAGGG - Intergenic
1032884689 7:136124794-136124816 TATAAGAAGGAAAAAGTGCAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033724630 7:144101358-144101380 CAACAGAAGGTAAAGGCAGATGG - Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034718098 7:153262323-153262345 ACTCAGAAGGAAAGGCTGGAAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035454925 7:159001945-159001967 AATCAGGAGGAGAAGGTGGTAGG + Intergenic
1035752462 8:2005935-2005957 AACCGGAAGGAAAAGGAGGAAGG - Exonic
1037300263 8:17444063-17444085 GATCAGAAGGAGGAGGAGGAGGG - Intergenic
1037480577 8:19301900-19301922 CAACAGAAAGAAAAGCAGGAAGG + Intergenic
1038125024 8:24664013-24664035 CATCATAAAAATAAGGTGGAAGG - Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038527158 8:28285450-28285472 CATCACACTGAAAAGCTGGAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038731208 8:30129459-30129481 CTTCAGGAGGCCAAGGTGGATGG + Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039624490 8:39034134-39034156 CATCAGGAGGCTAAGGTGGGAGG - Intronic
1039836086 8:41257310-41257332 AATCAGAAGGCTGAGGTGGAAGG + Intergenic
1040040400 8:42911102-42911124 GATCAGGATGAAAAGGTAGATGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040709487 8:50171057-50171079 CATCAGATGACAAAGGTGGAAGG - Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041020351 8:53632450-53632472 CATCAAAAGGAAAAGGCATATGG - Intergenic
1041307404 8:56476497-56476519 CATCAGAAAGCAAAGGTGTCAGG + Intergenic
1042104127 8:65306545-65306567 CCTCAGGAGGCAGAGGTGGAAGG - Intergenic
1042301493 8:67287416-67287438 CATCAGTAGGAAGAGGTATATGG - Intronic
1042710661 8:71713376-71713398 CACTAGGAGGAAATGGTGGATGG - Intergenic
1044041070 8:87368923-87368945 CATGAGAAGGAAAAGAAGGAGGG - Intronic
1044337788 8:91008037-91008059 CAGCAAAAGGAAAAGGCAGATGG - Intronic
1045010847 8:97957201-97957223 CACCAGGTGGAGAAGGTGGAAGG + Intronic
1045113016 8:98951215-98951237 CATAGGCAGGAAAAGGGGGAAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045572210 8:103379840-103379862 GATCTGAGGGAAAATGTGGAGGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047082839 8:121482708-121482730 CATTAGGAGGCTAAGGTGGATGG - Intergenic
1047748859 8:127865230-127865252 TTTCAGAAGGACAAGGTGGTAGG + Intergenic
1047895694 8:129363982-129364004 CTTCAGATGGAAAAGCTGGGGGG + Intergenic
1049798528 8:144507266-144507288 CTTCAGGAGGAAGAGGTGGGTGG - Intergenic
1050291586 9:4160998-4161020 CTTAAGAAGGCTAAGGTGGAAGG + Intronic
1050315818 9:4399854-4399876 GACCTGAAGGAAAAGATGGAGGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051534334 9:18140364-18140386 CAGCAAAGGGAAAAGGTGTATGG + Intergenic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1051802433 9:20951225-20951247 CGTCAGAGGGAAATGGTGTATGG + Intronic
1052752139 9:32502753-32502775 AAACAGAAGGCAAAGTTGGAGGG - Intronic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053076761 9:35140294-35140316 CATCAAAAGTATAAAGTGGAAGG + Intergenic
1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG + Intronic
1055720584 9:79168828-79168850 CATTAAAGGGAAAAGGTGTATGG - Intergenic
1055722261 9:79188498-79188520 CATTAGCACGTAAAGGTGGAGGG - Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056964364 9:91153627-91153649 AATGAGTAGGGAAAGGTGGAGGG + Intergenic
1058578243 9:106426180-106426202 CCTGAGAAGGACAAGGTGAAGGG + Intergenic
1058638510 9:107060061-107060083 CATCAAAAAGCCAAGGTGGAAGG - Intergenic
1058923854 9:109642664-109642686 CATCAGAAGGCTGAGGTGGGAGG - Intronic
1060216403 9:121741099-121741121 CATCAGAGGAAACAGGTGGGTGG - Intronic
1060607894 9:124933928-124933950 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1061244229 9:129393027-129393049 CATCTGCAGGATAAGGTGCAGGG + Intergenic
1062227970 9:135464576-135464598 CACCAGAAGGGAAATGTGGCCGG + Intergenic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1185511702 X:668511-668533 AATCAGAAGGATGAGGTGGAAGG - Intergenic
1186080124 X:5922052-5922074 AATCAGAGGGAAAAGGGAGAAGG + Intronic
1186474600 X:9847531-9847553 AATCAGAGGGAAAAGGGGGTTGG + Intronic
1186772521 X:12831742-12831764 CATCAAAAGGATAATGTGGCTGG - Intergenic
1187244724 X:17543808-17543830 TATCAAAAGGAAAAAGAGGAGGG - Intronic
1187501591 X:19843499-19843521 CACCAAAAGGAAAACGTGGCTGG - Intronic
1187965397 X:24606471-24606493 CAGAAGGAGGAAATGGTGGAAGG - Intronic
1188004248 X:25006110-25006132 TGTCAGAGGGAAAAAGTGGAGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189203969 X:39221856-39221878 GATTAGGAGGAAAAGGTGAAGGG + Intergenic
1189603261 X:42649264-42649286 CATCCATAGGAAAAGGGGGAGGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190799076 X:53771822-53771844 CTTAAGAAGGAAAAAGTGGAAGG + Intergenic
1190934994 X:54991652-54991674 CATAAGAAGGACAAGATGAAGGG + Intronic
1191840465 X:65510157-65510179 AATCAGAAAGAAAAGGTCCATGG + Intergenic
1192972053 X:76242807-76242829 CATCAAAAAGAAAACGTGAAAGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1194105440 X:89761714-89761736 CATAAAAAGGAAAAATTGGAAGG + Intergenic
1194124136 X:89992661-89992683 CATCTGAAAGAAAAGGGGAAAGG + Intergenic
1195638292 X:107143456-107143478 CTTCAGGAGGCCAAGGTGGATGG - Intronic
1196504620 X:116426652-116426674 GATAAGAGGGGAAAGGTGGAAGG + Intergenic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1197912643 X:131501051-131501073 CATCAGAAGGTAAAGGTGTCAGG - Intergenic
1197962222 X:132019626-132019648 CATCAGAAAGCAAAGGTGTCAGG - Intergenic
1198527285 X:137514265-137514287 CATGAGAAGAAACAGGTTGATGG + Intergenic
1198932886 X:141879463-141879485 AGTGAGGAGGAAAAGGTGGAGGG + Intronic
1199074159 X:143510807-143510829 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199093153 X:143714068-143714090 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199215182 X:145254092-145254114 GATCCGAAGGAGAAGGTGGAGGG + Intronic
1200277412 X:154747555-154747577 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1200457405 Y:3409531-3409553 CATAAAAAGGAAAAATTGGAAGG + Intergenic
1200477026 Y:3650283-3650305 CATCTGAAAGAAAAGGGGAAAGG + Intergenic
1201271077 Y:12254134-12254156 GAAGAGAAGGAAAAGGTGGGAGG + Intergenic