ID: 901453339

View in Genome Browser
Species Human (GRCh38)
Location 1:9349364-9349386
Sequence GGCCCCATCGTGCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901453339_901453347 4 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453347 1:9349391-9349413 CTGTGCCGGGCCAGGAGTGGGGG 0: 1
1: 0
2: 5
3: 86
4: 897
901453339_901453345 2 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453345 1:9349389-9349411 AGCTGTGCCGGGCCAGGAGTGGG 0: 1
1: 0
2: 1
3: 27
4: 260
901453339_901453354 24 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453354 1:9349411-9349433 GGGTAGGTGAGTGTGGGGTCAGG 0: 1
1: 1
2: 7
3: 85
4: 656
901453339_901453356 26 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453356 1:9349413-9349435 GTAGGTGAGTGTGGGGTCAGGGG 0: 1
1: 0
2: 6
3: 36
4: 503
901453339_901453342 -4 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453342 1:9349383-9349405 GGCCAGAGCTGTGCCGGGCCAGG 0: 1
1: 1
2: 5
3: 63
4: 574
901453339_901453352 18 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453352 1:9349405-9349427 GAGTGGGGGTAGGTGAGTGTGGG 0: 1
1: 0
2: 6
3: 101
4: 764
901453339_901453340 -10 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453340 1:9349377-9349399 CGATGGGGCCAGAGCTGTGCCGG 0: 1
1: 0
2: 2
3: 25
4: 232
901453339_901453355 25 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453355 1:9349412-9349434 GGTAGGTGAGTGTGGGGTCAGGG 0: 1
1: 0
2: 5
3: 42
4: 409
901453339_901453357 27 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453357 1:9349414-9349436 TAGGTGAGTGTGGGGTCAGGGGG 0: 1
1: 0
2: 2
3: 37
4: 451
901453339_901453341 -9 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453341 1:9349378-9349400 GATGGGGCCAGAGCTGTGCCGGG 0: 1
1: 0
2: 1
3: 66
4: 564
901453339_901453353 19 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453353 1:9349406-9349428 AGTGGGGGTAGGTGAGTGTGGGG 0: 1
1: 0
2: 6
3: 73
4: 745
901453339_901453348 8 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453348 1:9349395-9349417 GCCGGGCCAGGAGTGGGGGTAGG 0: 1
1: 0
2: 7
3: 76
4: 784
901453339_901453351 17 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453351 1:9349404-9349426 GGAGTGGGGGTAGGTGAGTGTGG 0: 1
1: 0
2: 13
3: 152
4: 1135
901453339_901453346 3 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453346 1:9349390-9349412 GCTGTGCCGGGCCAGGAGTGGGG 0: 1
1: 0
2: 5
3: 30
4: 355
901453339_901453344 1 Left 901453339 1:9349364-9349386 CCTGCTTGTGGCACGATGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 901453344 1:9349388-9349410 GAGCTGTGCCGGGCCAGGAGTGG 0: 1
1: 0
2: 1
3: 41
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901453339 Original CRISPR GGCCCCATCGTGCCACAAGC AGG (reversed) Intronic
900671272 1:3856680-3856702 GGCCCCGTCGTGCCGTATGCCGG - Intronic
901453339 1:9349364-9349386 GGCCCCATCGTGCCACAAGCAGG - Intronic
902384209 1:16067216-16067238 GGCCCCATGATGTCACAGGCTGG + Intronic
919737094 1:200959504-200959526 GGCCCCCTGGAGCCACAGGCAGG - Intergenic
919812374 1:201417216-201417238 GGCCCCCTCCTCCCCCAAGCTGG - Intronic
922791501 1:228313716-228313738 GGTCCCATCCAGCCACCAGCGGG - Intronic
1065293328 10:24252534-24252556 TGCGCCACTGTGCCACAAGCTGG + Intronic
1072289814 10:93953469-93953491 GGCCCCATCATGACACTATCTGG + Intronic
1076318491 10:129561243-129561265 TTCCCCATCGTGACACAGGCAGG - Intronic
1083262082 11:61528557-61528579 GGCCCTACCGTGTCACAAGAAGG - Intronic
1087909417 11:103736057-103736079 TGCCCCATTAGGCCACAAGCTGG - Intergenic
1095167852 12:38995166-38995188 GGCTACATCGTGGTACAAGCAGG + Intergenic
1096770677 12:53934207-53934229 GGTCCCATCTTCCCTCAAGCTGG + Intergenic
1101940110 12:109093554-109093576 GGCCCCCTGGTGCCACCTGCTGG + Intronic
1106138036 13:26989389-26989411 GGCCCCATCGTGCCCTGAGTGGG + Intergenic
1106554295 13:30796918-30796940 GGAGCCATGGAGCCACAAGCTGG - Intergenic
1121112515 14:91322003-91322025 GGCCCCCTCCTGCCACAAGCAGG + Intronic
1121113453 14:91328095-91328117 GGCCAAATCATGCCACAAGGAGG + Intronic
1121531023 14:94653624-94653646 GTCCCCATCCTGCTCCAAGCTGG + Intergenic
1122329786 14:100904519-100904541 CGCCCCCACGTGCCACAAGGGGG + Intergenic
1122837024 14:104435432-104435454 GGCCCCGTCGTGCCCCAAGAAGG + Intergenic
1125271803 15:37947375-37947397 GGCCCCATCCTGCCCCTAACTGG + Intronic
1128776583 15:70324911-70324933 GGCGCCATCTTGCCACCAGTTGG + Intergenic
1130738340 15:86572466-86572488 GGCCCCATCGTGGCAGTTGCCGG + Intronic
1131147659 15:90024599-90024621 GGACCCATCATTTCACAAGCAGG - Intronic
1132236895 15:100228842-100228864 GGCCCCATCCTCCCACAGGTAGG - Intronic
1132515995 16:366348-366370 CACCCCATCCTGCCACCAGCTGG + Intergenic
1133802218 16:9092612-9092634 GGCCCCATTGTGCCCTGAGCCGG + Intronic
1138432414 16:56977519-56977541 GGTCCCCTCGTGCCACAGCCTGG + Intronic
1140706537 16:77635675-77635697 AGCCACATGGAGCCACAAGCAGG - Intergenic
1143376064 17:6468416-6468438 GGGCCCAGCTGGCCACAAGCTGG - Intronic
1144948611 17:18982319-18982341 GGGCCCATCCAGGCACAAGCTGG - Intronic
1145278323 17:21450094-21450116 GGGCCCATCCTGCCACCTGCTGG + Intergenic
1145312049 17:21706146-21706168 GGCCCCTGCCTGCTACAAGCTGG - Intergenic
1145316146 17:21735990-21736012 GGGCCCATCCTGCCACCTGCTGG + Intergenic
1145401130 17:22533942-22533964 GGGCCCATCCTGCCACCTGCTGG - Intergenic
1145714576 17:27007915-27007937 GGGCCCATCCTGCCACCTGCTGG + Intergenic
1151744166 17:76002633-76002655 GGCCACAGGGTGCCACAGGCAGG + Intronic
1152189991 17:78882602-78882624 GGCCCCATCCTGCTAAAAGAAGG - Intronic
1158735719 18:60076070-60076092 GGCCCCACAGTGGCACATGCTGG - Intergenic
1162016824 19:7850735-7850757 GGCCTGGTAGTGCCACAAGCAGG + Intronic
1162720185 19:12657454-12657476 GCCCCCAGCCTGCCGCAAGCTGG + Exonic
1164570445 19:29371016-29371038 GGCCCCATGGAGCCACCAGCAGG + Intergenic
1165805893 19:38580351-38580373 GGCCCCATCCTGCCCCCAGCTGG + Exonic
937145431 2:119640295-119640317 GGCCCTCTTGTGCCACAGGCTGG + Intronic
946340926 2:219067961-219067983 ATCCCCCTCCTGCCACAAGCTGG - Intergenic
1172842801 20:37912184-37912206 GGCTCTGTCGTCCCACAAGCTGG - Intronic
1173337847 20:42127263-42127285 GGCTCCATCTTTCCTCAAGCAGG - Intronic
1175507607 20:59496981-59497003 GGTCCCACAGTGCCAGAAGCTGG + Intergenic
1176116542 20:63434104-63434126 GGCCCCACCGTCTGACAAGCGGG - Intronic
1179295618 21:40059758-40059780 GGCCCCATGTGGCCATAAGCTGG - Intronic
1180198202 21:46209704-46209726 GGCCACATCCTGCCCCAACCGGG + Intronic
1184194037 22:42914678-42914700 GGCCCAATCAAGCCACCAGCTGG + Intronic
950129706 3:10533776-10533798 GGCCCCATCATGTCACATGGTGG - Intronic
950656664 3:14440956-14440978 GACCCCATCGTCCCACCACCTGG - Intronic
951853129 3:27165447-27165469 GTTCCCATCGTATCACAAGCTGG + Intronic
954107791 3:48418655-48418677 GACCCCATGGGGCCACAAGTTGG + Intronic
961708269 3:128806773-128806795 GTCCCCATCCTGCCCCCAGCTGG + Intronic
966156612 3:176923222-176923244 AGCCCCATCTTGCAACAGGCAGG - Intergenic
969682152 4:8649407-8649429 GGCCCCATCGGCCCAGAATCTGG + Intergenic
969725953 4:8918147-8918169 GGCACCATTGTGCCACAGACAGG - Intergenic
971150213 4:24023448-24023470 GGCCCCTTGGTGCCACACACAGG + Intergenic
971756451 4:30714604-30714626 GGCCTCATCTAGCCACAAGGGGG + Intergenic
981751348 4:148095256-148095278 GGGCCCATCTGGGCACAAGCGGG - Intronic
986226883 5:5823868-5823890 GGCCCCATGTTTCCAAAAGCTGG - Intergenic
989491217 5:42057428-42057450 GGCCCCATCTAACCACAAGGTGG - Intergenic
993902674 5:93595299-93595321 CGCCCCTAAGTGCCACAAGCGGG - Intergenic
995903389 5:117094588-117094610 GTCCCGATCGTGCCACACTCGGG - Intergenic
997103639 5:130994852-130994874 GGCCCCTTTGTGGCAGAAGCAGG + Intergenic
1002057742 5:176608512-176608534 GGCCCCAGAGTGGCCCAAGCTGG - Intronic
1003668228 6:8131445-8131467 GGTCCCATAGTGACACCAGCTGG - Intergenic
1003785714 6:9484676-9484698 GGCCTCATGGTACCACAAACAGG + Intergenic
1006910538 6:37560613-37560635 GGCCCCATCCAACCACAAGGGGG - Intergenic
1007089246 6:39172048-39172070 GGCCCCATCATACCACACGCTGG + Intergenic
1011845664 6:91560591-91560613 GGCCCGATCGAGCCACAGGTGGG + Intergenic
1015485397 6:133764305-133764327 GGCTCCCTCATGCCACAGGCTGG - Intergenic
1021451193 7:20785118-20785140 GGCCCCCACGTCCCACCAGCTGG + Exonic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028317522 7:89421944-89421966 GGGCTCATAGGGCCACAAGCTGG - Intergenic
1032090103 7:128907304-128907326 GGCCCCATCCTGGCAGACGCAGG + Exonic
1032107560 7:129046921-129046943 GGCCCCACCTTGCCACAAATCGG + Intronic
1034331484 7:150287007-150287029 GGTCCCAGCATGCCACAAGCCGG + Intronic
1034666559 7:152822854-152822876 GGTCCCAGCACGCCACAAGCCGG - Intronic
1043751593 8:83943235-83943257 GGCCCCAGGGTGGCATAAGCTGG + Intergenic
1047361710 8:124175200-124175222 GGCCCCAGCTTGCAACAGGCAGG - Intergenic
1053426516 9:38013807-38013829 GGTCCCATGGAGCCACAGGCAGG - Intronic
1058720632 9:107760589-107760611 GGCCCCATAGTTCCTCAGGCAGG - Intergenic
1186061020 X:5707308-5707330 GGCCCCAACCTGCCACAATGTGG - Intergenic
1197406208 X:126054372-126054394 GGCCCCATCCAACCACAAGAAGG - Intergenic
1199532576 X:148867186-148867208 GGCCCCATCTTGCCTCAATGTGG - Intronic