ID: 901453711

View in Genome Browser
Species Human (GRCh38)
Location 1:9351730-9351752
Sequence AGGTGTGAACAAAAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901453708_901453711 -1 Left 901453708 1:9351708-9351730 CCTGCACAGCAAGGAGGTGGCTA 0: 1
1: 0
2: 1
3: 14
4: 178
Right 901453711 1:9351730-9351752 AGGTGTGAACAAAAGGAAGTTGG 0: 1
1: 0
2: 1
3: 33
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901453711 Original CRISPR AGGTGTGAACAAAAGGAAGT TGG Intronic
900252402 1:1678002-1678024 AGGTGTGAGAAACAGGAAATCGG - Intronic
900974832 1:6010611-6010633 GGCTGTGAACTAAAGGAACTGGG - Intronic
901453711 1:9351730-9351752 AGGTGTGAACAAAAGGAAGTTGG + Intronic
901546713 1:9963245-9963267 AAATCTGAACAAAAGCAAGTTGG + Intronic
902778919 1:18692192-18692214 AGGGGGGAAGAAAAGGAAGAAGG + Intronic
903337792 1:22636572-22636594 AGGTCTGAAGAAGGGGAAGTAGG + Exonic
903629958 1:24760793-24760815 TGCTGTGAAGAAAATGAAGTAGG + Intronic
908209167 1:61882095-61882117 AGCAGTGAACAAAATAAAGTCGG + Intronic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
912320144 1:108705428-108705450 AGGTGTCAACAAAAGTAGCTAGG - Intergenic
913328487 1:117648299-117648321 ATTTGTGAACAATAGGAGGTTGG + Intergenic
914926026 1:151888544-151888566 TGCTGTGAACAAAACAAAGTTGG - Intronic
915642646 1:157240981-157241003 AGCTGTGAACACAGGGAAGCTGG + Intergenic
916970394 1:170007276-170007298 AGGAGAGAATAGAAGGAAGTGGG + Intronic
919427192 1:197447499-197447521 AGGTGTAAACACCAGGAGGTGGG + Intronic
920680385 1:208068036-208068058 AGGTGTTCATAGAAGGAAGTGGG - Intronic
920868006 1:209769248-209769270 AGATGTGAACCAGAGGAGGTAGG + Intronic
921087629 1:211810947-211810969 AGGTGACAACAGAGGGAAGTAGG + Intronic
922429269 1:225531856-225531878 AGGTGAGAAAAAAAGTTAGTAGG - Intronic
923056454 1:230429668-230429690 AAATATGAAAAAAAGGAAGTGGG + Intergenic
923966164 1:239141290-239141312 AAGTCTTAATAAAAGGAAGTAGG + Intergenic
924149900 1:241118797-241118819 AAGTGAGAACAAAAGGTATTTGG - Intronic
924272093 1:242344493-242344515 ACGTGGGAGGAAAAGGAAGTAGG + Intronic
924324067 1:242877813-242877835 AGGTGTGTACACAAGGGGGTAGG + Intergenic
924448484 1:244156310-244156332 GGCTGGGAACAAAAGGCAGTGGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063908097 10:10801227-10801249 AGGTGTGGACAGAATGAACTTGG - Intergenic
1063981019 10:11451886-11451908 AGGTGGGAACAGACGGGAGTGGG - Intergenic
1064165087 10:12978955-12978977 ATTTGGGAACAAAAGGAAGGCGG - Intronic
1064709809 10:18111667-18111689 AGATGGGGACAAAAGGAGGTGGG + Intergenic
1065179325 10:23108774-23108796 AGCTGTGAAGAAGAGGAAGTTGG - Intronic
1065239557 10:23692574-23692596 AGTTGTGAACAGAAGGCAGTGGG + Intergenic
1065633016 10:27700750-27700772 AGTAGTGAACAAGAGGAAGGTGG + Intronic
1065867620 10:29927476-29927498 AGATGTCAACAAAAGAAACTGGG - Intergenic
1065965878 10:30769790-30769812 AGGTGTGAAGAAAAAGACATGGG - Intergenic
1066108522 10:32176681-32176703 AGGTGTTAAAAAATGGAAGAGGG + Intergenic
1066712574 10:38251645-38251667 ACGTGGGAGGAAAAGGAAGTAGG - Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1068807667 10:61217072-61217094 AGATGTCAACAAAAAGAAGATGG - Intergenic
1069700988 10:70425720-70425742 AGGAGTTAGCAAAAGGAACTGGG + Exonic
1071055182 10:81501913-81501935 AAGTGTAAAAAAAATGAAGTGGG - Intergenic
1072188290 10:93061920-93061942 AGTTGTGATCAAAAGGCAGCTGG + Intronic
1072188751 10:93064265-93064287 AGCTGTTAACACAAGGATGTTGG + Intronic
1072914167 10:99526998-99527020 AGGTGAGGAAGAAAGGAAGTGGG + Intergenic
1073021934 10:100452320-100452342 AGTAGTGAAAAAAAGGAAGGGGG - Intergenic
1074075179 10:110116620-110116642 TGGTCTGAACCAAAGGAACTTGG - Intronic
1074830831 10:117247469-117247491 AGGTGGGAAGAACAGGAAGCGGG - Intronic
1077252090 11:1565223-1565245 AGGTGTGACCACATGGCAGTGGG - Intronic
1078511341 11:11986400-11986422 TGGTGAGAACAAAAGAAAGTAGG + Intronic
1078820488 11:14875720-14875742 GGGTGTGAATAAAAGGAATATGG + Intergenic
1078879473 11:15433867-15433889 AGGTGCAAACAAAATGCAGTAGG + Intergenic
1079056761 11:17212885-17212907 AGGTGTGAATAGCAGGAGGTGGG + Intronic
1080325802 11:31071510-31071532 AGGTATGAATACAAGGAAGCAGG - Intronic
1081034111 11:38119911-38119933 AGGTTTGAGCAAAATGAAGAAGG + Intergenic
1081095647 11:38930896-38930918 AGGTGAGAACAATAGGCACTGGG - Intergenic
1081126047 11:39323361-39323383 TGGTAAAAACAAAAGGAAGTTGG + Intergenic
1083175825 11:60949830-60949852 AGGTGTCAACGAAAGGAAACTGG - Intronic
1086747948 11:90453787-90453809 AGGTGTGAACATAAAGAGGAAGG - Intergenic
1086943264 11:92819961-92819983 GGGTGTGAATATCAGGAAGTGGG - Intronic
1087247646 11:95858347-95858369 AGGTATGAAATAAAGGAAGCTGG - Intronic
1087306325 11:96493095-96493117 AGGTATTAAAAAAAAGAAGTGGG + Intronic
1088455602 11:110030034-110030056 CCTTGTGAACAAAAGGAAATGGG + Intergenic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1088764494 11:112962579-112962601 AAGTGTGAACAATAGGGAGCTGG + Intronic
1089468741 11:118704063-118704085 GGGTGTGAACACCAGGGAGTGGG + Intergenic
1089550152 11:119268731-119268753 AAGAAAGAACAAAAGGAAGTAGG + Intronic
1090214723 11:124951715-124951737 AGGTGTGAACACCAAGAGGTGGG + Intergenic
1090469733 11:126969474-126969496 AGGTGTGAACCAGGGGAAGAGGG + Intronic
1090629598 11:128634580-128634602 AGGGGGGAAAAGAAGGAAGTGGG + Intergenic
1090749993 11:129738134-129738156 AGGTTTCAAAAAAAGGAAGACGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093640388 12:21520817-21520839 AGGTGTGATCAATAGGAAGATGG - Intergenic
1093679806 12:21988770-21988792 AGCTGAGAACAAAAGGCACTGGG - Intergenic
1093777673 12:23096677-23096699 AGTTGTGAACCGAAGAAAGTGGG - Intergenic
1095267341 12:40175658-40175680 AAGAGTGAACAAAGTGAAGTGGG + Intergenic
1095770386 12:45948351-45948373 AGGTATTAAAAAAATGAAGTGGG - Intronic
1096665883 12:53164546-53164568 AGATGGGAACAAAAGACAGTGGG + Intronic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1098686013 12:73422486-73422508 AGGTGTGAGGAAACAGAAGTAGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1098893869 12:76035434-76035456 GGGTGGGAAGAAAAGGAAGGTGG + Intergenic
1099277335 12:80593553-80593575 AGTTGAGAACAAAAGCAATTTGG - Intronic
1100740801 12:97590025-97590047 AGGGGTGAACACAAGGTAGGTGG + Intergenic
1101740596 12:107496969-107496991 AGGTGTGAACTTAAGGTAGTAGG + Intronic
1101986662 12:109452452-109452474 AGGTGTGATGAACAGGAAGAGGG + Intronic
1102765822 12:115432044-115432066 AGGTGTGGAGAAAAGGACTTTGG - Intergenic
1102827417 12:115961161-115961183 TGGTCTGAAGAAAAGGATGTGGG + Exonic
1102833132 12:116026133-116026155 AGGAGTCAAAAAAAGGATGTCGG + Intronic
1102855931 12:116293429-116293451 AAATGAGAACAAAAGGTAGTTGG + Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103152151 12:118650142-118650164 AGGTGTGACAAAAAAGAAGAGGG - Intergenic
1103480041 12:121244945-121244967 AGCTGTCAGCAAAAGGAGGTGGG + Intronic
1104216015 12:126734678-126734700 ATGTGTGCAGAAAAGGATGTAGG - Intergenic
1104871641 12:132002785-132002807 AGGAGTGAACACCAGGAGGTGGG + Intronic
1104995440 12:132651586-132651608 GGGTGTGAACACCAGGAAGTGGG - Intronic
1105587254 13:21756663-21756685 ACTTGTGGACACAAGGAAGTGGG - Intergenic
1106001735 13:25729966-25729988 AGATGTGAACAAAAACAAGCTGG - Intronic
1106366453 13:29085459-29085481 AGGTGGGAACAATAGACAGTGGG - Intronic
1106487930 13:30189184-30189206 AGGTCTGAAAAGAAGGAAGATGG + Intergenic
1106934852 13:34706410-34706432 AGCTTTGAACAAAAGGATGAGGG + Intergenic
1107101581 13:36598862-36598884 AGGAATGACCATAAGGAAGTAGG + Intergenic
1109066709 13:57703437-57703459 AGGAGTGAGCAAAAGGAGATTGG + Intronic
1109950498 13:69497062-69497084 AGGAATGAGCAAAAGAAAGTGGG - Intergenic
1111601973 13:90485923-90485945 AGTTGAGAACAAAAGGCAGAAGG + Intergenic
1113112122 13:106834474-106834496 GGGTGTGAAAACTAGGAAGTGGG + Intergenic
1113351521 13:109533943-109533965 AAGTATGAAAAAATGGAAGTAGG - Intergenic
1116034148 14:39607748-39607770 AGGTGTGAATACTAGGAAGTGGG + Intergenic
1117327638 14:54683997-54684019 AGGAGTCAAGAAAAGGAAGAAGG + Intronic
1117498510 14:56329447-56329469 AGGTGTGCGTAAAAGGAAGAAGG + Intergenic
1120834944 14:89030984-89031006 AGGGGTGAAGCAAAGGAAGGGGG + Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121438628 14:93934961-93934983 AGGGGTGAACAATGGGAAGGTGG - Intronic
1124145351 15:27120022-27120044 ATGTGTGAACACCAGGAGGTGGG + Intronic
1124247698 15:28085020-28085042 GGGTGTGAACACCAGGAGGTGGG + Intronic
1125010345 15:34865454-34865476 AGGTGTGAGCAAAAGAAATAAGG + Intronic
1125176687 15:36830560-36830582 GTGTGTGAACAAGAGAAAGTTGG + Intergenic
1127602859 15:60555694-60555716 AGGTGGGAAGAAAAGGAAGGTGG + Intronic
1127967527 15:63934082-63934104 AGCTGTTAAAAAAAAGAAGTTGG - Intronic
1128899535 15:71408040-71408062 AGCTGGGAGCAAGAGGAAGTGGG - Intronic
1129861116 15:78862426-78862448 AGGTGGGAAAAAAAGCAAATTGG + Intronic
1130243195 15:82217703-82217725 AGGTGTGAACACTGGGAAGCAGG - Intronic
1130457257 15:84123587-84123609 AGGTGTGAACACCGGGAAGCAGG + Intergenic
1130763847 15:86850388-86850410 ATGTGTGAAAAACAGGAAGGGGG - Intronic
1131119426 15:89813679-89813701 AGGGGTGACCAGGAGGAAGTGGG - Intronic
1138524669 16:57596043-57596065 AGGTGTGAATACCAGGAGGTAGG + Intergenic
1138533863 16:57649433-57649455 TGGTGTGAACCAAAGGAGGCTGG + Intronic
1138573156 16:57888985-57889007 AGGCGTGAACACCAGGAAGGGGG - Intronic
1140571222 16:76108461-76108483 AGGTGTGAACACAAGGGGGCAGG - Intergenic
1142872245 17:2828525-2828547 AGGTGTGAAGATGAGGAAGGAGG + Intronic
1143286853 17:5796542-5796564 AGGTGAGAATGTAAGGAAGTTGG - Intronic
1143935479 17:10479953-10479975 AGATGTCACCAAAAGGAAATGGG - Intergenic
1144118656 17:12127827-12127849 ATGTGTGCACAAAAGTAAGCAGG - Intronic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1145754213 17:27379070-27379092 AAGAGTGAATAAAAGCAAGTAGG - Intergenic
1145846457 17:28042423-28042445 AGGTGTTTAGAAAAGGATGTGGG + Exonic
1146566798 17:33920524-33920546 AGGTGGGAACAATAGACAGTGGG + Intronic
1148536457 17:48443047-48443069 ACATGTGAGCAAACGGAAGTGGG - Intergenic
1149591117 17:57830739-57830761 AGGTTAGAACAAGAGGTAGTGGG - Intergenic
1150155292 17:62848130-62848152 AGGTGGCAACAAAAAGAAGAAGG + Intergenic
1151092882 17:71462816-71462838 AGATGAGAACAAAAAGAAATTGG - Intergenic
1152780643 17:82226150-82226172 AACTGGGAACAAAAGGAAGTTGG + Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1155422133 18:25667172-25667194 AGGTGTTATATAAAGGAAGTTGG - Intergenic
1155694669 18:28671115-28671137 AGGAGGGAACACAAGGAAGGAGG + Intergenic
1156111571 18:33733407-33733429 AGGTGTGGAGAAAAGGAAGAGGG - Intronic
1157320637 18:46631365-46631387 ACGTGTGAACCACAGGGAGTAGG + Intronic
1158150755 18:54366979-54367001 AGTGGTAACCAAAAGGAAGTAGG - Intronic
1158719438 18:59910852-59910874 AGTGGTGAAAAAAAGTAAGTGGG - Intergenic
1158751765 18:60270278-60270300 AGGTGGGAACAACAGAAACTGGG - Intergenic
1159333905 18:67038628-67038650 ATGTGTGAAAAACAGGAACTAGG + Intergenic
1159465612 18:68779271-68779293 AGGAGAGAACTATAGGAAGTAGG + Intronic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1162701477 19:12518488-12518510 AGATGTGAAAAAAAAGGAGTTGG + Intronic
1165338664 19:35194326-35194348 AGGTGTGGAGAAAGGGAATTGGG - Intergenic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
925581361 2:5414672-5414694 ACTTGTGACCAAAAGGAAATGGG + Intergenic
925632913 2:5913782-5913804 AGGAGTTAACTAAAGGAAGGAGG + Intergenic
926551402 2:14305915-14305937 AGCTGTGAAAAAATGGCAGTGGG + Intergenic
927205319 2:20605376-20605398 TGATGGGAACAAAAGGAAGGTGG - Intronic
927976365 2:27341627-27341649 AGGAGTGAACAAAATGATTTAGG - Intronic
928383713 2:30846075-30846097 AGGTCTGAAGAAAAGAGAGTTGG - Intergenic
928809980 2:35211826-35211848 AACTGTAATCAAAAGGAAGTTGG - Intergenic
929009083 2:37423462-37423484 AGGTGGGAAAAACAGGAATTGGG + Intergenic
930349038 2:50225645-50225667 AGGTAGGAATAAGAGGAAGTAGG + Intronic
930392384 2:50778543-50778565 TGGAATGAACAAAAGGAAGGTGG + Intronic
930568689 2:53056672-53056694 AGATGGGAACAATAGGAACTAGG + Intergenic
930845092 2:55895223-55895245 AGGTGTTAACAAAATGCAGATGG + Intronic
931897753 2:66752060-66752082 CGGTGTTAACAAAAGAAAGGAGG + Intergenic
935319910 2:101876314-101876336 AGGTGTGGAAATAAGGAAGGAGG + Intronic
936950090 2:117969021-117969043 AGGTGTGAACATCAGCAGGTGGG - Intronic
937159982 2:119751335-119751357 AGGTGTGTAAGAAAGGGAGTAGG - Intergenic
939234611 2:139475326-139475348 AGGCGTGAATACAAGGAAGCAGG - Intergenic
939299519 2:140317467-140317489 AGGTGGGAACACAAGGATGATGG + Intronic
939451718 2:142382790-142382812 TGGTGTGAAAAAAAAGAGGTAGG + Intergenic
941531042 2:166671777-166671799 AGGCGTCATCGAAAGGAAGTAGG - Intergenic
941542744 2:166806841-166806863 AGGTGTGATTATAAGGAGGTGGG + Intergenic
941932652 2:170957574-170957596 AGGGATGAAGAAAAGGAAGGAGG - Intronic
942321176 2:174737227-174737249 AGATTTGAAAAATAGGAAGTAGG + Intergenic
942993505 2:182232073-182232095 AGTGGTGAGGAAAAGGAAGTGGG + Intronic
944244154 2:197514956-197514978 AGGGTTTAACAACAGGAAGTTGG - Intronic
946770773 2:223086188-223086210 AGATGAGATCAAAAGGATGTGGG - Intronic
946884105 2:224205760-224205782 AGGTGAGAAGGAAAGGAAGATGG - Intergenic
946916414 2:224527485-224527507 TGGTGTGAACCAAAGGTAATAGG - Intronic
948025468 2:234772763-234772785 AGGAGAGAAGAAAAAGAAGTCGG - Intergenic
948264993 2:236629473-236629495 AGGTGTGAACCACTGGAAGCTGG - Intergenic
1169000903 20:2167349-2167371 AGGTGTCAACAAGAGGGACTTGG + Intronic
1169314441 20:4576791-4576813 AGGTGTGAAAACAAGGAGGTGGG + Intergenic
1170030690 20:11940788-11940810 AGGTATGCACAAAAGGAAGGAGG + Intergenic
1170251426 20:14288064-14288086 AGGTGTGACCACAGGGAGGTAGG + Intronic
1171749012 20:29029099-29029121 AGGTGTGAACAGGAGGCAGGAGG + Intergenic
1172155861 20:32823930-32823952 AGGTGGGAACAGAAGGAGTTAGG - Intronic
1172517586 20:35545696-35545718 GGGTGTGAATACTAGGAAGTGGG + Intronic
1172801592 20:37580011-37580033 AGGTGTGAACATGGGGAAATAGG - Intergenic
1172985551 20:38985395-38985417 AGGCTTAAAGAAAAGGAAGTAGG + Intronic
1173133765 20:40420955-40420977 AGGTGGGAATTCAAGGAAGTAGG + Intergenic
1173224961 20:41157063-41157085 AGGTGTGGCCAACAGGAACTTGG + Intronic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1175616671 20:60405586-60405608 AGGTGTGAATACCAGGAGGTAGG - Intergenic
1176955475 21:15097862-15097884 AGATGTGGAAAAAAGGAAGAAGG + Intergenic
1177709743 21:24758378-24758400 AGTTGTTCACAAAAGGCAGTTGG + Intergenic
1178905933 21:36636334-36636356 AGGATCCAACAAAAGGAAGTTGG - Intergenic
1181859302 22:25805833-25805855 AGGGGTTGACAAAGGGAAGTAGG - Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182362875 22:29757607-29757629 AGGTGTGAAAATCAGGAGGTGGG - Intronic
1183104177 22:35604364-35604386 AGGTGAGAGCAAAAGGAATAAGG - Intergenic
949151050 3:767349-767371 GGGTCTGAACACAAGGAGGTGGG + Intergenic
949280973 3:2346472-2346494 ACTTTTGAGCAAAAGGAAGTGGG - Intronic
949387878 3:3524613-3524635 AGGTTTGAACAAAGGTAACTTGG + Intergenic
949492146 3:4599544-4599566 AGGTGAGGACCAAAGGAAGTAGG - Intronic
950892013 3:16412611-16412633 AAGTGTGAACACCAGGAGGTGGG - Intronic
951331571 3:21375409-21375431 AAATGTAAACAAAAGGAATTGGG - Intergenic
952530368 3:34256595-34256617 AGGGGAGAAAAAAAAGAAGTAGG + Intergenic
952871795 3:37907070-37907092 AGGAAAGAACAAAAGGAAGTGGG - Intronic
952932166 3:38368821-38368843 AGGGGTGAACACCAGGAGGTGGG + Intronic
952979687 3:38724606-38724628 TGATGTGGACAAAAGAAAGTGGG + Intronic
954326900 3:49868901-49868923 AGGTGCGGACAAAAGCAATTTGG + Intronic
955234521 3:57127907-57127929 AGGTTTGAACTGAAGTAAGTGGG - Intronic
955326033 3:58009718-58009740 AGCTGAGAACTGAAGGAAGTGGG + Intronic
955894547 3:63685543-63685565 AGCTGTGACAAAGAGGAAGTTGG - Intergenic
956104480 3:65802637-65802659 AGGAATGAACAAAAGAAAGATGG - Intronic
956870384 3:73411454-73411476 AGGTGTGAGCAAAGGCAAGGTGG + Intronic
958082661 3:88766846-88766868 GGAAGTGAACAAAAGGAACTAGG + Intergenic
958553010 3:95640883-95640905 AGGGTTTCACAAAAGGAAGTTGG - Intergenic
959263438 3:104108974-104108996 AGGTGGGAAAAAAAGGTAGAAGG + Intergenic
959265535 3:104132723-104132745 AGCAGTGAAGTAAAGGAAGTGGG - Intergenic
959927670 3:111941926-111941948 AGGTGGGAAAAAGAGGAAGATGG - Intronic
960453805 3:117844437-117844459 AGTTGTGAACTGAAGGCAGTGGG - Intergenic
960863809 3:122180564-122180586 ATGTGTGAAGACAAGGAAGCTGG + Intergenic
960915853 3:122694163-122694185 AGCTGTGAACAAAAAGCTGTGGG + Intronic
961129540 3:124453254-124453276 TGGTGTGAAGGAAAGGAGGTAGG - Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
962908200 3:139824463-139824485 AGGTGTGTACCTAAGTAAGTGGG - Intergenic
963156290 3:142100675-142100697 AGGTGTGAAGAAAGGGAAGGAGG - Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
964870775 3:161311904-161311926 AAGTGACAAAAAAAGGAAGTTGG + Intergenic
965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG + Intronic
965706089 3:171509608-171509630 ATGTCTGAACCAAAGAAAGTGGG - Intergenic
967253099 3:187563196-187563218 AGATGTGAACACCAGGAGGTGGG + Intergenic
967549167 3:190769529-190769551 GGGTGTGAAGAATAGCAAGTGGG - Intergenic
967961943 3:194932483-194932505 AGGTGTGAGCAAGAGGATATTGG - Intergenic
970233520 4:13934549-13934571 AGATTTGACCAGAAGGAAGTAGG + Intergenic
970809203 4:20071861-20071883 AGGTGTGAACAAGAAAGAGTTGG - Intergenic
971014287 4:22471219-22471241 AAGTGGGAACATAAGGTAGTTGG - Intronic
971356151 4:25896927-25896949 AGTTGAAAACTAAAGGAAGTTGG + Intronic
971860568 4:32097824-32097846 ATGTGTAAGCAAAAGGAAATAGG - Intergenic
972703865 4:41521069-41521091 AGGTGGGAATAAAAGGAAAATGG - Intronic
972854197 4:43086768-43086790 AGGTGTGAGCATAATGAAATAGG + Intergenic
974246230 4:59322311-59322333 AGAAGTAAACAAAAGGAATTTGG - Intergenic
974655287 4:64811258-64811280 ATGTGTAAATAACAGGAAGTGGG + Intergenic
975376299 4:73650280-73650302 AGGTGTGGTTAAAAGGAAGGAGG + Intergenic
975395978 4:73873673-73873695 AGGTGTAAACATAATGAAGAGGG - Intergenic
975574137 4:75846373-75846395 GGGTGTGAACAAAATGAGGCTGG - Intergenic
976902255 4:90192806-90192828 AGGTGTGAATATAAGGCAGTAGG + Intronic
978040200 4:104051122-104051144 AGGTGTGAATCAAAGGAAGGAGG - Intergenic
978506410 4:109462702-109462724 GGGTGTGAATAACAGGAGGTGGG + Intronic
981528599 4:145732150-145732172 ATGTGGGAACTAAAGGAATTAGG + Intronic
984221480 4:176983046-176983068 AGGTGGGAACAATAGACAGTGGG - Intergenic
984807091 4:183761568-183761590 AGTTGTGAAGAAAAGAAAGTTGG + Intergenic
985745119 5:1642486-1642508 AGGTGTGGACAAAAAGTATTTGG + Intergenic
985921296 5:2978186-2978208 AGAGGAGAACAGAAGGAAGTAGG - Intergenic
986111227 5:4720646-4720668 GGGTGAGACCAAAAGGAAGCAGG - Intergenic
986376677 5:7139119-7139141 AGTTGTGGCCAAAAGGAGGTAGG - Intergenic
986456760 5:7927633-7927655 AGGTGTGCACAGAAGGCAGGTGG + Intergenic
986701341 5:10412479-10412501 GAGAGTGAAAAAAAGGAAGTGGG + Intronic
987026371 5:13930656-13930678 AGATGGGAACAAAAGCAAGCAGG + Intronic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987547514 5:19331965-19331987 AGGTGTGAATATCAGGAAGTTGG + Intergenic
988546038 5:32158384-32158406 AGTTGTGAACAAAGGGAAGTAGG - Intronic
988617337 5:32787668-32787690 AGGTGTGGAGATAAGGAATTTGG + Exonic
989290594 5:39760634-39760656 AGAGGTAAACAGAAGGAAGTGGG + Intergenic
990879436 5:60522851-60522873 AGATGTGATCAATAGGTAGTAGG - Intergenic
991947036 5:71908167-71908189 AGGTGTGAATACCAGGAATTGGG + Intergenic
992188515 5:74267284-74267306 AGCTATGAACAAAAGAAAGAAGG - Intergenic
992733340 5:79693784-79693806 AGCTGTGAACAAAATGAATAAGG + Intronic
993290296 5:86059596-86059618 TGGTGTGAACACCAGAAAGTTGG - Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994723992 5:103413468-103413490 AGGTGAGGAAAAAGGGAAGTCGG + Intergenic
995217086 5:109607843-109607865 AGGAGGGAAGAAATGGAAGTGGG + Intergenic
995588469 5:113673762-113673784 AGGAGTGACCAAAAGCAATTTGG - Intergenic
996584713 5:125072485-125072507 GGGTGTGAATAACAGGAAGTGGG + Intergenic
997257972 5:132443792-132443814 AGGTGTAACCAAAAGCCAGTAGG - Intronic
998904762 5:146893202-146893224 AGGTGTTAACCACTGGAAGTAGG - Intronic
999629866 5:153559867-153559889 AGGAGTGAACTCAAGGAAGTAGG - Intronic
1000233730 5:159338445-159338467 AGGTGGGAACAACATGGAGTGGG + Intergenic
1000500598 5:162044437-162044459 AAGTGAAAACAAAAGGAAATTGG - Intergenic
1001287258 5:170432914-170432936 TGGTGTAAAACAAAGGAAGTGGG + Intronic
1001490139 5:172149295-172149317 GGGTGGTAACAAAAGGAAGGAGG - Intronic
1001848740 5:174944145-174944167 AGGTGAGAACAGAAAGAAGAGGG + Intergenic
1001968608 5:175935214-175935236 AGGTGTGTGCAAAAGTAATTGGG + Intronic
1003258027 6:4490793-4490815 AGTTGTGAAGAAAGGGAAGAAGG + Intergenic
1003354569 6:5355118-5355140 AGGTGGGAGCTACAGGAAGTAGG - Intronic
1004803597 6:19178184-19178206 ACTTGTGAACAAATGGAAATGGG + Intergenic
1007821496 6:44563663-44563685 AGGGGACAACAAAAGGAAGATGG + Intergenic
1008786877 6:55178694-55178716 AGGTGTGAATAAAATGGTGTTGG + Intronic
1009977240 6:70684331-70684353 AGGGGTGAACAAAATAAAGAGGG + Intronic
1010043549 6:71415870-71415892 AGGTGTGCAAGAATGGAAGTGGG + Intergenic
1010051812 6:71513355-71513377 AGATGTGAATAAAAAGAAGAGGG + Intergenic
1010477659 6:76308323-76308345 AGGTGAGAACAGAGGGAAATGGG - Intergenic
1010665409 6:78624085-78624107 AGGTATAAGCAAATGGAAGTGGG - Intergenic
1010719513 6:79266563-79266585 ATTTCTGAAAAAAAGGAAGTTGG - Intergenic
1011709341 6:90036252-90036274 TGCTGGGAATAAAAGGAAGTAGG - Intronic
1012285636 6:97384485-97384507 AGGATTGAAAACAAGGAAGTTGG - Intergenic
1012624057 6:101384860-101384882 ATGTGTGAAAAAAATGAGGTAGG + Intergenic
1012937172 6:105380292-105380314 AGGTGTGAAGAAGAGTAAGGAGG + Intronic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1013834477 6:114317652-114317674 AGCTGTGAACAAAAGTAACATGG + Intronic
1015250916 6:131126808-131126830 AGGTTTGAACAAAGAGAAATCGG + Intergenic
1015807095 6:137120862-137120884 TGGTCTGAAAAAAAGTAAGTGGG - Intergenic
1016088929 6:139951482-139951504 AGGTGAGAACATATGGCAGTTGG - Intergenic
1016526243 6:145004714-145004736 AATTGTGAGCAAAAGGAACTTGG - Intergenic
1017592142 6:155989463-155989485 TGGTGTGAACCAGAGGAAGAGGG - Intergenic
1017636565 6:156449739-156449761 ACATGGGAACTAAAGGAAGTAGG + Intergenic
1018716678 6:166538455-166538477 AGGTGAGAACAAAATGCCGTTGG - Intronic
1020912921 7:14155806-14155828 AGGGGTGAAAACCAGGAAGTTGG + Intronic
1021006247 7:15397599-15397621 AGGTGGGGAGAAAAGGAAGAAGG - Intronic
1021034164 7:15776019-15776041 AGGTGAGTACAAAAGAAAGTAGG - Intergenic
1021348145 7:19553336-19553358 AGGTATTAATAAAGGGAAGTTGG - Intergenic
1022013446 7:26328936-26328958 AGGTGTGTACAAGGGGAAGGAGG - Intronic
1023920869 7:44628923-44628945 AGGTAGGAACAAAAGGGAGATGG - Intronic
1026210084 7:68296328-68296350 AAGGCTGAACAAACGGAAGTGGG + Intergenic
1028238428 7:88389085-88389107 ATGTGTGAAAAAAATGCAGTGGG - Intergenic
1030735519 7:113043429-113043451 AGGTGTGACAAACAGGAAGAAGG + Intergenic
1031169571 7:118275508-118275530 AGGTATTAAGAATAGGAAGTAGG - Intergenic
1031960366 7:127983959-127983981 AGGTGTAAACACAAGAAAGGAGG - Intronic
1036024695 8:4892358-4892380 TGGTGTGAACAAGAGCAAGGGGG + Intronic
1036610713 8:10347518-10347540 AGGTGGGAATAAAAAGAAATGGG - Intronic
1037324288 8:17673131-17673153 AGGCATGGACAAAAGCAAGTTGG + Intronic
1037653611 8:20863700-20863722 AGGTGTGAATACCAGGAGGTGGG + Intergenic
1037678021 8:21068624-21068646 AGGTGTGGACAAGAGAAAGTGGG + Intergenic
1041105746 8:54442500-54442522 TGGTGGAAACAAAAGGAAGATGG + Intergenic
1043344401 8:79283184-79283206 TGGTGTGAACAAAGGTAAGGAGG + Intergenic
1043548466 8:81341352-81341374 AGGTGTGGACAGAAGGAGCTAGG - Intergenic
1044848944 8:96409105-96409127 AGGTATGAAGAAAAGGAAATGGG + Intergenic
1045859221 8:106796820-106796842 AGGCATGAACAATAGGAGGTGGG - Intergenic
1047012060 8:120683458-120683480 AGGTGTCAAAAAAAGGGGGTGGG + Intronic
1047381466 8:124368143-124368165 AGGTGTGAATACAAGGGAGTGGG - Intronic
1047381492 8:124368426-124368448 AGGTGTGAATACAAGGGAGTGGG - Intronic
1047435211 8:124830269-124830291 AGTTGTCAAAAAAATGAAGTAGG - Intergenic
1047994066 8:130316700-130316722 AGGTGAGATCAAAAGGAAGGAGG + Intronic
1049042063 8:140119911-140119933 AGATGTGTATAGAAGGAAGTAGG - Intronic
1049501508 8:142970222-142970244 AAGTGGTAACAAAAGGAAGTGGG + Intergenic
1050191255 9:3029007-3029029 AACTGTGAACCAAAGGAAGAAGG + Intergenic
1052778907 9:32760533-32760555 TACTGTGAACAAAAAGAAGTGGG - Intergenic
1052793435 9:32899986-32900008 AAGTGTGAACCCAAGTAAGTGGG - Intergenic
1054744157 9:68837200-68837222 AGCAGTGAACACAAGGAACTTGG + Intronic
1056263174 9:84869288-84869310 AGGAGTGACCAAATGGAGGTTGG - Intronic
1056296744 9:85200935-85200957 AGATGTGAAAATCAGGAAGTAGG - Intergenic
1056570099 9:87807390-87807412 AGGAGGGAAAAAAAGGAAGAAGG + Intergenic
1057019251 9:91683207-91683229 AGGTGTGAACATCCGGATGTGGG + Intronic
1057040211 9:91842586-91842608 AGCTGTGGACAATTGGAAGTGGG - Intronic
1057380288 9:94561241-94561263 AGGTCAGAACAAAAGTAACTTGG - Intronic
1058337408 9:103848373-103848395 AAGTGTGAACACCAGGAGGTGGG - Intergenic
1058432797 9:104933696-104933718 AGGTGTTAATAAAAGGGAGGGGG - Intergenic
1058575680 9:106398769-106398791 GGCTGTGATCAAAAGGAAGGAGG + Intergenic
1060071048 9:120547732-120547754 GTGTGTGAACAAAAGGACATAGG + Intronic
1060220712 9:121762748-121762770 AGTTGTGAGCACAAGGAGGTGGG + Intronic
1060298614 9:122360586-122360608 AGGTGAGAAGATAAGGGAGTGGG + Intergenic
1060761618 9:126256361-126256383 AGGTATGAAAATAAGAAAGTGGG + Intergenic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061389712 9:130310663-130310685 GGGTGTGAACACGAGGAGGTGGG + Intronic
1061940558 9:133881554-133881576 AGCTGGGAACACAAGGAAGGGGG + Intronic
1185962486 X:4560371-4560393 AGCAGTGAGCAAATGGAAGTAGG + Intergenic
1186544590 X:10435594-10435616 GGGTGTGAACACCAGGAGGTAGG + Intergenic
1186999122 X:15157023-15157045 GGGTGTGAACACCAGAAAGTGGG - Intergenic
1187410929 X:19049982-19050004 TGGTGTGAACTAAGGGAAATTGG - Intronic
1187437803 X:19288605-19288627 AGGGGAGAAAAAAAGGGAGTGGG + Intergenic
1187570499 X:20496162-20496184 AGGGGTGAAGAGAGGGAAGTGGG - Intergenic
1187711976 X:22063442-22063464 AGCTGTGGAGAAGAGGAAGTTGG + Intronic
1188030721 X:25260480-25260502 GGGTGTGAACAACAGGAGGTGGG + Intergenic
1188567120 X:31539362-31539384 AGGTGTGAAGGAAGGGACGTAGG - Intronic
1189866660 X:45337147-45337169 AAGAGTGAACAAAATCAAGTGGG - Intergenic
1189979563 X:46495526-46495548 AGGGGTGGAAAAAATGAAGTGGG + Intronic
1190451146 X:50581987-50582009 GGGTGTGAACACCAGGAGGTGGG - Intergenic
1191955817 X:66641522-66641544 AGGTGTGAGCAAAAGGAGAGGGG - Intergenic
1192193317 X:69010741-69010763 AGGTGTGAATACGAGGAGGTAGG + Intergenic
1192452165 X:71251375-71251397 AGGAGGGAAGAAAAGGAGGTTGG + Intronic
1193701158 X:84762628-84762650 ATGTATGGACAAGAGGAAGTAGG - Intergenic
1195671078 X:107470667-107470689 GGGTGTGAACATCAGGAGGTGGG + Intergenic
1196145635 X:112313918-112313940 AAGGGAGATCAAAAGGAAGTGGG + Intergenic
1196268363 X:113680117-113680139 AGGTGGGAACAATAGACAGTAGG - Intergenic
1196287432 X:113898682-113898704 AGGTCTGAAAAAAAGGAGGGAGG + Intergenic
1196710936 X:118761913-118761935 TGGTGTGAACAAAATGTAGCAGG + Intronic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197629286 X:128839777-128839799 AGGGGAGAACAATAGGGAGTTGG - Intergenic
1197744414 X:129921591-129921613 AGCTGTGATCAAATGGAAGAGGG + Intronic
1198516785 X:137416670-137416692 AGGTGTGTACATAAGGCACTAGG + Intergenic
1198666724 X:139032335-139032357 AGGTTTTATAAAAAGGAAGTTGG - Intronic
1199619003 X:149682688-149682710 AGGAGTGAGCAAAAGGATTTGGG + Intergenic
1199943189 X:152643651-152643673 GGGTGTGAACAAAAGCTAGGAGG + Intronic
1200683145 Y:6236326-6236348 AAGTGTGGCCAAATGGAAGTGGG - Intergenic
1200838072 Y:7752475-7752497 AAGTGTGAACACCAGGAGGTAGG - Intergenic
1200960907 Y:8994977-8994999 AAGTGTGGTCAAATGGAAGTGGG - Intergenic
1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG + Intergenic