ID: 901457119

View in Genome Browser
Species Human (GRCh38)
Location 1:9369414-9369436
Sequence CTCTGGGCTGGTAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901457119_901457126 24 Left 901457119 1:9369414-9369436 CCTTCTTTCCTACCAGCCCAGAG 0: 1
1: 0
2: 2
3: 34
4: 309
Right 901457126 1:9369461-9369483 ACTCCCGTTCTATTTTATGATGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901457119 Original CRISPR CTCTGGGCTGGTAGGAAAGA AGG (reversed) Exonic
900635735 1:3664174-3664196 ATCTGGGCTGGTAGGAAGGTAGG - Intronic
900773167 1:4562025-4562047 ATCTGGGCTGGCAGGAAGGCTGG + Intergenic
900800960 1:4736835-4736857 GGGTGGGCTGGTTGGAAAGAGGG + Intronic
900950264 1:5854656-5854678 CTGGGGGCTGTTAGGGAAGAAGG - Intergenic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901457119 1:9369414-9369436 CTCTGGGCTGGTAGGAAAGAAGG - Exonic
901622977 1:10604117-10604139 CTCCCGTCTGGTAGGAAAGACGG + Intronic
902680368 1:18039704-18039726 AAGGGGGCTGGTAGGAAAGATGG + Intergenic
903948385 1:26978914-26978936 CACTGAGCAGGTAGGAGAGATGG + Intergenic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904890013 1:33772623-33772645 CTTTGAGCTGGTGGGACAGAAGG - Exonic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906245146 1:44268187-44268209 TCCTGGTCTGGTAGGGAAGATGG - Intronic
906567748 1:46812875-46812897 CTTTGGCCTGGGAGGAAAGAGGG - Intronic
907281199 1:53348578-53348600 ATCAGGGCTGGGAGGAAAGCAGG - Intergenic
909135997 1:71801019-71801041 TTGTAGGGTGGTAGGAAAGAAGG - Intronic
911659194 1:100481142-100481164 CTCTGGGCTGGTGGAATAGAAGG + Intronic
912222300 1:107691827-107691849 CTCTGTGCTGGCATTAAAGATGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912724373 1:112045536-112045558 CTCTTGGCCGGTAGGTAAAATGG - Intergenic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913209762 1:116572382-116572404 CCCTGGGCTGGTAGGAACTCAGG + Intergenic
914422476 1:147541875-147541897 CTCTGGGTTGGTGGGGGAGAAGG + Intronic
914445596 1:147747993-147748015 CTCTGGCCTGCTAAGATAGAAGG + Intergenic
914454396 1:147822333-147822355 CTCTGAGATGGTAGGAAGGTAGG - Intergenic
915583569 1:156830917-156830939 CTGGGGGCTGGTAGAAAAGAAGG - Intronic
915902265 1:159855426-159855448 CTCGGGGATGGAGGGAAAGATGG - Intronic
916018860 1:160775787-160775809 CTCTGGGGTGGCAGGAGACAAGG - Intergenic
916107627 1:161442616-161442638 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916109211 1:161450034-161450056 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916110797 1:161457415-161457437 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916112384 1:161464825-161464847 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916113970 1:161472206-161472228 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916427369 1:164693533-164693555 GTCAGGTGTGGTAGGAAAGAAGG - Intronic
917837735 1:178954125-178954147 CTGTGGGCTGGAAGCAATGACGG - Intergenic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918262240 1:182806518-182806540 CTTTGGGCTGAAAGGTAAGAGGG + Intronic
918377949 1:183928073-183928095 TTCTGTGCTTGTAGGAGAGATGG + Exonic
918410539 1:184253906-184253928 CTCATGTCTGGTAGGAAGGAAGG - Intergenic
919918144 1:202151824-202151846 TTATAGGCTGGTGGGAAAGAAGG - Intronic
920217387 1:204370608-204370630 CTCAGGGCTAGTGGGAAAGGTGG - Intronic
920568908 1:207001492-207001514 CACTGGGCTGGTGGAAGAGATGG + Intergenic
920741168 1:208582587-208582609 CTCTGGCCTTGTAGGAAATATGG + Intergenic
921291707 1:213663853-213663875 CTGTGGGCTGATGGGAAGGAGGG - Intergenic
921636108 1:217495605-217495627 TTCAGGGGTGGAAGGAAAGAGGG - Intronic
922356516 1:224781437-224781459 TTCTGGGCTTATAGGAAAGAAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
1063948365 10:11199507-11199529 GTCTGGGCTGGAAAGGAAGATGG + Intronic
1064285654 10:13989251-13989273 CTCTGGGCTGGTAGGTGTTAGGG - Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065795593 10:29304765-29304787 CTCAGGGCTGGGAGGCAGGAGGG + Intronic
1066025338 10:31352560-31352582 GGCTGGGGTGCTAGGAAAGAGGG + Intronic
1067735302 10:48845883-48845905 CTGTGGAGTGGTAGGCAAGAGGG + Intronic
1072702782 10:97656001-97656023 GTCTGTGCAGCTAGGAAAGAAGG - Intronic
1072899361 10:99393752-99393774 CTCTGGGTTGTTGGGGAAGAGGG - Exonic
1077433718 11:2528285-2528307 GGCTGGGCTGGAAGGAAGGAAGG + Intronic
1077663087 11:4086413-4086435 CTTTGGGCTGGCAGGTAAGGAGG - Intronic
1080240801 11:30125190-30125212 CTCTGGGCAGGTATGTCAGAGGG - Intergenic
1080384047 11:31800019-31800041 CTCTGGTCTGGGAGGAGAGATGG - Intronic
1082212758 11:49525534-49525556 CTCTGGGCTGGTTTGAACCAAGG + Intergenic
1083728388 11:64640305-64640327 CCCTGAGCAGGTAGGAAGGAGGG - Intronic
1084536217 11:69758767-69758789 CTTTGGGCTGGAAGGAGAGCTGG - Intergenic
1084966417 11:72746963-72746985 CGCTGGGCCAGTAGGAAAGCTGG + Intronic
1085121267 11:73969067-73969089 TTCTGCACTGGCAGGAAAGATGG - Intronic
1085805450 11:79631959-79631981 CTTTGGACTGGAAGGAAGGAAGG + Intergenic
1087970134 11:104470392-104470414 GGCTGGGCTGGTATGGAAGAGGG + Intergenic
1088813994 11:113409424-113409446 CTCTGCCCTGGTGGGTAAGAGGG + Intergenic
1088917910 11:114241005-114241027 CTCTGGGCCAGGAGGAAACATGG - Intronic
1089138178 11:116266041-116266063 CTCTGGGCTGGTGGGACCCAGGG + Intergenic
1089218669 11:116852383-116852405 CTCTGGGCTGGGAGTCAGGAAGG - Intronic
1091287381 11:134415249-134415271 CTCTTGGGTGGTAGCTAAGAAGG - Intergenic
1092132127 12:6120013-6120035 GTCAGGGCAGGTAGCAAAGATGG + Intronic
1092658089 12:10708939-10708961 CTCTGGGCTTCTAGGAAACAAGG - Intronic
1092874387 12:12835453-12835475 CTCTGGGCAGGTAAGAAATCAGG + Intergenic
1096488942 12:52003224-52003246 CTCTGGTCTGTCAGGAATGAGGG - Intergenic
1098886977 12:75970134-75970156 CTGTGGTCTGGAAGGAGAGAAGG - Intergenic
1100276162 12:93073646-93073668 CCAGGGGCTGGGAGGAAAGAGGG - Intergenic
1101472790 12:105013968-105013990 CTCTCGGCTGGCTGGCAAGATGG - Intronic
1102259712 12:111436594-111436616 CTCTGGGCTGGTCTGGAAGCAGG + Intronic
1102466283 12:113132627-113132649 CTCTGGGATGCCAGGAAAGAGGG + Intronic
1103054078 12:117804940-117804962 CTCTGGGCAGCAGGGAAAGATGG - Intronic
1103979390 12:124726708-124726730 CCCTGGGCTGGAAGGGAGGAGGG - Intergenic
1104761138 12:131298291-131298313 CTCGGGGCTGGGAGGAAACAGGG + Intergenic
1104818638 12:131662501-131662523 CTCGGGGCTGGGAGGAAACAGGG - Intergenic
1104996952 12:132664220-132664242 CACTGGGCAGGAAGGAAGGAGGG - Intronic
1104996963 12:132664259-132664281 CACTGGGCAGGAAGGAAGGAGGG - Intronic
1106559103 13:30833430-30833452 CTCTGGGAAGGAAGGAAAAAAGG - Intergenic
1107127199 13:36858448-36858470 CTCTGGGCTGATAGCAAGGCTGG + Intronic
1108420150 13:50240415-50240437 CTCTGGCCTGGAGGGAGAGAGGG - Intronic
1109652933 13:65353149-65353171 CTCTGGGCTGGTCTGAAACCTGG - Intergenic
1109652982 13:65353363-65353385 CTCTGGGCTGGTCTGAAACCTGG - Intergenic
1110141795 13:72139393-72139415 CTTTGGACTGTTAGGAGAGAGGG - Intergenic
1110721272 13:78765030-78765052 CTCGGGGCTAGTGGGGAAGAAGG - Intergenic
1112309384 13:98304510-98304532 CTCTAGGCTGGTGGAGAAGAGGG + Intronic
1112610087 13:100947292-100947314 CTCGAGGCTGGTAGGTAAGGAGG - Intergenic
1113585669 13:111462510-111462532 CTCTAGGCTGGCAGAGAAGACGG - Intergenic
1114369258 14:22067803-22067825 CTCCGTGCTGAGAGGAAAGATGG + Intergenic
1116982943 14:51190537-51190559 ATCTGGGCAGGGAGGAATGAGGG - Intergenic
1117793648 14:59367679-59367701 CTCTGACCTGGCAGGAAGGAAGG + Intronic
1118264174 14:64278693-64278715 ATCAGGGCTGGTACGAGAGAAGG + Intronic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1120252138 14:82070751-82070773 CTGTTGGCTGGTGGAAAAGAAGG - Intergenic
1120512075 14:85427122-85427144 ATCTGGGTTGGGAGAAAAGAGGG - Intergenic
1121446309 14:93981322-93981344 CTCTGAGCTGGCAGGTAAGCTGG - Intergenic
1121457384 14:94047059-94047081 CTGTGGGCTGGCCGGCAAGATGG + Exonic
1122953999 14:105061475-105061497 CACTGGGCTGGCCGGAGAGAGGG - Intronic
1123130188 14:105979149-105979171 CTCGGCGCTGGCTGGAAAGAGGG + Intergenic
1124585863 15:31006044-31006066 CTCTGTGCTGAAAGGAAAGCTGG - Intronic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1125360175 15:38856841-38856863 CTTTAGGTTGGCAGGAAAGAAGG + Intergenic
1125376288 15:39033348-39033370 CTGATGGCTGGTAGGAATGATGG + Intergenic
1125677258 15:41509081-41509103 CTCTGGGCTGATGGGGAAGATGG - Exonic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1126187048 15:45840935-45840957 CTCTGGGCTTGTAAATAAGAAGG - Intergenic
1127409480 15:58691627-58691649 CTCTGGGCTGGCAGAAGACAAGG - Intronic
1128879673 15:71231604-71231626 CTCTGAGCCTTTAGGAAAGAAGG - Intronic
1129238775 15:74239739-74239761 CTCTTGGCTGGGAGCAAAGCTGG - Intronic
1130316800 15:82803125-82803147 CTCTGGGGTCCCAGGAAAGAGGG - Intronic
1130906045 15:88241530-88241552 CTCTGGGCTGGAAAGGAGGAGGG + Intronic
1131223987 15:90608537-90608559 CTCTGAGCTGAGAGGAAGGAAGG - Intronic
1132583685 16:696668-696690 CTTTGGGGTGGGAGGAAAGAAGG - Intronic
1132590101 16:722867-722889 CCCTGGTCTGGTTGGAATGAAGG - Intronic
1133603600 16:7364247-7364269 CACTTGGCTGCCAGGAAAGACGG + Intronic
1133711731 16:8408181-8408203 ATCTGGGCTGCTGGAAAAGAAGG - Intergenic
1134239451 16:12494600-12494622 CTGTGAGCTGGTAGAGAAGATGG - Intronic
1134514372 16:14874808-14874830 ATCTGGGCTGGAATGAAATACGG - Intronic
1134702047 16:16273456-16273478 ATCTGGGCTGGAATGAAATACGG - Intronic
1134969784 16:18521194-18521216 ATCTGGGCTGGAATGAAATACGG + Intronic
1135188158 16:20332736-20332758 TTCTTGTCTGGTAGGAGAGAGGG - Intergenic
1135627320 16:24007387-24007409 CCATGGGCTGGTTGGAGAGAGGG + Intronic
1135717428 16:24783720-24783742 CTCTGTGCTAGTAGGAAGAAAGG - Intronic
1135929029 16:26721070-26721092 CTCTAGGTTGGTGGGAAATAAGG - Intergenic
1135995060 16:27241478-27241500 CCCTGGGCTGGGAAGAAGGAAGG + Intronic
1136654166 16:31699806-31699828 CTCTCGTCTGGCAGGAAAGGGGG + Intergenic
1137055132 16:35742051-35742073 CTCTGCCCAGGAAGGAAAGAAGG + Intergenic
1137602694 16:49767378-49767400 CTCTTGGCTGGGAACAAAGATGG - Intronic
1138416428 16:56874152-56874174 CTCTGAGCTGGGAGGGAATAGGG - Intronic
1139529083 16:67533418-67533440 TTCGGGGATGGGAGGAAAGAAGG + Intronic
1141681565 16:85547187-85547209 CCCAGGGCTGGTGGGACAGAGGG + Intergenic
1142672191 17:1492377-1492399 CTCTGGGCTGGGAGGAGGGTGGG - Intronic
1142905005 17:3035517-3035539 CTCTGAGCTGGTGGGCAGGATGG + Exonic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1146616175 17:34359006-34359028 CTCAGGATTGGTAGGGAAGAGGG + Intergenic
1146913545 17:36663674-36663696 CACTGGTCTGTTAGGGAAGACGG - Intergenic
1146936537 17:36815701-36815723 CTCTGGGCTGGGAGTCAAGGTGG + Intergenic
1148583707 17:48761757-48761779 CTCTGGGCTCCTAGCAAGGAGGG + Intergenic
1148687059 17:49506887-49506909 CTTTGGGCTGTTTGGAAAGTGGG + Intronic
1150292685 17:63990685-63990707 CTCTGGGCTGCCAGGAAAGATGG - Intergenic
1151470131 17:74312830-74312852 CTCTCCGCTGGTACAAAAGAGGG - Intronic
1151720665 17:75854134-75854156 CTCTGAGCGGGTAAGATAGAGGG + Intronic
1152584746 17:81183864-81183886 CTCTGGGCTGGTGGCACGGAGGG + Intergenic
1152913704 17:83020768-83020790 CCCAGGGCTGGAAGGAAACACGG + Intronic
1153912636 18:9717629-9717651 CTCTGGGAGGGAAGGACAGAGGG + Intronic
1155063319 18:22247563-22247585 GTCTGGGCTGGCAGGACAGGAGG - Intergenic
1156370393 18:36467472-36467494 CTCTGCCCTGGAAGGGAAGAAGG - Intronic
1156395107 18:36692099-36692121 CTTTGGGCTGGCAGGGAAAAGGG + Intronic
1156482216 18:37443422-37443444 CCCTGGGCTGGCAGGAGAGGAGG + Intronic
1158437790 18:57446101-57446123 CTCTGCCCTGGTAGGAAGGTTGG + Intronic
1159137687 18:64356209-64356231 CTTTGGCCAGGTAGAAAAGAAGG + Intergenic
1159898730 18:74022020-74022042 CTCTGGGCGGGTTGCAAGGATGG - Intergenic
1161482913 19:4519609-4519631 CACTGGGCTGGGAGGAGGGAGGG + Intergenic
1161865847 19:6831685-6831707 CTCCAGCCTGGTAGGAGAGACGG - Intronic
1162199573 19:9010659-9010681 CTCTGGGCTTGAAGGAAAACAGG + Intergenic
1162366019 19:10250246-10250268 CCCTGGACTGGTAGGGAAGCCGG + Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165103920 19:33457438-33457460 CTGTGGGCTGGCAGGGATGAGGG + Intronic
1166847114 19:45735323-45735345 CTCTGGGATTGCAGGAAGGATGG - Intronic
1167152722 19:47719162-47719184 GTCTGGGCAGGCAGGAAGGATGG + Intronic
1167192733 19:48003000-48003022 TTCTTGGCTGGTCGGAAAAAGGG - Intronic
1167414413 19:49362561-49362583 CTCGGGGCTGGTAGGAACTCAGG + Intronic
1168118488 19:54239506-54239528 CTCTGGGACACTAGGAAAGAAGG - Intronic
1168187425 19:54709023-54709045 CTGTGGGCTCCTAGGAGAGAAGG - Intergenic
1168310885 19:55459943-55459965 CTCTGGCCTGGTAGGAGTGTGGG + Intronic
925744039 2:7029797-7029819 TTCTGAGCTTGTGGGAAAGAAGG - Intronic
926344723 2:11934844-11934866 CTCTGAATTGGGAGGAAAGATGG + Intergenic
926753264 2:16216505-16216527 CTCTCTGTTGGTAGGAAAGACGG - Intergenic
927884999 2:26712925-26712947 CTCTGGGCTGGCAGGGAATTTGG - Intronic
928894397 2:36243996-36244018 CTGTGGCGTGGTAGGCAAGATGG - Intergenic
929450656 2:42034916-42034938 CTCTCGTCTGGGAGGACAGAAGG + Intergenic
929573795 2:43039804-43039826 CCCTGGGCTGGTAGGAGAACTGG - Intergenic
929610105 2:43264696-43264718 CTCTGGATTGGGAGAAAAGAAGG + Intronic
934163833 2:89276249-89276271 TTCAGGGCTCATAGGAAAGATGG - Intergenic
934203439 2:89906275-89906297 TTCAGGGCTCATAGGAAAGATGG + Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
936134393 2:109876933-109876955 CTCATGGCTGGTGGAAAAGAAGG + Intergenic
936210304 2:110494552-110494574 CTCATGGCTGGTGGAAAAGAAGG - Intergenic
936497124 2:113032087-113032109 CTCTGGGTTGAGAGGAAGGAGGG + Intronic
937094810 2:119228539-119228561 CTCTGGACTGGCCAGAAAGAAGG + Intronic
937392706 2:121504787-121504809 ATCTGGGCTTGGTGGAAAGATGG - Intronic
938901291 2:135800547-135800569 CATTAGGCTGGAAGGAAAGATGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
944960686 2:204869322-204869344 CCCTGGGCTGCTAGGCAAGGAGG - Intronic
945285660 2:208078851-208078873 CTCTGGGCTGGTACTGAGGAGGG - Intergenic
946039724 2:216773323-216773345 CTCTGTGGTGGTAGGAGATAAGG + Intergenic
947574390 2:231261041-231261063 CCCTGGGCTGGAAGGAGAGCCGG - Intronic
1168806241 20:673953-673975 CTGAGGGCTGGCAGGACAGAGGG - Intronic
1168991632 20:2101529-2101551 CACTGGGCTGGTAGAAGGGAAGG + Intergenic
1169087580 20:2836894-2836916 CTTTGGATTGGCAGGAAAGAGGG - Intronic
1169343718 20:4814308-4814330 ATCTGAGCTTGTAGGAAACAGGG - Intronic
1171304760 20:24095759-24095781 CTCTGGGCTGAAAGGAAACTTGG - Intergenic
1171749259 20:29031917-29031939 CTCCTGGCAGGTAAGAAAGAAGG + Intergenic
1171976147 20:31596000-31596022 CTCTGGGCTGGTGAGAGAAAGGG + Intergenic
1172782859 20:37447561-37447583 GGCTGGTCTGGGAGGAAAGAAGG - Intergenic
1172838167 20:37886318-37886340 CTCTGGGCTGGGAGGCGGGATGG + Intergenic
1173686119 20:44924430-44924452 GTCTGGGCTGGAGGGGAAGAGGG + Intronic
1174936042 20:54869882-54869904 CTGTGTGCTGGAAGGACAGAGGG + Intergenic
1175013776 20:55766209-55766231 CTCTAGGCCAGTGGGAAAGATGG - Intergenic
1176015368 20:62928362-62928384 CTCTGGACTTGCAGGAAGGAAGG - Intronic
1178292964 21:31385412-31385434 CTGTGGGCTGCTACGAAAGAAGG + Intronic
1179961729 21:44771277-44771299 CTCTGTGCTGGTACCAAACAAGG - Exonic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1183728145 22:39600778-39600800 CCCTGGGCTGGGAGGAATGATGG + Intronic
1185336495 22:50272922-50272944 CACTGGGCAGTCAGGAAAGAAGG - Intergenic
950457106 3:13099389-13099411 CTCAAAGCTGGTAGGAAAAATGG + Intergenic
951506306 3:23449026-23449048 CTTTGGGCTGTTAGGTAAGAGGG - Intronic
952768561 3:36976699-36976721 CTCTCGGCTGAGAAGAAAGAGGG - Intergenic
952775345 3:37040732-37040754 CTCAAAGCTGGGAGGAAAGAAGG - Intronic
954573579 3:51662516-51662538 CTCTGGGCTGTCAGGAGAGACGG - Exonic
959743441 3:109748069-109748091 CTCTGGACTGTTTGGAAACACGG + Intergenic
961365206 3:126395164-126395186 CACAGGGATGGTAGGACAGATGG - Intronic
961531385 3:127542393-127542415 CCCTGGGCTGGAAGGAAACCAGG + Intergenic
961617433 3:128193869-128193891 CTCTGGCATGGGAGGACAGAAGG + Intronic
962747270 3:138406194-138406216 CTCTGGGCTGGAGGCAGAGAAGG + Intergenic
963974076 3:151461044-151461066 CTCTGGGAGGGAAGGAAGGAAGG + Intergenic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
965728159 3:171742169-171742191 GACTGGGGTGGGAGGAAAGATGG + Intronic
965731542 3:171777442-171777464 CTCTGGGCAATTAGGAAAGAAGG - Intronic
965756747 3:172035123-172035145 CTCAGAGGTGGTAGGAAAGAAGG + Intergenic
967464918 3:189793612-189793634 ATCTGAGCTGGTAGAATAGAGGG + Intronic
968274169 3:197427136-197427158 CTCTGAGCTGCTTGGAAATAGGG - Intergenic
969858884 4:10020709-10020731 ATCGGGGCTGGGAGCAAAGAAGG - Intronic
971935213 4:33138825-33138847 CTCGGGGCTCTTAGGAAAAATGG - Intergenic
972737260 4:41854819-41854841 CACTGGGCTGTTTGGCAAGAAGG - Intergenic
975127662 4:70800244-70800266 TTCTGGGGTGGTGGGAAGGAGGG + Intronic
975219607 4:71799264-71799286 CGCTGAGCTGGGAGGCAAGAAGG - Intronic
976414264 4:84753684-84753706 CTCAGAGATGGTAGGAAAGGGGG - Exonic
977527064 4:98158441-98158463 TTCTGGGCTGGATGGAAAGCAGG - Intergenic
979028116 4:115603215-115603237 CCCTAGGCTGGTAGGAAATAGGG - Intergenic
980873133 4:138632916-138632938 CTCAGGGGTGGCAGTAAAGATGG - Intergenic
981121493 4:141056471-141056493 GTGTGGGCTGGTGGGAGAGATGG + Intronic
981495743 4:145390494-145390516 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
982233908 4:153234303-153234325 TTCAGGGGTGGGAGGAAAGAAGG + Intronic
982361982 4:154528652-154528674 CTCTGTGCTGGAAGGAGGGAAGG + Intergenic
982558299 4:156897523-156897545 CTCTGTCCTGATAGGAAAGGTGG - Intronic
982810859 4:159824409-159824431 CTGTGGGCTAGTAGGAGACAAGG - Intergenic
986462808 5:7990493-7990515 CTCAGGGCTGGCAGGGAGGAAGG - Intergenic
986828539 5:11549374-11549396 CTCTGCTCTGATGGGAAAGAGGG - Intronic
987139375 5:14929715-14929737 CTTTGGATTGGTGGGAAAGAGGG + Intergenic
987753373 5:22069241-22069263 CTTTGGACTGGTGGGAAACATGG - Intronic
988392938 5:30659088-30659110 CTATGGCCTGTTAGGAAAGTGGG - Intergenic
988973139 5:36489439-36489461 CTTAGGCCAGGTAGGAAAGAGGG + Intergenic
991176517 5:63694289-63694311 CTCTGGGAGGGTAGGAACGTGGG + Intergenic
993360701 5:86971780-86971802 CTCTGCAGTGGTAGGAAAGATGG - Intergenic
996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG + Intergenic
997667497 5:135643416-135643438 CTCTGGGCTGGAAGTAAGGGTGG + Intergenic
997719920 5:136070100-136070122 CTCTGGGCTGGGAGGAAAGGGGG + Intergenic
999467601 5:151822420-151822442 CTGAGGGCTGGGAGGAAAGGAGG - Intergenic
999484749 5:151984630-151984652 CTCTGGGCTGGTACAGCAGAGGG + Intergenic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1001186102 5:169574339-169574361 ATTTGGGATGGTAGGAAGGAAGG + Intergenic
1002679649 5:180950683-180950705 CCCTGAGCTGGGAGGGAAGAAGG + Exonic
1003105469 6:3211734-3211756 GTGTGTGCTGGCAGGAAAGAGGG - Intergenic
1003736392 6:8882480-8882502 CTCAGGGCTGGGTGGAGAGATGG + Intergenic
1004995806 6:21191852-21191874 CTCAGGGCTGCTGGGAAACACGG - Intronic
1005050950 6:21683460-21683482 CTCTAGGCTTTTAGAAAAGAGGG - Intergenic
1005232949 6:23725406-23725428 CTCTGGAATGGTAGAAAATAAGG - Intergenic
1005419599 6:25635251-25635273 CTATGGGCTGGGAAGAAAGATGG - Intergenic
1005975713 6:30797057-30797079 CTCTGTGCTGGTAGGAGGGGAGG + Intergenic
1006410294 6:33869869-33869891 TGCTGGCCTGGTAGGAAGGATGG - Intergenic
1006991656 6:38220088-38220110 CTCTGGGCTGGTGGCAATGGAGG + Intronic
1007572839 6:42905645-42905667 CACTTGGCTGGCAGGAAAGGAGG - Intergenic
1007801920 6:44401581-44401603 CTCTGAGCTGGGGGGAAGGAGGG + Intronic
1008636603 6:53417198-53417220 CTCTGGGCTGGAATGAAGGTAGG + Intergenic
1010958278 6:82116506-82116528 TTCTAGGCTTGTAGGAAGGAAGG + Intergenic
1011363579 6:86554498-86554520 CTCTGAGCTGGTTGCACAGATGG + Intergenic
1011895800 6:92223369-92223391 TTTTGGGATGGTAGGTAAGATGG + Intergenic
1013292189 6:108729120-108729142 CTCCGGGCTAGTAAGAAAGCCGG + Intergenic
1013656608 6:112253550-112253572 CTCTGTGCTGTTAGGACAGTGGG - Intronic
1014292530 6:119575664-119575686 CTCTGTGCTGATGGGAAAGGAGG - Intergenic
1016845528 6:148564793-148564815 CTCTGCGCTGTCAGGACAGATGG + Intergenic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1018788221 6:167125448-167125470 CTCTGTGGTGGTAGCAAAGAGGG - Intronic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019927409 7:4202442-4202464 CTCAGGGCTGCTAGAAGAGAAGG + Intronic
1020309750 7:6858928-6858950 GTCTGGGCTGGTGGGGAACAGGG - Intergenic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1021929126 7:25562149-25562171 CTCTGGGCTGGCAGGGACGGGGG - Intergenic
1022465944 7:30653324-30653346 CTCCAGCCTGGCAGGAAAGAGGG - Exonic
1022748114 7:33193561-33193583 CTCTGATTGGGTAGGAAAGAAGG - Intronic
1023864472 7:44232309-44232331 CTCTGGGGTGGTGGGAGGGATGG - Intronic
1025035099 7:55588946-55588968 CTCTGGGCTGGAAGGAGGCAGGG - Intergenic
1026011231 7:66638232-66638254 CTCTAAGCAGGAAGGAAAGAGGG - Exonic
1029252743 7:99248746-99248768 CTCTGGGCTGGTAGAAAGAGTGG + Intergenic
1032498637 7:132382190-132382212 CTCTGGGCTTCAGGGAAAGAAGG - Intronic
1032790438 7:135238498-135238520 CTCTGGGCTTGTAGGGAATCTGG - Intronic
1033024691 7:137760848-137760870 CTCTGGACTGGAAGGAAGGAGGG - Intronic
1034066534 7:148142185-148142207 CCTTGAGCTGGTAGGAAGGATGG + Intronic
1034975728 7:155448455-155448477 CTCTGGGCTGGTGGGAAGTGTGG + Intergenic
1036579513 8:10061027-10061049 CTCTGGGCAGGATGCAAAGAGGG - Intronic
1037829695 8:22180165-22180187 CACTGGGCTGGGAGGTAGGATGG + Intronic
1038007279 8:23443001-23443023 CTCAGGACAGGTTGGAAAGAGGG - Intronic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1041516135 8:58700699-58700721 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
1043822011 8:84878209-84878231 CTCAGGGCTGGTAGACAATAAGG + Intronic
1044630705 8:94275883-94275905 ATCTGGGCTGGCAGCAAGGATGG - Intergenic
1046954741 8:120051827-120051849 CTCTTGGCTGTGAGGAAGGAAGG + Intergenic
1047174102 8:122524197-122524219 CTCTTGGCTGGTAAGGAATAGGG - Intergenic
1047401713 8:124553749-124553771 TTCTGGGCTGGGAGGACAAAAGG + Intronic
1049479619 8:142815669-142815691 TTCTGGGTGGGAAGGAAAGAGGG - Intergenic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049653939 8:143789578-143789600 CTCTGGGCTGGTTTGGAACAAGG - Intergenic
1051371711 9:16364717-16364739 CTGTGGCCTGGTAGGCAGGAGGG - Intergenic
1052670455 9:31550936-31550958 CTCTGGGATGGAAGGAGAAATGG + Intergenic
1053202776 9:36164046-36164068 CTCTGTGCTGGTGGGTCAGATGG - Intergenic
1053414451 9:37938249-37938271 CTCCTGGCTGGTAGGAATGGTGG + Intronic
1058577635 9:106420784-106420806 TTGTGGTCTGGCAGGAAAGAGGG + Intergenic
1058824350 9:108761464-108761486 CTCTGGACTGGAAGGGAACATGG + Intergenic
1059050941 9:110924935-110924957 CTATAGTCTGGTAGGAAGGATGG - Intronic
1060211339 9:121712361-121712383 CTTTGGGCTGCCAGAAAAGAGGG - Intronic
1060474504 9:123976661-123976683 CACTGGACTGGGAGGAAAGAAGG - Intergenic
1060476859 9:123993462-123993484 CACTGGACTGGGAGGAAAGAAGG + Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1061001438 9:127905057-127905079 CTCTGGGCTTGGAGGAAGTAGGG + Intronic
1061264971 9:129499583-129499605 CCCTGGGATGGAAGCAAAGAGGG + Intergenic
1061945340 9:133905582-133905604 CTCCAGGCTGGCAGGAAGGAAGG - Intronic
1062694895 9:137868786-137868808 CTCTGGGCAGGTGGGGAAGGGGG + Intronic
1191585891 X:62826498-62826520 CTCTGGGGTGGTGTCAAAGAAGG - Intergenic
1192773281 X:74215793-74215815 CCCTGTGCTGTTAGGGAAGAGGG - Intergenic
1193551099 X:82893625-82893647 GTCTGGGCATGTAGCAAAGAGGG - Intergenic
1193720500 X:84979930-84979952 TTCTGGGCTGGTAAGAAATAGGG - Intergenic
1195724420 X:107899459-107899481 CTTTGGGCTGGGAGGTAATAGGG + Intronic
1196481833 X:116159193-116159215 TTTTTGGCTGGCAGGAAAGATGG + Intergenic
1197703849 X:129619549-129619571 CTTTGGCCAGGAAGGAAAGAAGG - Intergenic
1197775708 X:130117504-130117526 CTCTGGGATGGTGGGAAATTTGG + Intergenic
1197842842 X:130768475-130768497 GGCTGGGGTGGTTGGAAAGAGGG - Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1202150973 Y:21843519-21843541 CCCTAGGCTGGTAAGAAACATGG + Intergenic