ID: 901457575

View in Genome Browser
Species Human (GRCh38)
Location 1:9372064-9372086
Sequence CGGGCTGATAATGATTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901457571_901457575 4 Left 901457571 1:9372037-9372059 CCAGAGAACAGCTGCTGCTGTTG No data
Right 901457575 1:9372064-9372086 CGGGCTGATAATGATTTTCCTGG No data
901457569_901457575 18 Left 901457569 1:9372023-9372045 CCTTTCTTCCTGGGCCAGAGAAC 0: 1
1: 0
2: 4
3: 86
4: 1077
Right 901457575 1:9372064-9372086 CGGGCTGATAATGATTTTCCTGG No data
901457570_901457575 10 Left 901457570 1:9372031-9372053 CCTGGGCCAGAGAACAGCTGCTG 0: 1
1: 1
2: 1
3: 40
4: 344
Right 901457575 1:9372064-9372086 CGGGCTGATAATGATTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901457575 Original CRISPR CGGGCTGATAATGATTTTCC TGG Intergenic
No off target data available for this crispr