ID: 901459459

View in Genome Browser
Species Human (GRCh38)
Location 1:9383066-9383088
Sequence GGGCAGCTAAATGCACACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901459453_901459459 7 Left 901459453 1:9383036-9383058 CCACTTTACAGATGAAGACACCG No data
Right 901459459 1:9383066-9383088 GGGCAGCTAAATGCACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901459459 Original CRISPR GGGCAGCTAAATGCACACTG AGG Intergenic
No off target data available for this crispr