ID: 901463202

View in Genome Browser
Species Human (GRCh38)
Location 1:9404098-9404120
Sequence GTGTGCATAAGGACCGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901463195_901463202 21 Left 901463195 1:9404054-9404076 CCTGTGGGCTGAGCAGGAAGTAG No data
Right 901463202 1:9404098-9404120 GTGTGCATAAGGACCGAGGGTGG No data
901463198_901463202 -2 Left 901463198 1:9404077-9404099 CCTAGCAAAGCAGGGAGAACAGT No data
Right 901463202 1:9404098-9404120 GTGTGCATAAGGACCGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901463202 Original CRISPR GTGTGCATAAGGACCGAGGG TGG Intergenic
No off target data available for this crispr