ID: 901468976 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:9442407-9442429 |
| Sequence | TTCGGTCTTAAAATACTTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901468976_901468977 | -6 | Left | 901468976 | 1:9442407-9442429 | CCATCAAGTATTTTAAGACCGAA | No data | ||
| Right | 901468977 | 1:9442424-9442446 | ACCGAAGCTTCACATTCTCAAGG | No data | ||||
| 901468976_901468979 | -5 | Left | 901468976 | 1:9442407-9442429 | CCATCAAGTATTTTAAGACCGAA | No data | ||
| Right | 901468979 | 1:9442425-9442447 | CCGAAGCTTCACATTCTCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901468976 | Original CRISPR | TTCGGTCTTAAAATACTTGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||