ID: 901468976

View in Genome Browser
Species Human (GRCh38)
Location 1:9442407-9442429
Sequence TTCGGTCTTAAAATACTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901468976_901468977 -6 Left 901468976 1:9442407-9442429 CCATCAAGTATTTTAAGACCGAA No data
Right 901468977 1:9442424-9442446 ACCGAAGCTTCACATTCTCAAGG No data
901468976_901468979 -5 Left 901468976 1:9442407-9442429 CCATCAAGTATTTTAAGACCGAA No data
Right 901468979 1:9442425-9442447 CCGAAGCTTCACATTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901468976 Original CRISPR TTCGGTCTTAAAATACTTGA TGG (reversed) Intergenic
No off target data available for this crispr