ID: 901469215

View in Genome Browser
Species Human (GRCh38)
Location 1:9443955-9443977
Sequence ACCATGGGCACAGCCCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901469197_901469215 23 Left 901469197 1:9443909-9443931 CCTCATCCCCCCACCTCCTTCTC No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469198_901469215 17 Left 901469198 1:9443915-9443937 CCCCCCACCTCCTTCTCCCCTTA No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469206_901469215 0 Left 901469206 1:9443932-9443954 CCCTTACCCCTCCTCTTTCCTTC No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469207_901469215 -1 Left 901469207 1:9443933-9443955 CCTTACCCCTCCTCTTTCCTTCA No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469203_901469215 10 Left 901469203 1:9443922-9443944 CCTCCTTCTCCCCTTACCCCTCC No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469205_901469215 1 Left 901469205 1:9443931-9443953 CCCCTTACCCCTCCTCTTTCCTT No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469211_901469215 -8 Left 901469211 1:9443940-9443962 CCTCCTCTTTCCTTCACCATGGG No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469209_901469215 -7 Left 901469209 1:9443939-9443961 CCCTCCTCTTTCCTTCACCATGG No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469199_901469215 16 Left 901469199 1:9443916-9443938 CCCCCACCTCCTTCTCCCCTTAC No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469208_901469215 -6 Left 901469208 1:9443938-9443960 CCCCTCCTCTTTCCTTCACCATG No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469201_901469215 14 Left 901469201 1:9443918-9443940 CCCACCTCCTTCTCCCCTTACCC No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469204_901469215 7 Left 901469204 1:9443925-9443947 CCTTCTCCCCTTACCCCTCCTCT No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469202_901469215 13 Left 901469202 1:9443919-9443941 CCACCTCCTTCTCCCCTTACCCC No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data
901469200_901469215 15 Left 901469200 1:9443917-9443939 CCCCACCTCCTTCTCCCCTTACC No data
Right 901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901469215 Original CRISPR ACCATGGGCACAGCCCGTCT TGG Intergenic
No off target data available for this crispr