ID: 901473772

View in Genome Browser
Species Human (GRCh38)
Location 1:9475225-9475247
Sequence ATTGAGCAACCCAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901473761_901473772 25 Left 901473761 1:9475177-9475199 CCAGCCTGCTGGGGACCAGAAGT No data
Right 901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG No data
901473768_901473772 -8 Left 901473768 1:9475210-9475232 CCACGGCCGGCTTGCATTGAGCA No data
Right 901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG No data
901473767_901473772 -5 Left 901473767 1:9475207-9475229 CCACCACGGCCGGCTTGCATTGA No data
Right 901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG No data
901473762_901473772 21 Left 901473762 1:9475181-9475203 CCTGCTGGGGACCAGAAGTCGTC No data
Right 901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG No data
901473766_901473772 -4 Left 901473766 1:9475206-9475228 CCCACCACGGCCGGCTTGCATTG No data
Right 901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG No data
901473763_901473772 10 Left 901473763 1:9475192-9475214 CCAGAAGTCGTCATCCCACCACG No data
Right 901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901473772 Original CRISPR ATTGAGCAACCCAAGGAAGA GGG Intergenic
No off target data available for this crispr