ID: 901474120

View in Genome Browser
Species Human (GRCh38)
Location 1:9477372-9477394
Sequence CCTTCTGTACTTAAGTTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901474117_901474120 12 Left 901474117 1:9477337-9477359 CCTTAGAGGCTGTTTACTTTTGA No data
Right 901474120 1:9477372-9477394 CCTTCTGTACTTAAGTTAGTTGG No data
901474115_901474120 29 Left 901474115 1:9477320-9477342 CCTGAAGGCAGAACTAGCCTTAG No data
Right 901474120 1:9477372-9477394 CCTTCTGTACTTAAGTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901474120 Original CRISPR CCTTCTGTACTTAAGTTAGT TGG Intergenic
No off target data available for this crispr