ID: 901476719

View in Genome Browser
Species Human (GRCh38)
Location 1:9495081-9495103
Sequence CTCCCAGGACACACCCCAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901476719_901476731 3 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476731 1:9495107-9495129 CGGAGGGGCAGAGCGGGGAGGGG No data
901476719_901476726 -3 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476726 1:9495101-9495123 GAGAGCCGGAGGGGCAGAGCGGG No data
901476719_901476736 25 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476736 1:9495129-9495151 GAGGGGCTTGGTCTTCGTCCTGG No data
901476719_901476725 -4 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476725 1:9495100-9495122 GGAGAGCCGGAGGGGCAGAGCGG No data
901476719_901476732 6 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476732 1:9495110-9495132 AGGGGCAGAGCGGGGAGGGGAGG No data
901476719_901476733 7 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476733 1:9495111-9495133 GGGGCAGAGCGGGGAGGGGAGGG No data
901476719_901476734 8 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476734 1:9495112-9495134 GGGCAGAGCGGGGAGGGGAGGGG No data
901476719_901476737 26 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476737 1:9495130-9495152 AGGGGCTTGGTCTTCGTCCTGGG No data
901476719_901476730 2 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476730 1:9495106-9495128 CCGGAGGGGCAGAGCGGGGAGGG No data
901476719_901476735 13 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476735 1:9495117-9495139 GAGCGGGGAGGGGAGGGGCTTGG No data
901476719_901476727 -2 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476727 1:9495102-9495124 AGAGCCGGAGGGGCAGAGCGGGG No data
901476719_901476728 1 Left 901476719 1:9495081-9495103 CCGCTTGGGGTGTGTCCTGGGAG No data
Right 901476728 1:9495105-9495127 GCCGGAGGGGCAGAGCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901476719 Original CRISPR CTCCCAGGACACACCCCAAG CGG (reversed) Intergenic
No off target data available for this crispr