ID: 901480330

View in Genome Browser
Species Human (GRCh38)
Location 1:9520625-9520647
Sequence CTGTGCAGACGCAGCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901480330_901480334 -4 Left 901480330 1:9520625-9520647 CCTTCTGGGCTGCGTCTGCACAG No data
Right 901480334 1:9520644-9520666 ACAGTCTCCCTGGGGCCCTGTGG No data
901480330_901480335 -3 Left 901480330 1:9520625-9520647 CCTTCTGGGCTGCGTCTGCACAG No data
Right 901480335 1:9520645-9520667 CAGTCTCCCTGGGGCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901480330 Original CRISPR CTGTGCAGACGCAGCCCAGA AGG (reversed) Intergenic