ID: 901483079

View in Genome Browser
Species Human (GRCh38)
Location 1:9539510-9539532
Sequence GGCCACGCCGCGGAAGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901483065_901483079 17 Left 901483065 1:9539470-9539492 CCCGCCGGGCTCGCGCCGCAGAG 0: 2
1: 0
2: 1
3: 9
4: 96
Right 901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG 0: 2
1: 0
2: 0
3: 10
4: 110
901483068_901483079 13 Left 901483068 1:9539474-9539496 CCGGGCTCGCGCCGCAGAGGCCG 0: 2
1: 0
2: 0
3: 15
4: 148
Right 901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG 0: 2
1: 0
2: 0
3: 10
4: 110
901483064_901483079 18 Left 901483064 1:9539469-9539491 CCCCGCCGGGCTCGCGCCGCAGA 0: 2
1: 0
2: 3
3: 6
4: 90
Right 901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG 0: 2
1: 0
2: 0
3: 10
4: 110
901483066_901483079 16 Left 901483066 1:9539471-9539493 CCGCCGGGCTCGCGCCGCAGAGG 0: 2
1: 0
2: 0
3: 12
4: 83
Right 901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG 0: 2
1: 0
2: 0
3: 10
4: 110
901483074_901483079 -7 Left 901483074 1:9539494-9539516 CCGGTGAGGCGCCGGCGGCCACG 0: 1
1: 1
2: 0
3: 8
4: 117
Right 901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG 0: 2
1: 0
2: 0
3: 10
4: 110
901483071_901483079 2 Left 901483071 1:9539485-9539507 CCGCAGAGGCCGGTGAGGCGCCG 0: 1
1: 1
2: 0
3: 14
4: 130
Right 901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG 0: 2
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901483079 Original CRISPR GGCCACGCCGCGGAAGGCGC GGG Exonic
900483433 1:2910342-2910364 GGCCACTCAGCTGAAGGGGCAGG - Intergenic
900513353 1:3070368-3070390 CGCCTCACCGCGGATGGCGCCGG - Intronic
900566522 1:3334911-3334933 TGGCCCTCCGCGGAAGGCGCAGG - Intronic
901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG + Exonic
902336464 1:15757676-15757698 GGCCACCCCGCAGATGGCGCTGG + Intronic
904557303 1:31373480-31373502 GCCCACGCCGGGGAAAGCTCTGG + Intronic
905038222 1:34930539-34930561 GGCCACGGTGGGGAAGCCGCAGG + Intergenic
907430154 1:54406707-54406729 GTCCACGCCGCGGGGAGCGCGGG - Intronic
912315146 1:108661353-108661375 GTCAACGGCGCGGCAGGCGCAGG - Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918064392 1:181089527-181089549 GGGCACACCGCGGGCGGCGCGGG - Exonic
1063369602 10:5512516-5512538 GCCCACGGCGAGGAAGGGGCGGG - Intergenic
1075032109 10:119030335-119030357 GGCGACGCCGCGCGAGGAGCGGG + Exonic
1076351323 10:129816710-129816732 GGCAACGCCGGGGAAGGGTCGGG + Intergenic
1082206002 11:49434599-49434621 GGCCACGCCGCGGAAGGCGCGGG - Intergenic
1083880323 11:65545229-65545251 GGGCAGGCTGCGGAAGGCGTTGG - Intronic
1084175673 11:67421045-67421067 GGCCGCGCCGCGGCTGGGGCCGG + Exonic
1085050259 11:73376679-73376701 GGCCGGTGCGCGGAAGGCGCCGG - Intronic
1085076764 11:73598289-73598311 GGGCTCGCGGCGGGAGGCGCAGG - Intergenic
1095825874 12:46530642-46530664 GCCCACCCCGTGGAGGGCGCCGG + Intergenic
1099304364 12:80936846-80936868 GCCCAGGCTGCGGAAGGCGCGGG - Intronic
1102310582 12:111841989-111842011 GCCATCGCCGCGGAAGGCCCAGG + Intronic
1103722146 12:122980782-122980804 GGCGAGGCCGCGAAGGGCGCGGG + Exonic
1104892839 12:132148665-132148687 GGCCAGGCCGGGGAGGGGGCGGG + Intronic
1106597671 13:31161098-31161120 GGGGCGGCCGCGGAAGGCGCAGG + Intronic
1108618627 13:52159584-52159606 GCCCGCCCCGCGGAAGCCGCCGG - Exonic
1111672644 13:91348635-91348657 GGCCACGGCGGGGAAGTTGCGGG - Intergenic
1112693107 13:101917494-101917516 AACCAAGCCGCGGAAGGCTCGGG - Intronic
1113881488 13:113629162-113629184 GGGCACGCAGAGGAAGGTGCAGG + Intronic
1117131863 14:52695314-52695336 GTGCACGCCGCGGAGGGCGCCGG + Intronic
1117392013 14:55271508-55271530 GGCCAGGCCGCGGCCGGGGCAGG + Exonic
1121453849 14:94026462-94026484 GGGAATGCCGCGGGAGGCGCGGG - Exonic
1121767746 14:96502315-96502337 GGCTTCGCGGCGGACGGCGCTGG + Intronic
1122582187 14:102777745-102777767 GGCCCCGCCGCCCAGGGCGCGGG - Intronic
1125181797 15:36887404-36887426 AGCCCCGCCGCGGAAGAGGCAGG + Intergenic
1127922423 15:63504281-63504303 GGAAACGCCGCGGACGGCCCGGG + Intergenic
1128224661 15:65993578-65993600 GGCCACGTCGGGGAGGGTGCAGG - Intronic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1129710910 15:77819855-77819877 GGCGGCGCCGCGGAGGGGGCCGG - Intronic
1132941651 16:2511518-2511540 GGCCAGGCAGCGGCAGGGGCAGG + Intronic
1133130933 16:3675789-3675811 GGCCACGCAGAGGAAGGAGGAGG + Intronic
1133232098 16:4371783-4371805 GGGCCCGCCGCGGCAGGGGCGGG - Intronic
1137624775 16:49900684-49900706 GGCCACACAGCAGAAGGAGCAGG - Intergenic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1142395349 16:89828572-89828594 GGCGGCGCCGCGGCGGGCGCAGG + Exonic
1144604621 17:16653679-16653701 GGCCACGCCCCGGACGCCGCCGG + Intronic
1144952868 17:19003607-19003629 GGTCACGCCGCGGTAGGCGATGG + Exonic
1151383499 17:73741396-73741418 GGCCAAGCCGCTGAAGGTGAAGG - Intergenic
1151785003 17:76271168-76271190 GGACACGCAGCGGGAGGGGCAGG - Exonic
1152686064 17:81694406-81694428 GGCCAGGCCGCTGCAGGCCCAGG + Intronic
1153457392 18:5295781-5295803 GGCCAGGGTGCGGAAGGGGCTGG - Intronic
1160934064 19:1584910-1584932 GGGCACAGAGCGGAAGGCGCAGG - Intronic
1161219893 19:3113661-3113683 GGCCACGCCTTGGCAGGAGCCGG + Intronic
1161618011 19:5283053-5283075 GGCCACGGAGCGGGAGGCTCAGG - Intronic
1162398365 19:10430811-10430833 GGCCCCGCCTCGGCGGGCGCTGG - Intronic
1163320565 19:16572318-16572340 GGCCACGGCGCGGGGGGCCCGGG - Exonic
1163492796 19:17626683-17626705 GGCCACGCTGCTGCAGGCACTGG + Exonic
1163845776 19:19637490-19637512 GGCCAGGGCGGCGAAGGCGCGGG + Exonic
1165157286 19:33796282-33796304 GGCTGGGCCGCGGAGGGCGCTGG + Intronic
1165803232 19:38565571-38565593 GGAGACGCCGCGGAGGGCGCTGG + Exonic
1166317891 19:41998906-41998928 GGCCAGGCCGCGGCCGGGGCGGG + Exonic
1166800088 19:45451232-45451254 AGCCACAGCGCGGGAGGCGCTGG - Intronic
930751763 2:54941430-54941452 GGCTACGCTGAGGAAGGAGCTGG - Intronic
946422023 2:219570667-219570689 GGCCGCGCCGAGGACGGCCCCGG - Exonic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
948853021 2:240717635-240717657 GGGCAGGCTGCGGAAGGAGCTGG - Intronic
1168973541 20:1947383-1947405 GGCCGCACCACGGAATGCGCAGG - Intergenic
1169316199 20:4592758-4592780 GGCCACGCCGGGAACGCCGCCGG + Intergenic
1170678891 20:18507663-18507685 GGCAACGGTGCGGCAGGCGCCGG + Exonic
1171972479 20:31573016-31573038 GGCCAGGGCGCGGGAGGCGGAGG + Intronic
1172273500 20:33667532-33667554 GGCCAGCCCGCTGAACGCGCCGG - Exonic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172838306 20:37886919-37886941 GGCTGGGCCGGGGAAGGCGCTGG + Intergenic
1172951979 20:38728185-38728207 GACCACGGCGCGGATGGAGCCGG - Exonic
1174053855 20:47785253-47785275 GCTCACGCCGGGGAAGGCTCCGG + Intronic
1174342360 20:49905931-49905953 GGCCTTGCTGGGGAAGGCGCTGG + Exonic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1177834046 21:26170536-26170558 TGCCGCGCCTCGGAAGGCGGGGG - Intronic
1178948357 21:36966513-36966535 GGCCGCGCCGCAGAAGGTGAAGG + Intronic
1179713801 21:43277555-43277577 GGCCACTCCCCGGCAGGCCCTGG + Intergenic
1181599316 22:23939984-23940006 GGCCGCGCTGCAGAAGGGGCCGG - Intergenic
1181609191 22:24001319-24001341 GGCCGCGCTGCAGAAGGGGCCGG + Intergenic
951078547 3:18425274-18425296 GGCCCCGCTGGGGAAGGCTCCGG - Intronic
959594451 3:108114229-108114251 AGCCACCCCGCGAAAGGGGCTGG - Intergenic
961735930 3:129002153-129002175 GGCGGCGGCGCGGACGGCGCAGG - Exonic
967859797 3:194141874-194141896 GGCCACGCCGGGGCAGGAGTGGG + Intergenic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
985708373 5:1414451-1414473 GGGCAGGGCGGGGAAGGCGCTGG + Intronic
985708390 5:1414489-1414511 GGTCAGGGCGGGGAAGGCGCTGG + Intronic
985722117 5:1494845-1494867 GGCCACCCGGTGGAAGCCGCCGG + Exonic
996442996 5:123512613-123512635 GGCCGCGCCGAGGCAGCCGCCGG - Intronic
997228652 5:132227816-132227838 GGCGACGCCGCGGGAGGTTCTGG - Intronic
1002896205 6:1381987-1382009 CGCCACCCCGCGGAAGCCGGAGG + Intergenic
1002991868 6:2245732-2245754 GGCCACCGCGCGGGAGGGGCGGG + Intergenic
1003569467 6:7246744-7246766 GGCGACGGCGAGGCAGGCGCCGG + Exonic
1006097485 6:31665247-31665269 GGCCACGTTGAGGAAGGCGAAGG - Intronic
1015626002 6:135181497-135181519 GGCCATGGCGCGGCGGGCGCGGG - Exonic
1016894334 6:149037594-149037616 GGCCAGGCCGCCGCAGGCACAGG - Intronic
1019544665 7:1568065-1568087 GGCGGGGCTGCGGAAGGCGCTGG - Intronic
1019577945 7:1746542-1746564 GGCCTCGGCTCGGAAGGCGCGGG - Exonic
1022164020 7:27740293-27740315 GGCCGCCCCGCACAAGGCGCTGG - Intronic
1025206375 7:56995687-56995709 GGCCAGGCCGGGGAGGGGGCTGG + Intergenic
1026817342 7:73522740-73522762 GGCCACGCCCGGGGATGCGCGGG + Intergenic
1026953807 7:74364408-74364430 GGCCCCCCCGGGGAAGGGGCTGG + Intronic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1038568760 8:28641725-28641747 GGCCACGCGGCGGAGGGGGTCGG - Intronic
1049638902 8:143705523-143705545 GGCCAGGCCCCGGGAGGTGCTGG + Intronic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1055654659 9:78440371-78440393 GGCCACCCCGCTGATGGGGCCGG + Intergenic
1060407098 9:123378252-123378274 GGCATCGCCGGGGAAGGGGCTGG - Exonic
1061858029 9:133453842-133453864 TGCCAAGCCGCGGAAGGCACGGG + Intronic
1062230592 9:135479787-135479809 GGCCGCGCCGTGGGAAGCGCGGG - Exonic
1062560404 9:137139181-137139203 GGCGGCTCCGCGGACGGCGCTGG - Intronic
1185831843 X:3310349-3310371 GGCCACGCAGCGGTAGGCCCCGG + Exonic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1189534726 X:41923924-41923946 GACCAAGCCGCGAAAGGGGCTGG + Intergenic
1190730978 X:53225237-53225259 GGACACCCCGCGGAAGGATCCGG - Exonic
1192657089 X:73003384-73003406 GGCCACCCCGGGGGAGGCGGAGG + Intergenic
1192665031 X:73079617-73079639 GGCCACCCCGGGGGAGGCGGAGG - Intergenic
1201244160 Y:11986731-11986753 GGCCACGCAGCGGTAGGCCCCGG - Intergenic