ID: 901489266

View in Genome Browser
Species Human (GRCh38)
Location 1:9588596-9588618
Sequence CCCGCGCCGCCTTCCACCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901489258_901489266 -8 Left 901489258 1:9588581-9588603 CCGTGCCCCGCCCTCCCCGCGCC 0: 2
1: 1
2: 38
3: 236
4: 1944
Right 901489266 1:9588596-9588618 CCCGCGCCGCCTTCCACCTCCGG 0: 1
1: 0
2: 4
3: 12
4: 240
901489257_901489266 3 Left 901489257 1:9588570-9588592 CCTACAGGGCTCCGTGCCCCGCC 0: 1
1: 0
2: 0
3: 20
4: 187
Right 901489266 1:9588596-9588618 CCCGCGCCGCCTTCCACCTCCGG 0: 1
1: 0
2: 4
3: 12
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901489266 Original CRISPR CCCGCGCCGCCTTCCACCTC CGG Intergenic
900180217 1:1307949-1307971 CCCGCCCCGCCTGTCACCGCCGG + Exonic
900191394 1:1353733-1353755 CCCGGGGCCCCTGCCACCTCAGG - Intronic
900996553 1:6126288-6126310 CCTGCCCCACCCTCCACCTCTGG + Intronic
901443361 1:9292787-9292809 CCCGCCCCGCCCCCGACCTCGGG - Intergenic
901443438 1:9293063-9293085 CCCGCGCCGCCTACCGCGCCCGG - Exonic
901489266 1:9588596-9588618 CCCGCGCCGCCTTCCACCTCCGG + Intergenic
904026279 1:27505581-27505603 TCAGCGCCTCCTTCCACCTGCGG + Intergenic
904039262 1:27575019-27575041 CCCGCCCCGCCTCCCAACTGCGG - Intronic
904608921 1:31714704-31714726 CCCCCACCACCTCCCACCTCGGG - Intergenic
904768992 1:32870687-32870709 CCCGCGCCGCGCTCCGCCTGTGG - Exonic
905569371 1:38991578-38991600 CGAGCGGCGCCTTCCAACTCCGG + Exonic
908195485 1:61742708-61742730 CCGGCGGCGCCCTCCACCTCCGG - Intronic
909496586 1:76285907-76285929 CCCGCGCCCCCTCCCCCATCTGG + Intronic
910314870 1:85871260-85871282 CCAGCTCCTCCTTGCACCTCTGG - Intronic
912481478 1:109984996-109985018 CCCCCGCCTCTTTCCCCCTCTGG - Exonic
913504216 1:119501214-119501236 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
915457626 1:156051214-156051236 CCTGCCCAGCCCTCCACCTCTGG - Exonic
916070711 1:161168106-161168128 CCAGCGCCGCCTTGGACCTGAGG + Exonic
916836202 1:168548082-168548104 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1062856690 10:783399-783421 CCAGCGCCGCCGTCCACCCTGGG + Intergenic
1062920741 10:1277667-1277689 CCAGCTCCTCCTTCTACCTCTGG - Intronic
1065157876 10:22889192-22889214 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
1065398701 10:25271067-25271089 TCCGAGCTGCCTCCCACCTCAGG + Intronic
1066787927 10:39026515-39026537 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
1067168844 10:43887833-43887855 CCCACACCTGCTTCCACCTCTGG - Intergenic
1067937784 10:50625216-50625238 CCCTCGCCAACTTCCGCCTCTGG - Intergenic
1069386252 10:67885216-67885238 CCCCAGCCGCCCTCAACCTCAGG - Intronic
1070822888 10:79373019-79373041 CCAGACCCGCCTTCCTCCTCTGG - Intergenic
1070912682 10:80132465-80132487 CCCGCCCCGCCTTCCCTCCCGGG + Intronic
1073084499 10:100879535-100879557 CCAGAGCCTCCTGCCACCTCTGG + Intergenic
1074503006 10:114043556-114043578 CCCGCGCCCCCTTCCGCGCCTGG - Intergenic
1075611376 10:123857538-123857560 TCCACGCCGCCTTCCATCGCTGG - Intronic
1076721942 10:132396776-132396798 CCCGGGCCCCCCTCCCCCTCCGG - Intergenic
1077285753 11:1764469-1764491 CCCGCTCCGCCCTCTCCCTCTGG + Intergenic
1077366625 11:2163815-2163837 CCCTGGCCTCCTTCCTCCTCTGG - Intergenic
1078066194 11:8081042-8081064 ACCGCGCCGGCTCCCACCTTCGG - Intronic
1082617315 11:55376839-55376861 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1083372159 11:62190682-62190704 CCCGCGCCTCCTCCTATCTCTGG + Intronic
1083494478 11:63038895-63038917 CCAGCGCCTCCTTTTACCTCTGG + Intergenic
1084003928 11:66313502-66313524 CCAGCTCAGCCTTCCAGCTCAGG + Intergenic
1084151248 11:67289009-67289031 CCGGCCCCGCCTTCCTCTTCCGG + Intronic
1085182382 11:74546657-74546679 CCCGCCCAGCCTACCACCACTGG - Intronic
1086437978 11:86800457-86800479 CCCGCCCCGCCTCCGGCCTCGGG - Exonic
1091133549 11:133167151-133167173 CCCGAGCAGCCTTCCAGCGCCGG - Intronic
1091339671 11:134800626-134800648 GCCGCCTCTCCTTCCACCTCTGG + Intergenic
1091558598 12:1594202-1594224 CCCTCCCCGCCTTCCGGCTCCGG + Intronic
1092045953 12:5432006-5432028 GCCGCGCCGCCCTCCCCCGCCGG - Intergenic
1092230690 12:6773930-6773952 ACCGCGCCGCGGTGCACCTCAGG + Exonic
1092533117 12:9361567-9361589 CCCGAGCTGCCTTCCAGCTGTGG - Intergenic
1092999343 12:13980804-13980826 GCAGCGCCGCCTCCCACCCCGGG + Intergenic
1095167543 12:38991230-38991252 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
1095825836 12:46530486-46530508 CCCGGGCCCACCTCCACCTCAGG - Intergenic
1100363344 12:93897822-93897844 CCCCCCCCGCCTTCCCCCACAGG + Intergenic
1100652060 12:96601533-96601555 CCAGCTCCTCCTTCTACCTCTGG + Intronic
1100653262 12:96613926-96613948 CCCGCTCCTCCTTGTACCTCTGG - Intronic
1101702553 12:107188619-107188641 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
1102339152 12:112108359-112108381 CCGGAGCCGGCTTCCACCTTCGG + Intronic
1102465892 12:113130693-113130715 CCAGCCCTGCCTTCCCCCTCTGG - Intronic
1102949945 12:117024728-117024750 CCAGCCCTGCCTTCCACCTGTGG - Intronic
1104052807 12:125207661-125207683 CCATCGCCGCCATCCATCTCTGG + Intronic
1104985291 12:132593226-132593248 CCCGGGCCTCCTCCCGCCTCCGG + Intergenic
1114269022 14:21090391-21090413 CCCGCCGCGCCTTCCACCTCTGG + Exonic
1114525872 14:23366479-23366501 TCCCCGGCGCCTTCCTCCTCCGG + Intergenic
1114649036 14:24271486-24271508 CCCGCGCCTCCTCCCAGCGCAGG - Exonic
1117302278 14:54441362-54441384 CCTGCGCCGCCTTTCTCCGCTGG - Exonic
1118285261 14:64465373-64465395 CCCGCGCCGCCCCGCGCCTCCGG + Intronic
1119456867 14:74763613-74763635 CCCGCGGCCCCCTCCTCCTCGGG + Exonic
1120675425 14:87416123-87416145 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
1120891567 14:89496421-89496443 CCCGCGCCACCTTCCTTCCCAGG + Intronic
1122217667 14:100214614-100214636 CCCGCCCCGCCCTCCTCCCCGGG + Intergenic
1122544118 14:102512924-102512946 CCCCCTCCGCCCTCCACCTGGGG - Intergenic
1122749376 14:103921421-103921443 CCCCCGCCGTCTCGCACCTCGGG + Intronic
1202946899 14_KI270726v1_random:36259-36281 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
1123717416 15:23041871-23041893 CCCCCGCCGCCCAGCACCTCTGG - Intergenic
1124613255 15:31223593-31223615 CACGCGCCGCTCTCCGCCTCTGG - Intergenic
1124835784 15:33194862-33194884 CCCGCCTCCCCTGCCACCTCGGG - Intergenic
1126392549 15:48175301-48175323 CCCCTGCTGCCCTCCACCTCTGG - Intronic
1128998709 15:72316054-72316076 CCCTCTCTGCCTCCCACCTCTGG + Intronic
1129294052 15:74589976-74589998 CCAGCGCCGCCTTCACCCTCAGG + Exonic
1130577669 15:85106690-85106712 ACTGCTCCGCCTTCCATCTCTGG - Intronic
1131144019 15:90000361-90000383 GCCTCGCCGCCCTCCAGCTCCGG - Intergenic
1134644989 16:15858440-15858462 CCAGCGCCGCATACCAGCTCTGG + Intergenic
1136908625 16:34126897-34126919 CCAGCTCCGCCTTGTACCTCTGG + Intergenic
1139826642 16:69762446-69762468 CCCGCGCCGCCCGCCGCCCCCGG - Intronic
1141561732 16:84873005-84873027 GCCGCGCCGCCATCCACTACGGG + Exonic
1142120207 16:88383299-88383321 CCCGCCCCGCGTTCCAGCCCGGG - Intergenic
1143492275 17:7291414-7291436 CCCGCCCCGCTTTACCCCTCAGG + Intronic
1143655420 17:8290943-8290965 CCAGCGCCAACTTCCAGCTCTGG + Exonic
1144682305 17:17204173-17204195 TCCCCGCGGCCTGCCACCTCTGG + Intronic
1144781218 17:17809594-17809616 CCCCCGCCGCCGTCCAGCTCAGG + Intronic
1147722346 17:42546988-42547010 CCCGGGCCGCCTCCCACAGCCGG - Intergenic
1147723534 17:42553158-42553180 CCCGGGCCGCCTCCCACAGCCGG - Exonic
1148551116 17:48551294-48551316 CCCCCGCCGCCCTCCCCTTCGGG + Intronic
1150124634 17:62628142-62628164 CCCCCGCCGCCCGCCACATCTGG - Intronic
1150692609 17:67378373-67378395 CCAGCGCCGCCCTCCCCCGCTGG - Intronic
1150840380 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG + Exonic
1151716035 17:75831478-75831500 CCCCCTCCGCCTCCCACCCCAGG + Intronic
1152555254 17:81049830-81049852 CCCGCCTCCACTTCCACCTCCGG - Intronic
1152628842 17:81400563-81400585 CCCGCGCTGCCCTCCTCCCCGGG - Intronic
1152631454 17:81412504-81412526 CCCCAGCCGCCTCCCACCTGAGG - Intronic
1154151439 18:11909062-11909084 CCCGCGCCGCGCTGCCCCTCCGG + Exonic
1155257760 18:24014128-24014150 CCCCCGCCGCCCACCTCCTCGGG + Intronic
1158142413 18:54269568-54269590 TCGCCGCCGCCTTCCTCCTCCGG - Exonic
1160688646 19:449998-450020 CCAGTGCCGCCCTCCACCCCTGG + Intronic
1160769042 19:822122-822144 CTGGCGCCGCCTCCCACCGCCGG + Intergenic
1161155668 19:2731001-2731023 CCCCCGCCAACTTCCACTTCAGG - Intronic
1161550716 19:4910564-4910586 CCCGGGCCTCCTTTCTCCTCTGG + Intronic
1161628537 19:5340090-5340112 CGCCCGCCGCCTTCCCTCTCCGG - Intronic
1162742645 19:12782486-12782508 CCCGCCCCGCCGTTCCCCTCCGG + Intronic
1164248306 19:23454325-23454347 CCAGCTCCGCCTTGTACCTCTGG + Intergenic
1164565693 19:29324349-29324371 GCCGCCCCGGCTGCCACCTCTGG + Intergenic
1165331407 19:35142846-35142868 CCCTCGCCGCCCTTCAACTCTGG - Intronic
1165682639 19:37790650-37790672 CCCGCGCCGCCTTCTTCCTCAGG - Intronic
1166356291 19:42229465-42229487 CCCAGGCCCCCTTCCACCTCTGG + Intergenic
1167376412 19:49114547-49114569 CCCGCCCCGCCCACCCCCTCCGG - Intronic
1168110551 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG + Exonic
1168251010 19:55141963-55141985 CCTGAGCCACCTCCCACCTCCGG + Intronic
1168354766 19:55694397-55694419 CCCCCGCTGCCTTCCCCCGCGGG + Intronic
925237405 2:2291957-2291979 CCCGCCCCGCCCTGCACCTGCGG - Intronic
925415871 2:3669796-3669818 CCATCGCAGCCTCCCACCTCCGG - Intronic
927151177 2:20196995-20197017 CCCGCTCCGCCTTCCCCATCAGG + Intergenic
927713896 2:25341099-25341121 GCCGCGCCGCGATCCTCCTCCGG - Intronic
930838241 2:55817553-55817575 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
931477943 2:62608782-62608804 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
931886229 2:66620543-66620565 CCAGCTCCTCCTTGCACCTCTGG + Intergenic
932567156 2:72917450-72917472 CCCGCCCCGCCCCCCACCTTGGG + Intronic
932621427 2:73266636-73266658 CCCGCGCCGCCGTCTCCTTCAGG + Exonic
932780233 2:74554700-74554722 CCCGCCCCGCCTCCCGCCGCAGG + Exonic
933023401 2:77222770-77222792 CCAGCTCCTCCTTCTACCTCTGG - Intronic
933366402 2:81359545-81359567 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
935368286 2:102317941-102317963 CCCGAGCCTGCTCCCACCTCAGG - Intronic
935592651 2:104855949-104855971 CCGGCGCCGCCCTTCACGTCGGG - Exonic
944154114 2:196593163-196593185 TCCGCGCCGCCACCCACCCCCGG + Intronic
945102444 2:206274753-206274775 CCCGCGCCGCTTCTCGCCTCCGG + Exonic
946026773 2:216676673-216676695 CCAGCGCCTCCCTCCACCCCAGG - Exonic
946325092 2:218980958-218980980 CCCGCGCCACCCTCCTTCTCGGG + Intergenic
946371171 2:219282135-219282157 CCCTCTCAGCCTTCCACCTCAGG - Intronic
1168760825 20:348229-348251 CCCGCCCCGCCCGCCTCCTCCGG + Intronic
1168796019 20:610478-610500 CCCGGGCCGCTTTCAACCTGGGG - Intergenic
1169042081 20:2504363-2504385 CCAGCTCCTCCTTGCACCTCAGG - Intronic
1171013589 20:21521804-21521826 CCCGCTCCGCCTTCTACTCCCGG + Intergenic
1171377292 20:24702392-24702414 CTTGCCCCGCCCTCCACCTCTGG - Intergenic
1171904064 20:30885463-30885485 CCAGCTCCGCCTTGTACCTCTGG + Intergenic
1173727251 20:45306704-45306726 CCCACGCCCCCTGCCATCTCGGG - Intronic
1175036277 20:56004216-56004238 CCCGCGTCGCCTCCTACCCCGGG + Exonic
1175961804 20:62641253-62641275 CCCAGGCCGCCCTCCACTTCTGG - Exonic
1176131604 20:63498875-63498897 CCCGCGCCGCCCCCCACCCCGGG + Intronic
1177775525 21:25562158-25562180 CCAGCGCCGCCTGCAGCCTCGGG + Intergenic
1181342255 22:22191376-22191398 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1181353498 22:22279371-22279393 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
1181557692 22:23681342-23681364 CCTGCCCTGCCTTCCACTTCTGG - Intergenic
1182845894 22:33430685-33430707 CCCTGGCTGCCTGCCACCTCTGG + Intronic
1183583655 22:38739881-38739903 CACGCGGCCCCCTCCACCTCGGG + Exonic
1184640316 22:45866956-45866978 CCCGCGCCGCCGGCTTCCTCAGG - Intergenic
1185037947 22:48489508-48489530 CCCGCGCCGGCCTCCACGTGCGG - Exonic
952729514 3:36624077-36624099 CCAGCTCCTCCTTGCACCTCTGG + Intergenic
953871368 3:46630047-46630069 CCCGCACCGCCTCCCTCCGCAGG - Intergenic
954838826 3:53494308-53494330 CTGGCGCCGCCTGCCTCCTCCGG + Intergenic
957039994 3:75329326-75329348 TCCTCGCCGTCTTCCTCCTCTGG + Intergenic
958496406 3:94849435-94849457 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
958798727 3:98732860-98732882 CTCGCGGCGCCTGCCACATCGGG - Exonic
965110302 3:164412328-164412350 CCAGCTCCGCTTTCTACCTCTGG + Intergenic
965800979 3:172493827-172493849 CCAGCCCCGCCTTGTACCTCTGG + Intergenic
966846404 3:184134212-184134234 CCCGCCCCGCGTTGCACGTCGGG - Intergenic
966919810 3:184604173-184604195 CCCGCGTCGCCTCCCAGCCCTGG + Intronic
968025862 3:195442437-195442459 CTCTCGCCCCCTTCCTCCTCTGG - Intronic
968435776 4:588225-588247 CCCGCCCCACCTGGCACCTCTGG - Intergenic
968571912 4:1346618-1346640 CCCGCGGCGCCTCCCCGCTCCGG - Intergenic
972817132 4:42656982-42657004 GCCGCGCCGCCGCCCACCTAGGG + Exonic
976389347 4:84493243-84493265 CCGGCTCCGGCCTCCACCTCTGG - Exonic
979122927 4:116926284-116926306 CCCGCGCCGCCGCCCCTCTCCGG + Intergenic
981958366 4:150506140-150506162 CCAGCTCCTCCTTGCACCTCTGG - Intronic
981984402 4:150836379-150836401 CCAGCTCCTCCTTGCACCTCGGG + Intronic
984345173 4:178513486-178513508 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
984936233 4:184891636-184891658 CCCCCGGCACCTTCCACCCCAGG - Intergenic
989086004 5:37676812-37676834 CCCGTTCCTCCTTCTACCTCTGG + Intronic
989102725 5:37836717-37836739 CCCGCGCCTCCATGCTCCTCCGG - Intronic
989784949 5:45315978-45316000 CCAGCTCCTCCTTCTACCTCTGG - Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
995463607 5:112428221-112428243 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
995523041 5:113028889-113028911 CCCCCACCGCCCTCCACCTGTGG - Intronic
996335521 5:122380118-122380140 CCAGCGCCTCCTTGTACCTCTGG + Intronic
996355804 5:122595109-122595131 CCAGCGCCTCCTTGTACCTCTGG + Intergenic
996630376 5:125624635-125624657 CCAGCTCCTCCTTGCACCTCTGG + Intergenic
997172194 5:131733907-131733929 CCAGCTCCTCCTTCTACCTCTGG + Intronic
1002033545 5:176448254-176448276 CCCCCGCCCCCCGCCACCTCTGG - Intronic
1002121157 5:177006096-177006118 TCCGCGCCGCCTCACGCCTCGGG - Intronic
1003066067 6:2904073-2904095 CCCCCACCCCCTTCCATCTCAGG + Intergenic
1003086116 6:3063155-3063177 CCCCCACCCCCTTCCATCTCAGG - Intergenic
1003820034 6:9885862-9885884 CCAGCCCCTCCTTGCACCTCTGG - Intronic
1005358197 6:25005215-25005237 CCAGGGCCTCCTTCAACCTCTGG - Intronic
1006300970 6:33193369-33193391 ACCGCCCCCCCTTCCTCCTCCGG + Intergenic
1008545257 6:52577503-52577525 CCCGCGCCGCCCTCAGCCCCCGG - Intergenic
1008825472 6:55688086-55688108 CCCGCTCCACCTTCTACCTCTGG - Intergenic
1009323081 6:62315602-62315624 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
1009875403 6:69498782-69498804 CCAGCTCCTCCTTACACCTCTGG - Intergenic
1012550944 6:100464524-100464546 GCCGCGGCGCCTCCCACCCCCGG - Intronic
1013377952 6:109537182-109537204 CCAGCTCCTCCTTCTACCTCTGG + Intronic
1018073192 6:160184943-160184965 CCAGCTCCTCCTTCTACCTCTGG - Intronic
1019197166 6:170289624-170289646 CCCGAGCCGCCCTGCACCTACGG - Exonic
1019701582 7:2476968-2476990 CCCCCGCCGCCTGCCCCCACTGG + Intergenic
1020083094 7:5296817-5296839 CCGGCCCCGCCCTCCACCACAGG - Intronic
1020178091 7:5898777-5898799 CCCGCCCCGGCCCCCACCTCGGG - Exonic
1020304836 7:6826198-6826220 CCCGCCCCGGCCCCCACCTCGGG + Exonic
1025211209 7:57020413-57020435 CCGGCCCCGCCCTCCACCACCGG + Intergenic
1025660746 7:63556434-63556456 CCGGCCCCGCCCTCCACCACCGG - Intergenic
1027177790 7:75915501-75915523 CCCGCGCCGCCGCCCCCCACGGG + Intronic
1029667907 7:102007705-102007727 CCCTCGCCACCACCCACCTCTGG + Intronic
1034306307 7:150047736-150047758 CCTGCGCCGCCGTCCTCCTCGGG + Intergenic
1034463014 7:151208969-151208991 CCCGCCCTCCCTGCCACCTCTGG + Intronic
1034800540 7:154052917-154052939 CCTGCGCCGCCGTCCTCCTCGGG - Intronic
1035476727 7:159149219-159149241 CCCGGGCCCCCTCCCACCCCAGG + Intergenic
1038326761 8:26577741-26577763 CTCGCGCCGCCTGCCGCCCCCGG + Intronic
1039531801 8:38269181-38269203 CCGCCGCCGCCTTCCCCATCCGG + Exonic
1039843444 8:41309334-41309356 CCCGCGCCGCCTCCGACCGCAGG - Exonic
1041107732 8:54458659-54458681 CCCGCGCCCCCGGCCACCTGGGG - Intronic
1041889429 8:62852033-62852055 CCAGCTCCTCCTTCTACCTCTGG + Intronic
1042698547 8:71585165-71585187 CCAGCTCCTCCTTCTACCTCTGG - Intronic
1047980346 8:130174592-130174614 CCCACCCCTCCTCCCACCTCTGG + Intronic
1048488565 8:134870841-134870863 CCATCCCTGCCTTCCACCTCTGG - Intergenic
1049033172 8:140052065-140052087 CCTGCTCTGCCTTCCTCCTCTGG - Intronic
1049639474 8:143708213-143708235 CCCGAGGCGCGTCCCACCTCTGG - Intronic
1052200074 9:25767435-25767457 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1053230192 9:36401186-36401208 GCCCCGCCCCCTTCCCCCTCGGG - Intronic
1054764960 9:69035742-69035764 CCCGCTCCGCCCTCCAGCGCTGG - Exonic
1060186332 9:121566303-121566325 CCCACGCACCCTTTCACCTCAGG + Intergenic
1060987557 9:127828460-127828482 GCCGCGCCGCCTTCCTCCTGGGG - Intronic
1062305785 9:135906769-135906791 CCCACGCCGCCCTCCGCCGCAGG + Intronic
1185736487 X:2500467-2500489 CCCGCGCACCCTGACACCTCCGG - Intronic
1189004957 X:36985727-36985749 CCCGCGCCGCCTTCCTGCTCGGG - Intergenic
1189044069 X:37572217-37572239 CCCGCGCCGCCTTCCTGCTCGGG + Exonic
1190110371 X:47585521-47585543 CCCGCCCCGCCTTTCTCCTTAGG + Exonic
1191017968 X:55830636-55830658 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1191217944 X:57952450-57952472 CCAGCCACGTCTTCCACCTCTGG - Intergenic
1192073402 X:67964688-67964710 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1192352202 X:70365821-70365843 CCAGCTCCTCCTTCTACCTCTGG + Intronic
1193154094 X:78155023-78155045 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
1193374619 X:80743474-80743496 CCAGCTCCTCCTTGCACCTCTGG + Intronic
1193461382 X:81794623-81794645 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
1193582526 X:83283487-83283509 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
1193583194 X:83289842-83289864 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1194772698 X:97924609-97924631 CCCGCTCCTCTTTCTACCTCTGG - Intergenic
1195163390 X:102193639-102193661 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
1195167309 X:102233058-102233080 CCAGCTCCTCCTTCTACCTCTGG + Intergenic
1195170843 X:102266851-102266873 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1195188017 X:102420248-102420270 CCAGCTCCTCCTTCTACCTCTGG + Intronic
1195191550 X:102454029-102454051 CCAGCTCCTCCTTCTACCTCTGG - Intronic
1195261369 X:103134944-103134966 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1197915305 X:131528029-131528051 CCAGCTCCTCCTTGCACCTCTGG - Intergenic
1198466175 X:136906758-136906780 GCCTCCCCGCCTGCCACCTCTGG - Intergenic
1199884910 X:152010313-152010335 CCAGCTCCTCCTTCTACCTCTGG - Intergenic
1200164147 X:154024488-154024510 GCCTGGTCGCCTTCCACCTCTGG - Intronic
1201536116 Y:15050266-15050288 CCAGCTCCTCCTTGCACCTCTGG + Intergenic
1202068258 Y:20962716-20962738 CCAGCTCCTCCTCCCACCTCAGG - Intergenic
1202248975 Y:22849820-22849842 CCAGCTCCTCCTTGCACCTCTGG + Intergenic
1202401963 Y:24483568-24483590 CCAGCTCCTCCTTGCACCTCTGG + Intergenic
1202468818 Y:25186515-25186537 CCAGCTCCTCCTTGCACCTCTGG - Intergenic