ID: 901489266

View in Genome Browser
Species Human (GRCh38)
Location 1:9588596-9588618
Sequence CCCGCGCCGCCTTCCACCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901489258_901489266 -8 Left 901489258 1:9588581-9588603 CCGTGCCCCGCCCTCCCCGCGCC No data
Right 901489266 1:9588596-9588618 CCCGCGCCGCCTTCCACCTCCGG No data
901489257_901489266 3 Left 901489257 1:9588570-9588592 CCTACAGGGCTCCGTGCCCCGCC No data
Right 901489266 1:9588596-9588618 CCCGCGCCGCCTTCCACCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901489266 Original CRISPR CCCGCGCCGCCTTCCACCTC CGG Intergenic