ID: 901489603

View in Genome Browser
Species Human (GRCh38)
Location 1:9589796-9589818
Sequence CCACCTTTCCAGAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901489593_901489603 28 Left 901489593 1:9589745-9589767 CCTGTTGCTTCAGCAGAGCCTCG 0: 1
1: 0
2: 2
3: 4
4: 128
Right 901489603 1:9589796-9589818 CCACCTTTCCAGAGGGCAGGGGG 0: 1
1: 0
2: 1
3: 29
4: 316
901489595_901489603 10 Left 901489595 1:9589763-9589785 CCTCGCAGGTAGCTTACTGTTTC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 901489603 1:9589796-9589818 CCACCTTTCCAGAGGGCAGGGGG 0: 1
1: 0
2: 1
3: 29
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901489603 Original CRISPR CCACCTTTCCAGAGGGCAGG GGG Intronic
900357586 1:2272161-2272183 CCATCTGTGCAGAGGGCAAGAGG - Intronic
900372054 1:2336538-2336560 CAATCTTTCTAGAAGGCAGGCGG - Exonic
901065530 1:6492401-6492423 CCACCTCACAGGAGGGCAGGGGG + Intronic
901353505 1:8620991-8621013 CCACACTTCCACAGGGTAGGTGG - Intronic
901489603 1:9589796-9589818 CCACCTTTCCAGAGGGCAGGGGG + Intronic
904411771 1:30329029-30329051 CCACCAGTCCTGAGGGCAGAAGG - Intergenic
904673146 1:32180653-32180675 CCAACTCGCCAGAGCGCAGGGGG - Intronic
904833604 1:33320927-33320949 CCACCTTTCCCCAGGACTGGAGG + Intronic
905272583 1:36796575-36796597 CCACTGTTCTAGAAGGCAGGAGG + Exonic
905387602 1:37615044-37615066 TCTCCTTCCCAGAGTGCAGGCGG + Intronic
905788861 1:40779519-40779541 CCACCTCTACTGAGAGCAGGAGG - Intergenic
905797592 1:40824240-40824262 CTACCTTTCCCCAGGGCAGAAGG - Exonic
905902304 1:41589576-41589598 GGACATTTCCAGAGGGCAGGTGG + Intronic
906274387 1:44505436-44505458 CAACCTGTCCAGAGGCCTGGTGG - Intronic
907406984 1:54259671-54259693 CCTCCTCCCCAGTGGGCAGGCGG - Intronic
907560244 1:55381255-55381277 CAACCTTGGAAGAGGGCAGGAGG - Intergenic
910433002 1:87177311-87177333 CCTCCTTTCCAGAAGACAAGTGG - Intergenic
912721121 1:112020908-112020930 CCACCTTGCCAGAGAGCACTGGG - Intergenic
915717911 1:157961849-157961871 CCAGCGTTCCAGAAGCCAGGAGG - Intergenic
915980137 1:160415352-160415374 CCTCCCTTCCAGAGGGCTTGGGG + Intronic
916321041 1:163504660-163504682 CCCCCTTTGCAAAGGACAGGAGG - Intergenic
917538481 1:175891641-175891663 ACAGCTTTCCAGAAGGCAGGAGG + Intergenic
917851542 1:179068928-179068950 GCAACTCTCCAGAGTGCAGGTGG + Intronic
920388064 1:205581863-205581885 CCACCATTCCAGTGAGCAGCAGG + Intronic
920683212 1:208089130-208089152 ACATCTTTCCAGAAGGCAGATGG - Intronic
921946082 1:220887066-220887088 CCACCTTTCGCCAGGCCAGGGGG + Intergenic
923906621 1:238392128-238392150 GCTGCTTGCCAGAGGGCAGGTGG - Intergenic
1064002403 10:11674576-11674598 CCATTCTTCCAGTGGGCAGGTGG - Intergenic
1064991465 10:21260288-21260310 CCACTTTTCCAAAGGCCAGAAGG + Intergenic
1065824521 10:29557713-29557735 CTACCTTTCCTGTGGACAGGAGG - Intronic
1067174251 10:43931291-43931313 CCCCCTTTCCAGAAGGCACTGGG - Intergenic
1067716662 10:48695701-48695723 CCACCTTTCCACAGGGACTGGGG + Intronic
1067758538 10:49025596-49025618 CCCCCTTTCCAGAAAGCTGGAGG - Intronic
1067803851 10:49379950-49379972 TCACCTCTCCAGAGGGGATGAGG + Intronic
1068956155 10:62819713-62819735 CTCCCTTTACAGTGGGCAGGGGG - Intronic
1069773443 10:70913575-70913597 GCACCTCTCCACAGGGCAGGTGG + Intergenic
1069961933 10:72084258-72084280 GCACCTTGCCAGGGGGCTGGAGG - Intronic
1070810333 10:79294413-79294435 CTCACTTCCCAGAGGGCAGGAGG - Intronic
1071251134 10:83820995-83821017 TCACATTTCCAGATGGCTGGGGG - Intergenic
1072693502 10:97586740-97586762 CCACTCTTGCAGAGGGCATGGGG + Intronic
1073235603 10:102012804-102012826 CCACCTTTCCAGAATGGAAGGGG - Intronic
1073930460 10:108568118-108568140 TCACATTTCCCGAGGGGAGGAGG - Intergenic
1074377359 10:112951188-112951210 CCGCCTTCCCAGAGGGGTGGAGG - Exonic
1074781848 10:116807919-116807941 CCAGCTCTCTAGAAGGCAGGAGG + Intergenic
1076484101 10:130804824-130804846 CCACCTACCCAGAGGGGAGGAGG - Intergenic
1077162454 11:1119947-1119969 CCTCCTTTCCAGTTTGCAGGGGG + Intergenic
1077240547 11:1508356-1508378 GCACTGTTCCAGAGCGCAGGGGG - Intergenic
1077240581 11:1508452-1508474 CCACCGTTCCAGAGCGCAGAGGG - Intergenic
1077579534 11:3407903-3407925 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1080683629 11:34497680-34497702 CCACCTTTCCACAAGGCAAGGGG - Intronic
1082790051 11:57340879-57340901 CCACCTCTGCAAAGGGAAGGAGG + Intronic
1083172527 11:60931422-60931444 CCACCTTGCCAGGTGGGAGGTGG + Intronic
1083207375 11:61160971-61160993 CCGACTTGCCAGAGGGCACGCGG - Intronic
1083318723 11:61832287-61832309 CCTCCTTTGCACGGGGCAGGAGG + Intronic
1083386335 11:62313028-62313050 CCACCTTACAAGGGGGGAGGTGG - Intergenic
1083421482 11:62555684-62555706 CCACCTTTCAAAAGGGGAAGTGG + Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083778287 11:64905405-64905427 CCGCCTTTCTAGAGGGCAGTTGG - Intronic
1083839684 11:65297152-65297174 GCGCCTTACCAAAGGGCAGGTGG + Exonic
1084236559 11:67791441-67791463 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1084835867 11:71801552-71801574 CCATAAATCCAGAGGGCAGGTGG + Intergenic
1086890500 11:92252927-92252949 CCAAAGTTCTAGAGGGCAGGAGG - Intergenic
1086927776 11:92659131-92659153 TAACCTTGCCAGAGGGAAGGTGG + Intronic
1088253879 11:107884901-107884923 CCTCCTTCCCAGAGGTGAGGTGG - Intronic
1088762690 11:112947602-112947624 GCACCTTTTCACAGGGCAGCAGG + Intergenic
1089179953 11:116576620-116576642 CCAGCACTGCAGAGGGCAGGGGG + Intergenic
1089375831 11:117994034-117994056 CCACTTCTCCAGAGGTTAGGAGG - Exonic
1089540594 11:119187251-119187273 CCACCTGGACAGAGGGCACGTGG - Exonic
1090636044 11:128691202-128691224 CCATCTTTCCAGATGTCTGGTGG + Intronic
1091064198 11:132493310-132493332 GCAGCTTTCCAGATGGGAGGAGG - Intronic
1091340312 11:134806930-134806952 CCACCTTCCCAGAGAGCAGCTGG - Intergenic
1091888000 12:4030977-4030999 CCACCATTGCAGAAGGCAGCGGG - Intergenic
1092407458 12:8230851-8230873 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1093965962 12:25325579-25325601 CAACCTTTCCAGGGGTCGGGGGG + Intergenic
1094654682 12:32408935-32408957 GAACCTTCCCAGAGGGCAGATGG - Intronic
1095976508 12:47943870-47943892 CCTGCTTCCCAGAGGGCATGGGG - Intergenic
1096755522 12:53796320-53796342 CCACCTTGACGGAGGGCGGGTGG + Intergenic
1099880219 12:88458992-88459014 CCAACATTGCAGAGGGCAAGTGG + Intergenic
1100172083 12:91986558-91986580 CCACCATTGCAGAGAGCAGCAGG + Exonic
1101583908 12:106067761-106067783 CCACCGTTCCACAGGGCTGCAGG - Exonic
1101693315 12:107101365-107101387 ACACCTTCCCAGAATGCAGGTGG - Intergenic
1104616727 12:130276651-130276673 ACACCTCCCCAGAGGGGAGGAGG + Intergenic
1105454093 13:20525146-20525168 CGATGTTTCCAGAGGGGAGGTGG - Intronic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1108005507 13:45942063-45942085 CCATCTTTCCACAAGGCAAGTGG + Intergenic
1110492808 13:76128770-76128792 CCATCTTTGCATAGGGTAGGTGG + Intergenic
1110718218 13:78731797-78731819 CCAGCTTGCCAGAAAGCAGGAGG - Intergenic
1111457613 13:88505597-88505619 GCACCTTTTCACAGGGCAGCTGG - Intergenic
1111925307 13:94457460-94457482 CCACAGTTCTAGAGGCCAGGAGG - Intronic
1112094873 13:96121474-96121496 CCACCTGCCCAAAGGGAAGGAGG - Intronic
1114673995 14:24429308-24429330 CCTCCCGTCCAGTGGGCAGGCGG - Exonic
1115891976 14:38040936-38040958 GCACCTTTCCACAGGGCGGCAGG + Intronic
1118283392 14:64449478-64449500 CCGCCTTTCCAGAGAACATGGGG + Exonic
1118776672 14:68978213-68978235 CCACCTTTCCCGGGGGTCGGAGG + Intronic
1121425801 14:93851048-93851070 CCACCTTTACAGAAGGCTGGAGG - Intergenic
1121733658 14:96203711-96203733 ACACCTTTTCAGAGGGCTTGTGG + Intergenic
1122632659 14:103114071-103114093 CCAGCCTTCCACAGGGAAGGGGG - Intergenic
1124049643 15:26184652-26184674 CAAAATTTCCAGTGGGCAGGTGG + Intergenic
1126387603 15:48109964-48109986 CCACCTCACCTGAGGGCAAGAGG - Intergenic
1128556810 15:68637371-68637393 CCACCTTTCCCGGGTGGAGGGGG + Intronic
1129062216 15:72869140-72869162 AGACCCTTCCAGAGAGCAGGAGG - Intergenic
1130612950 15:85378192-85378214 ACACCTTTCCAGTGGGCTGCAGG - Intergenic
1132031044 15:98438670-98438692 CCACCCTTGAGGAGGGCAGGCGG + Exonic
1132613370 16:828657-828679 GGACCTTCCCAGAGGGCATGGGG - Intergenic
1133025829 16:2988604-2988626 CTACCTTTCCCCAGGCCAGGAGG - Intergenic
1133040558 16:3058197-3058219 CCAGCTGTCCGGAGGGCTGGAGG - Exonic
1133348152 16:5083963-5083985 CCATAAATCCAGAGGGCAGGTGG - Intronic
1133588783 16:7222185-7222207 CGACCACACCAGAGGGCAGGTGG + Intronic
1133736884 16:8622447-8622469 CCACCTCTCCATAGGGCTGCAGG - Intronic
1137633168 16:49962422-49962444 CTCCCTTTCAAGAGGGGAGGGGG - Intergenic
1138340411 16:56285446-56285468 GCCCCTCTCCAGAGGGGAGGCGG - Intronic
1139276072 16:65728724-65728746 CCAGATTCTCAGAGGGCAGGGGG - Intergenic
1139574327 16:67831697-67831719 CAGCCTCTCCAGAGGACAGGAGG + Intronic
1141511543 16:84515249-84515271 CCACCTTTCCAGAAGTCACCAGG + Intronic
1141706278 16:85666808-85666830 CCACGGATCCAGAGGGCTGGTGG - Intronic
1141897721 16:86969188-86969210 GCTCCTTTCCTCAGGGCAGGTGG + Intergenic
1141980438 16:87546977-87546999 CTAGCTTTCCAGCAGGCAGGGGG + Intergenic
1142117508 16:88367468-88367490 CCACCTTTTCCCAGGGCATGGGG + Intergenic
1142868978 17:2808475-2808497 GCCCCCTTCCACAGGGCAGGAGG - Intronic
1144642501 17:16945281-16945303 CCCCCTTGCCAGAGGGCACTGGG - Intronic
1145206585 17:20987685-20987707 CCCCCTTCCCAGAGGGCACTGGG + Intergenic
1145809883 17:27758306-27758328 CCCCTTTTACAGAGGGAAGGGGG - Intronic
1146271581 17:31488694-31488716 CCACCATCCCAGAGGGACGGGGG - Intronic
1147309712 17:39588020-39588042 CCACCTTCCCTGGGGGCAGAAGG + Intergenic
1147573859 17:41587583-41587605 CCACCACACCATAGGGCAGGTGG + Intergenic
1147923701 17:43933924-43933946 CCAAATTCCCAGAGGGCAGCAGG - Intergenic
1148341196 17:46874505-46874527 CCAGATTCCCAGAGGGCAGCAGG - Intronic
1149122843 17:53190818-53190840 GCACCTTTTCACAGGGCGGGAGG + Intergenic
1149654196 17:58301773-58301795 CCATCTCCCCAGCGGGCAGGCGG - Intronic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150885868 17:69084905-69084927 CCACCTTTCCAGAGTGTCAGTGG - Intronic
1151576452 17:74954720-74954742 CCACCTTGCTCGAGGGGAGGTGG - Intronic
1151621667 17:75249258-75249280 CCTCCTTACCTGAGGTCAGGAGG - Intronic
1151944589 17:77312448-77312470 CCTGCTTTCCAGAGGACAAGTGG - Intronic
1154130620 18:11734070-11734092 CCATCTTTCCAGAGGCTCGGTGG + Intronic
1154302858 18:13209744-13209766 CCACCTTTCCAGGTGGAATGAGG + Intergenic
1155201469 18:23521536-23521558 CCACCTCTCCAGACAGAAGGAGG - Intronic
1155202326 18:23528019-23528041 CCACCTTGCCCTATGGCAGGCGG - Intronic
1156303375 18:35854652-35854674 CCACCTTTCCTGGGGGTAAGGGG + Intergenic
1157586728 18:48805817-48805839 CAACCTGTCCAAAGGGTAGGGGG - Intronic
1158405020 18:57153165-57153187 CTAGCTCTCCAGAGAGCAGGAGG - Intergenic
1159800072 18:72888187-72888209 CCACCTTCAAAGAGTGCAGGTGG + Intergenic
1160766635 19:811651-811673 CCCAGTTTCCAGAGAGCAGGCGG + Exonic
1161216252 19:3096271-3096293 CCATCTTTCCAGGGGGCCGCGGG + Intronic
1161407265 19:4097649-4097671 CCTCCTCTCTGGAGGGCAGGGGG + Intronic
1161900315 19:7113858-7113880 CTACCTTTCTCCAGGGCAGGTGG + Intronic
1163408143 19:17136377-17136399 CCAGCTCTCCAGAGGGTAGCTGG - Intronic
1163472602 19:17506049-17506071 CCACCACTCCAGGGGCCAGGGGG - Exonic
1163611329 19:18303425-18303447 CCTCCTTTCCACAGAGCAAGAGG - Intergenic
1163695770 19:18762571-18762593 GCTGCTTTCCAGAGTGCAGGAGG + Intronic
1165331944 19:35144966-35144988 CCACCCTGCCAGAGAACAGGAGG + Intronic
1166072519 19:40395330-40395352 CTACCTTGCCTGAGGGCAGGTGG + Exonic
1166108912 19:40611135-40611157 CCACATCTGCACAGGGCAGGGGG - Exonic
1166431513 19:42732039-42732061 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166434635 19:42757252-42757274 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166444506 19:42847278-42847300 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166447484 19:42871018-42871040 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166451949 19:42909829-42909851 CTCCCTTTGCAGAGAGCAGGTGG + Intronic
1166454395 19:42928698-42928720 CTCCCTCTGCAGAGGGCAGGTGG + Intronic
1166464194 19:43018025-43018047 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166470348 19:43074611-43074633 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166481475 19:43178136-43178158 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166483945 19:43197252-43197274 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166491063 19:43261117-43261139 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166664692 19:44671973-44671995 CCTCCTTACCTGAGAGCAGGAGG - Exonic
925851774 2:8088708-8088730 CTAGCATTCCAGAGGGAAGGAGG + Intergenic
929175989 2:38976784-38976806 GCACTTCTCCAGAGGGCTGGAGG - Intergenic
929778197 2:44941553-44941575 CCACTTAGCCAGAGGGCGGGGGG - Intergenic
929851383 2:45593721-45593743 ACAGCTTTTCAGAGGGGAGGTGG - Intronic
930940099 2:57001878-57001900 AAACCTTTCCACAGGGCAGCAGG + Intergenic
931902433 2:66804601-66804623 CCATCTGTCCAGGGGGAAGGGGG + Intergenic
935141785 2:100359596-100359618 TCCTCTTTCCAGAGGTCAGGAGG + Intergenic
935944365 2:108271912-108271934 GCCCCTTTCCATGGGGCAGGGGG + Intergenic
937229794 2:120390906-120390928 GCACCTGTGCAGACGGCAGGGGG - Intergenic
937346703 2:121130470-121130492 CCAACCTTCCTGAGGGCAGGGGG - Intergenic
939091589 2:137786444-137786466 CCACCTTTGCAGAGATCATGAGG + Intergenic
940650431 2:156435949-156435971 CCGCCTTGCCAGCGGGCTGGCGG - Intronic
941744453 2:169071644-169071666 CCTGCTTCCCTGAGGGCAGGAGG - Intronic
944721993 2:202432961-202432983 CCACCTTACCAGCTGGCAGATGG - Intronic
944933725 2:204545817-204545839 CCACCTGGCCAGGCGGCAGGTGG - Intronic
945637207 2:212370238-212370260 TCACCTCTTCAGAGGGCAGCAGG - Intronic
946413975 2:219530154-219530176 GCACCTTCCCTGAGGGCAAGGGG - Intronic
947084373 2:226434678-226434700 CAACCTTTCTAGAGGGTTGGAGG + Intergenic
947356536 2:229301735-229301757 GCTCCTTTCCAGACGGCAGCTGG - Intergenic
947815071 2:233031562-233031584 CAGCCTTTGCAGAGGGCAAGTGG - Intergenic
947815598 2:233034378-233034400 CCACCTTTGCAGTGGGCCCGGGG + Exonic
948099182 2:235359883-235359905 CCCCCCTTCCAGAGGGCTGTGGG - Intergenic
948311395 2:236989606-236989628 CCAGGTTTCCAGAGGGAACGAGG - Intergenic
948378857 2:237539627-237539649 CCACCTTGTCTGTGGGCAGGAGG - Intronic
948466858 2:238156449-238156471 TAACCTGTCCAGTGGGCAGGAGG + Intergenic
948501302 2:238396980-238397002 CCAGCTTGCCAGGGGGCAAGGGG - Intronic
948599697 2:239101206-239101228 CCTCCATACCACAGGGCAGGGGG + Intronic
948703856 2:239777572-239777594 CCACCTCTCCCGAGTGCAGGCGG - Intronic
1169778286 20:9280246-9280268 TCTCCTTTCCAGAGGCCAGAAGG - Intronic
1171215163 20:23347111-23347133 CCACAATTCCAGATGGCTGGTGG + Intergenic
1173723955 20:45283939-45283961 GCTGCTTTCCAGAGGGCAAGAGG - Intergenic
1173985002 20:47254287-47254309 CCACCTCTTTAGAGGGCAGTTGG + Intronic
1174148141 20:48466864-48466886 CAACCTTTCTAGAGGGCAATTGG - Intergenic
1174459657 20:50673415-50673437 CCACCTTTGCAGGGGGTAGCTGG - Intronic
1174553275 20:51376476-51376498 CCATCTTTACAGAGGGTAGAGGG + Intergenic
1175076472 20:56379107-56379129 CCACCTTACTAAAGGGCATGAGG + Intronic
1176162267 20:63653817-63653839 CCCCCATTCCCCAGGGCAGGCGG + Intergenic
1176384791 21:6133959-6133981 CCAACTGTCCAGAGGGCATAGGG + Intergenic
1179479685 21:41669367-41669389 CCACACATCTAGAGGGCAGGCGG + Intergenic
1179707922 21:43193040-43193062 CTTACTTTCCAGAGGGCAAGAGG + Intergenic
1179738681 21:43404293-43404315 CCAGCTGTCCAGAGGGCATAGGG - Intergenic
1181000500 22:19985842-19985864 CCAGGCTCCCAGAGGGCAGGAGG + Intronic
1182713734 22:32338923-32338945 CCAGCTCTCCTGGGGGCAGGAGG - Intergenic
1183267804 22:36840092-36840114 CCATCTGTCCTGAGGGCTGGGGG - Intergenic
1184401021 22:44274504-44274526 CCAGCTCTCCTGGGGGCAGGAGG - Intronic
1184650191 22:45916120-45916142 CCACTTTTCCAGATGGGTGGGGG - Intergenic
1184859467 22:47165045-47165067 CAGCCTCTCCACAGGGCAGGGGG + Intronic
1185019100 22:48363206-48363228 CCAACTCTGCAGAGAGCAGGAGG + Intergenic
1185267330 22:49911228-49911250 CTACCTTTCCAGAAGGCCAGAGG + Intronic
949765057 3:7516965-7516987 CTGACTGTCCAGAGGGCAGGTGG - Intronic
949888486 3:8714512-8714534 CCACCTTTGGAGAGGGAGGGTGG + Intronic
950262771 3:11554425-11554447 CTTGCCTTCCAGAGGGCAGGTGG + Intronic
950493779 3:13321707-13321729 CCACTTCTCCACAGAGCAGGTGG - Exonic
951520730 3:23608951-23608973 CCAGGTTGCCACAGGGCAGGCGG - Intergenic
951725190 3:25750120-25750142 GCACCTTTTCACAGGGCAGCAGG + Intronic
952317356 3:32242664-32242686 ACACATTTCCAGAAGTCAGGGGG - Intronic
953026755 3:39149775-39149797 CCAGCTTTGCAGAGGCCAGGAGG - Intronic
953259584 3:41324608-41324630 TCACCTATTCAGAAGGCAGGTGG + Intronic
953357936 3:42270206-42270228 CCCACTTACCAGAAGGCAGGAGG + Intergenic
953967330 3:47319527-47319549 CCGCCTTTGCAGTGGGCAGTGGG + Intronic
955719408 3:61865629-61865651 CCACCTGCCGACAGGGCAGGTGG + Intronic
956364388 3:68484243-68484265 CCACCTTTCCAGGGCTCAGAAGG + Intronic
957052503 3:75421225-75421247 CCATAAATCCAGAGGGCAGGTGG - Intergenic
957393965 3:79616640-79616662 GCTCCATTCCAGTGGGCAGGAGG + Intronic
958734990 3:97998724-97998746 CTACCTTTATAGAGGGCAGCTGG - Intronic
960845410 3:122000291-122000313 TCCCCTCTCCAGAGGTCAGGAGG - Intronic
961302340 3:125930329-125930351 CCATAAATCCAGAGGGCAGGTGG + Intronic
961426491 3:126852339-126852361 CCACACTTCTAAAGGGCAGGTGG - Intronic
961447803 3:126989067-126989089 CTACCTGTCCAGCGTGCAGGAGG + Exonic
961620800 3:128223036-128223058 CCAGCTCCCCAGAGGTCAGGAGG - Intronic
961636938 3:128339211-128339233 CTACCTAACCAGAGGTCAGGGGG - Intronic
962025582 3:131543918-131543940 CCAGCTTTCCAGATGGAAAGGGG - Intronic
964913385 3:161809773-161809795 GTCCCTTTCCAGAGGTCAGGAGG + Intergenic
964965995 3:162494733-162494755 GCACCTTTTCACAGGGCAGCTGG - Intergenic
966222643 3:177565934-177565956 GCACCTTTCCCCAGGGCAAGGGG + Intergenic
966387069 3:179410074-179410096 GCACCTCTCCATAGGGCAGCAGG - Intronic
967074359 3:185988928-185988950 CCACTTTTGGAGAGAGCAGGCGG - Intergenic
967569028 3:191005933-191005955 CCACCTTTTCTGAGAGCATGAGG + Intergenic
968120351 3:196121531-196121553 CCATCTCTCCAGCAGGCAGGAGG + Intergenic
968381567 4:101088-101110 CCACCCTTCCAGTGTGCAGGTGG - Intergenic
968511149 4:996483-996505 CCACCTTTCCTGAGGGGGGAAGG - Intronic
968653579 4:1769392-1769414 CTGCCTTTCCAGAGGCAAGGGGG - Intergenic
969457476 4:7308366-7308388 TCACCTTTCCAGGGGGCAGCTGG + Intronic
969479062 4:7437480-7437502 ACCCCTTCCCAGAGGCCAGGGGG + Intronic
969758683 4:9167193-9167215 CCATAAATCCAGAGGGCAGGTGG + Intergenic
969818647 4:9704656-9704678 CCATAAATCCAGAGGGCAGGAGG + Intergenic
971161691 4:24140052-24140074 CTACCATTCCAGAGGTCATGGGG + Intergenic
974004753 4:56544765-56544787 CCACCTGGCCCGAGGGCGGGAGG + Intronic
975292385 4:72692610-72692632 CCAACTTTCCAAATGGCACGTGG + Intergenic
976365881 4:84231527-84231549 GCACCTCTTCACAGGGCAGGAGG + Intergenic
982536716 4:156616075-156616097 CTACCTTTCCACAGGGCTGAGGG - Intergenic
983368494 4:166827301-166827323 TCTCCTTTCCAAAAGGCAGGAGG - Intronic
983396514 4:167204429-167204451 GCACCTTTTCACAGGGCAGCAGG + Intronic
983646173 4:169993671-169993693 CCCCCTGGCCAGTGGGCAGGAGG - Intronic
986351518 5:6884734-6884756 ACACCTTGTCAGAGGGCAGATGG + Intergenic
988854914 5:35219048-35219070 CCACCTTGGCAGATGGCAGGTGG + Intronic
991207026 5:64060761-64060783 GCACCTTTTCACAGGGCAGCAGG - Intergenic
991512414 5:67394269-67394291 GCACCTCTTCACAGGGCAGGCGG - Intergenic
997611369 5:135218056-135218078 CCACCTTTGAGGTGGGCAGGAGG - Intronic
998452575 5:142246174-142246196 CCTCCTTTCCAGAGGGGAAAGGG + Intergenic
998864038 5:146476868-146476890 CCACCTACCCAGGAGGCAGGAGG - Intronic
999053394 5:148548297-148548319 ACATCTTCCCAGAGGGCAGCAGG - Intronic
999542111 5:152585035-152585057 CCACCAATCCTGAGGGCAGTGGG + Intergenic
999938550 5:156515774-156515796 CCAAGTTTCCAGAGGGGAAGGGG + Intronic
1000479299 5:161751685-161751707 CCACCTGTCCATACTGCAGGAGG - Intergenic
1001300981 5:170533517-170533539 CCACCTCACAGGAGGGCAGGTGG + Intronic
1002055972 5:176598064-176598086 CCACCTTCCCCGAGGGCACCGGG + Exonic
1002065539 5:176649934-176649956 CCAGCTTTAGAGAGGGCAGAAGG - Intronic
1002418206 5:179131889-179131911 CCTGCCTTCCCGAGGGCAGGGGG + Intronic
1002426728 5:179181068-179181090 TCACCTTTCCATAGCTCAGGAGG + Exonic
1002806019 6:574895-574917 CCTGTTTTCCAGATGGCAGGTGG + Intronic
1003126705 6:3361583-3361605 CCAGCTTTACAGAGGACAAGGGG + Intronic
1004342156 6:14817368-14817390 GCACATTTGCTGAGGGCAGGTGG - Intergenic
1005444154 6:25903808-25903830 CCAGCTTTCTAGGGTGCAGGGGG + Intergenic
1005598172 6:27398964-27398986 TCAGCTTTCCATAGGACAGGAGG - Intronic
1005916468 6:30356454-30356476 CCACATGTCCTGAGGGAAGGGGG - Intergenic
1006404481 6:33836490-33836512 CTACCTTTGGAGAGGGAAGGAGG + Intergenic
1006450734 6:34104308-34104330 CATCCTTGCCAGTGGGCAGGAGG + Intronic
1007147533 6:39651242-39651264 CCACCTATTCAGATGGCTGGAGG - Intronic
1007230607 6:40345333-40345355 CCACGTTTCCAGAGGAGAGTTGG - Intergenic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1008851342 6:56026276-56026298 CCCCCTTTCTGGAGGGAAGGGGG + Intergenic
1010285509 6:74073384-74073406 CCACCTTTCCAGAAGCAAGCAGG - Intergenic
1013412853 6:109897290-109897312 CCACCTCCCCAGAGACCAGGAGG - Intergenic
1013459310 6:110359407-110359429 CCAACATTCAAAAGGGCAGGGGG - Intergenic
1015565176 6:134562860-134562882 CCTCAATTGCAGAGGGCAGGTGG - Intergenic
1017318490 6:153060419-153060441 GCACCTTCCCAAAGGCCAGGAGG - Intronic
1018598743 6:165515057-165515079 ACACCCTTTCAGAGGGCATGCGG + Intronic
1019032047 6:169022236-169022258 CAGCCGTTCCAGTGGGCAGGGGG + Intergenic
1019039237 6:169089844-169089866 TCACCTCTCCACAGGGCAGCAGG - Intergenic
1019233055 6:170584666-170584688 GCACCTTTCCGGAGGACAGGAGG + Intronic
1020319584 7:6929924-6929946 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1021777922 7:24072261-24072283 CCAGCTAAACAGAGGGCAGGAGG - Intergenic
1022617957 7:31951829-31951851 CAACCTTTCCAGCAGGCAGAGGG - Intronic
1023865926 7:44238449-44238471 AGGCCTTTCCAGAGCGCAGGCGG - Intronic
1024013177 7:45287960-45287982 CCTCCTTCCCAGAGGCCAGTGGG + Intergenic
1024564601 7:50671145-50671167 CCACCCTTCCTGAGGCCACGCGG + Intronic
1024986853 7:55201661-55201683 CCACTTTTCCTGAATGCAGGTGG - Intronic
1025873157 7:65453833-65453855 CCACTTTTCCTGAGGGAAGCTGG + Intergenic
1027506504 7:79022028-79022050 GCACCTTTTCACAGGGCAGCAGG - Intronic
1027972739 7:85106771-85106793 CCACCTCTTCACAGGGCAGCAGG + Intronic
1028216379 7:88138945-88138967 CCAGCTCTGCAGTGGGCAGGAGG + Intronic
1031576741 7:123423272-123423294 CCACCTTTCCCTAGGGATGGGGG - Intergenic
1034938333 7:155214039-155214061 CCATTTTTCCAGAGTCCAGGCGG - Intergenic
1036207066 8:6813432-6813454 CAATCTTTCCAGAGGCCATGTGG + Intronic
1036470582 8:9049040-9049062 CCATCTTTACAAAGGGCAGCTGG + Intronic
1036847834 8:12181770-12181792 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1036869202 8:12424085-12424107 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1037374437 8:18212624-18212646 CCTCCTTTGCAGAGAGCAAGAGG - Intronic
1038540148 8:28385260-28385282 CCACCTGGCCAGCGGGAAGGGGG - Intronic
1038552552 8:28482521-28482543 GCACCTTCCCAGAGTGCAGGTGG + Intronic
1039263082 8:35794206-35794228 ACACATTTACAGAGGGCAGAGGG - Intronic
1039536395 8:38318030-38318052 CCACCATTCCACAGGGTCGGCGG - Intronic
1040018924 8:42722818-42722840 TCAGCCTTCCAGAGTGCAGGGGG + Intronic
1040822140 8:51573393-51573415 ACACCTTTCCAGTGGGGAGCAGG - Intronic
1042058566 8:64792335-64792357 CCACCTATCCAGATTGCAGAAGG + Intronic
1048941599 8:139404996-139405018 CTACCTGTCAAGAGGGCAGAAGG + Intergenic
1049222089 8:141432876-141432898 CCACCTTGTTAGGGGGCAGGGGG + Intergenic
1050716755 9:8537066-8537088 TCACCATTCCAGATGGCAGCAGG + Intronic
1051961562 9:22770746-22770768 CCGCCTTTCCAGAGCTCAGGTGG + Intergenic
1060214444 9:121730236-121730258 CCACCCTTCCCGAGGCCAGAAGG + Intronic
1060779613 9:126401763-126401785 CCCCATGTCCAGAGGGAAGGCGG - Intronic
1061422570 9:130480204-130480226 CCACCTGTCCAGTGGGCACCTGG + Intronic
1061536325 9:131252438-131252460 GCAGCTTTCCAGAAGGCAGCCGG - Intergenic
1061852871 9:133426120-133426142 TCACCTTTGCAGAGGGCAGGAGG - Intronic
1062288143 9:135782603-135782625 CCTCCTGTCCAGAAAGCAGGAGG + Intronic
1062315287 9:135964215-135964237 CCACCTTCCAAGAAGGCTGGGGG + Intergenic
1185836634 X:3350783-3350805 CCACATTTCTAGAGGAAAGGGGG - Intergenic
1189354380 X:40299827-40299849 CCTCCATTTCAGAGGTCAGGAGG + Intergenic
1191856731 X:65633284-65633306 CCTCCTTTCCAGTGGGCATCTGG - Intronic
1192960227 X:76122362-76122384 GCACCTCTTCAGAGGGCAGCAGG - Intergenic
1193816328 X:86108483-86108505 GCACCTTTTCACAGGGCAGCAGG + Intergenic
1196046711 X:111263789-111263811 CCACCTTTCCAGGAAGCAGTCGG + Exonic
1196098919 X:111828415-111828437 CCACCTCTTCACAGGGCAGCAGG - Intronic
1196611537 X:117720165-117720187 GCACCTCTTCACAGGGCAGGAGG - Intergenic
1197428030 X:126322996-126323018 CCACCTTTCCAGGGATCATGCGG - Intergenic
1198990874 X:142514004-142514026 GCACATTTCCACAGGGCTGGGGG + Intergenic
1199713354 X:150488131-150488153 CCAGCTTCCCAGAGAGAAGGGGG - Intronic
1200009345 X:153109408-153109430 CGACATTTCCAGTGGGTAGGGGG - Intergenic
1200030255 X:153290514-153290536 CGACATTTCCAGTGGGTAGGGGG + Intergenic