ID: 901490360

View in Genome Browser
Species Human (GRCh38)
Location 1:9593481-9593503
Sequence TACCCAGGGCTGAGAGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 244}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901490356_901490360 -5 Left 901490356 1:9593463-9593485 CCCAACTCTAGCAGGGATTACCC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244
901490355_901490360 -4 Left 901490355 1:9593462-9593484 CCCCAACTCTAGCAGGGATTACC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244
901490354_901490360 -3 Left 901490354 1:9593461-9593483 CCCCCAACTCTAGCAGGGATTAC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244
901490352_901490360 1 Left 901490352 1:9593457-9593479 CCCACCCCCAACTCTAGCAGGGA 0: 1
1: 0
2: 5
3: 29
4: 235
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244
901490353_901490360 0 Left 901490353 1:9593458-9593480 CCACCCCCAACTCTAGCAGGGAT 0: 1
1: 0
2: 2
3: 19
4: 178
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244
901490357_901490360 -6 Left 901490357 1:9593464-9593486 CCAACTCTAGCAGGGATTACCCA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244
901490349_901490360 9 Left 901490349 1:9593449-9593471 CCAGAGAGCCCACCCCCAACTCT 0: 1
1: 0
2: 4
3: 31
4: 315
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244
901490348_901490360 12 Left 901490348 1:9593446-9593468 CCACCAGAGAGCCCACCCCCAAC 0: 1
1: 0
2: 2
3: 28
4: 293
Right 901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG 0: 1
1: 0
2: 3
3: 15
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901490360 Original CRISPR TACCCAGGGCTGAGAGTGAC AGG Intronic
901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG + Intronic
901546039 1:9957900-9957922 TCTGCAGGGCTGAGGGTGACAGG - Intronic
902263347 1:15243727-15243749 TGCCCAGGGCAGGGAGTGAAGGG - Intergenic
903066901 1:20704756-20704778 TGCCCAGTGCCGAGAGCGACAGG + Exonic
903490228 1:23722778-23722800 TAGCCAGGGTTGAGAGTACCAGG + Intergenic
904264243 1:29309033-29309055 TGCTGAGGGCTGAGAGTCACTGG + Intronic
904928505 1:34067150-34067172 TACCCAGAGCTGTGAGTCATTGG - Intronic
906503157 1:46356981-46357003 TGCCCAGGGCTGAGATTCAGTGG + Intronic
906679933 1:47719660-47719682 AACCCAGGGATCAGAGTGGCAGG - Intergenic
907047161 1:51306285-51306307 TGCCCATGGCTGAGTGTGCCAGG - Intronic
907300663 1:53484631-53484653 TCCCCAGGGCTGAGAGGCAGGGG + Intergenic
910650891 1:89565783-89565805 TGCCCAGAGCTCAGAGTGATCGG - Intronic
910850935 1:91649315-91649337 GACCCAGTGCTGAGTGTGAGGGG - Intergenic
912007578 1:104923131-104923153 TACCTAGGGCTGGAAGTGTCTGG + Intergenic
913439797 1:118885282-118885304 TACCCAGGGCTGAGTGACAGTGG - Exonic
913719867 1:121581684-121581706 TACCCAGTGATGAGATTGCCAGG + Intergenic
914880937 1:151546531-151546553 TGCCTAGGGCTGAGAGAGATTGG - Intronic
915093703 1:153444446-153444468 TAGCCAGGTCTGAGACTCACTGG - Intergenic
915168617 1:153962732-153962754 TTCCTAGGTCTGAGAGTCACTGG - Exonic
915535535 1:156533343-156533365 CACCCAGGGCTGAGGGTGTGGGG - Intronic
915692535 1:157704021-157704043 ATCCCAAGGCTGAGAATGACAGG - Intergenic
915731719 1:158058771-158058793 TCCCCTGGGGAGAGAGTGACAGG + Intronic
917073718 1:171181243-171181265 TGCCAAGGGCTGGGAGTGAGGGG + Intergenic
918098463 1:181353391-181353413 AACCCAGTGCTGAGAGTCAAGGG + Intergenic
918148827 1:181780994-181781016 TTCCCAGGGCTGTGTGTGAGTGG - Intronic
920386933 1:205576076-205576098 TGCCCAGGGTGGAGAGTGAGTGG + Intronic
920564004 1:206959610-206959632 TACCCAGCCCTGAGGGTGTCAGG + Intronic
920651178 1:207838520-207838542 TACAGAGGGCGGAGAGTGAGGGG + Intergenic
922208258 1:223467649-223467671 TAGCCAGGGGTGGGAGGGACAGG - Intergenic
923374602 1:233348151-233348173 TGCCTAGGGCTGAGAGGGAAGGG - Intronic
924947805 1:248857898-248857920 TGCCCAGGGCTGAGGGTGGCTGG - Intronic
1063351860 10:5363687-5363709 GAGCCAGGGCTGAGAGGAACGGG - Intergenic
1063597913 10:7453821-7453843 TACCCAGGGGTGAGATTGCCAGG - Intergenic
1063685458 10:8233119-8233141 TATAAAGGCCTGAGAGTGACTGG + Intergenic
1066000157 10:31097113-31097135 TAGCCAGGGCTGAGAACCACAGG + Intergenic
1066049464 10:31620580-31620602 CACCCAAGGCTGGGGGTGACAGG - Intergenic
1067092716 10:43277488-43277510 TACCCAGGGCAGAGGGAGAGAGG - Intergenic
1067152535 10:43748711-43748733 AAACCAGGGCTGAGACTGCCTGG - Intergenic
1071707091 10:88011079-88011101 TACCATGGGCTGAGTGTGAATGG + Intergenic
1072423320 10:95307943-95307965 TACCAAGAGGTGAGGGTGACTGG + Intergenic
1072622393 10:97088765-97088787 GAACCAGGGCTGTGGGTGACAGG + Intronic
1073043089 10:100620686-100620708 TCCCCTGGTCTGAGAGTCACAGG - Intergenic
1073246397 10:102093447-102093469 TACCTAGGGCTGAGAGAGTGGGG + Intergenic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1076175966 10:128367946-128367968 TACCCAGGACTGAGAGTGAATGG - Intergenic
1076368276 10:129936005-129936027 TGCCCAGGGCTGCGAGTCAACGG + Intronic
1077738519 11:4818077-4818099 GAAGCAGGGCTCAGAGTGACAGG + Intronic
1082001970 11:47398188-47398210 TGCCCAGGGCTGAGAGCCAAGGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083048964 11:59760076-59760098 GAACCAGAGCTGAGAGTGATGGG + Intronic
1083387335 11:62321324-62321346 TACCCAGGGCTGATAACCACAGG - Intergenic
1083941158 11:65896664-65896686 TGCCCAAGGCTGAAAGTGATAGG - Intronic
1083947826 11:65934954-65934976 TATCCAAGGCTGAGAGTGTAAGG - Intergenic
1084181444 11:67448552-67448574 GTCCCAGGGCTGAGTGAGACCGG + Intergenic
1088812727 11:113402353-113402375 CACCCAGGGCTGAGAAGCACTGG + Intergenic
1089046269 11:115504112-115504134 AACTCAGGGCTGAGAGGGAAGGG - Intronic
1089276782 11:117342174-117342196 TACTCATGGCTCATAGTGACTGG + Intronic
1089322217 11:117634116-117634138 GACCCAGGGCAGAGGGGGACCGG + Intronic
1091536436 12:1414340-1414362 TTCACAGGGCTGAGAGAGAGAGG + Intronic
1094063189 12:26336225-26336247 TCCCCAGGACTGAGAATGAGTGG - Intergenic
1096599950 12:52722141-52722163 GACCCCATGCTGAGAGTGACAGG + Intergenic
1096763939 12:53867723-53867745 TACCCAGGGCTGAGGATGGGAGG + Intergenic
1096804728 12:54133699-54133721 AGCCCAGGGCTGAGATTGACGGG - Intergenic
1097929910 12:65171070-65171092 TACCTAGGAATGAGAGGGACAGG + Exonic
1098390720 12:69967072-69967094 CACCCAAGGATGAGTGTGACTGG - Intergenic
1101777274 12:107806280-107806302 TGCCCTGGGCAGAGAGTGAGAGG - Intergenic
1104052296 12:125204011-125204033 TACCTAGGGCTGAGATGGAGCGG + Intronic
1104421583 12:128640459-128640481 CGCCCAGGGCTGGGAGGGACTGG + Intronic
1104719159 12:131035052-131035074 CACACAGGGCTGTGAGTCACAGG - Intronic
1104971785 12:132534086-132534108 CACCCAGTGCTGAGAGGGGCAGG + Intronic
1105543213 13:21332694-21332716 TACCCAGGACTGAGAGTTCATGG + Intergenic
1108096124 13:46903280-46903302 TAACCATGGCTGAGACAGACTGG + Intergenic
1109894584 13:68667929-68667951 CACACAAGGCTGAGAGTGAGGGG - Intergenic
1112291161 13:98144440-98144462 TCCCCAGGGCTGGGAGAGACAGG - Intronic
1116262809 14:42653248-42653270 TACCCAGGACTGAGCCAGACTGG + Intergenic
1116894219 14:50300048-50300070 TACCAGGGGCTGAGGGTGGCAGG + Intronic
1118844048 14:69533091-69533113 TACTCAGAGTTGACAGTGACAGG - Intergenic
1120633759 14:86925788-86925810 ACCCCATGGCTTAGAGTGACAGG + Intergenic
1121606213 14:95242104-95242126 CACCCAGGACTGAGAATCACAGG - Intronic
1122178793 14:99939671-99939693 TGCCCGGGGCTGAGGGTGAGGGG - Intronic
1202894382 14_KI270722v1_random:190089-190111 TACCAAGGGCTGAGAGGGAAGGG - Intergenic
1126798558 15:52280315-52280337 GGCCCAGGGCTGAGACTGATAGG - Intronic
1129171330 15:73809976-73809998 TGCCCAGGGCTGTGGGTGGCTGG - Intergenic
1129175135 15:73834316-73834338 TCCCCAGGGCTCTGAGTGGCAGG - Intergenic
1130870910 15:87971585-87971607 GACCCAGTGCTGAGAAAGACTGG + Intronic
1132894381 16:2221246-2221268 TACCCAGGGCTGGCAGGGAGGGG + Intergenic
1133201017 16:4204490-4204512 TGCCCAGGGCTGGGAGAGCCCGG - Intronic
1134002674 16:10794858-10794880 AACCCTGGGCTGAGAGTGAGTGG - Intronic
1135173632 16:20208954-20208976 TGCCCAGGGATGGTAGTGACTGG - Intergenic
1135843207 16:25895101-25895123 GAACCAGGGCTGAGAGGGAAGGG + Intronic
1136283641 16:29229065-29229087 TACCCATGGCTAGCAGTGACAGG + Intergenic
1137252175 16:46748401-46748423 TACACGGGCCTGTGAGTGACAGG + Intronic
1138394291 16:56692120-56692142 TTCCCAGGCCTGAGAGTGGCAGG - Intronic
1138505864 16:57478003-57478025 TGCCCAGGGCAGAGTGTGCCAGG - Intronic
1138767030 16:59617262-59617284 TACACAGGCATGAAAGTGACTGG + Intergenic
1139775366 16:69313408-69313430 TGCCCAGGGCTGGGAGAGAGAGG - Intronic
1141412557 16:83845401-83845423 CTCCCAGGCCTGAGAGTGGCGGG - Intergenic
1142088673 16:88198576-88198598 TACCCATGGCTAGCAGTGACAGG + Intergenic
1142325790 16:89413771-89413793 TCCCCAGGGGTGAGGGTGCCAGG + Intronic
1143258651 17:5582712-5582734 CACCCAGGGCTCAGAGAGAAGGG - Exonic
1144807944 17:17979883-17979905 TTCCCAGGGCTGGGTGGGACTGG - Intronic
1146592821 17:34143099-34143121 TGCCCAGCTCTCAGAGTGACTGG + Intronic
1146725669 17:35153858-35153880 AACCCAGGGCTGAGAAACACAGG - Intronic
1146883536 17:36456617-36456639 TTCCCAGGACTGAGAGTGGATGG + Intergenic
1147339682 17:39746024-39746046 GACCCAGGGATAAGAGAGACTGG + Intronic
1150657111 17:67046530-67046552 GTCCCAGGGCTGAGAGTGACAGG + Intronic
1151574172 17:74943272-74943294 CACCCAGGTCTGAAAGAGACAGG - Exonic
1152144799 17:78561695-78561717 TGCCCAGGGCTGTGACTCACGGG + Exonic
1152250378 17:79209382-79209404 TCTCCAGGGCTGAGTGTGGCAGG + Intronic
1152375640 17:79917515-79917537 TACCCAGGACTGTGAGGGAAGGG + Intergenic
1152480075 17:80545122-80545144 CCCGCAGGGCTGAGAGTGGCTGG + Intronic
1157570459 18:48708928-48708950 TGCTCAGGGCTGAGTGTGCCAGG - Intronic
1161475396 19:4481981-4482003 TCCCCCCGGCTGAGAGTGAGGGG - Intronic
1162926876 19:13935225-13935247 TACCCTGGGAGGAGAGTGAGCGG - Intronic
1164507798 19:28873932-28873954 AAGCAAGGGCTGGGAGTGACAGG + Intergenic
1165112837 19:33512351-33512373 TGGCCATGGCTGAGAGTCACTGG - Intronic
1165797660 19:38528240-38528262 CATCCAGGGCTGGGAGTGAGAGG + Intronic
1167390278 19:49190326-49190348 TACCCTGGGGTGAGAGTGGTGGG + Intronic
1167632110 19:50631787-50631809 TCCCCTGCGCTGTGAGTGACAGG + Intronic
1168310386 19:55456970-55456992 TAACCAGGGCTGACAGTAACCGG - Intronic
925008398 2:464347-464369 GACCCAGGGAAGAGAGTGAAGGG - Intergenic
925175501 2:1781002-1781024 CACCCAGTGTTGAGAGTGCCGGG - Intergenic
925577093 2:5371145-5371167 TACCCTGGGCTGGGATGGACTGG - Intergenic
925851554 2:8086905-8086927 TCCCTGGGGCTGATAGTGACTGG - Intergenic
927497529 2:23560958-23560980 TCCCCAGGGCTGAGCTGGACTGG + Intronic
928231434 2:29501855-29501877 TACCCAGGGCTGGGAGTAGGAGG - Intronic
928372841 2:30753500-30753522 GACCCAGAGCAGAGAGAGACTGG - Intronic
933004419 2:76972354-76972376 TACACAAGGCAGAGAGTGACAGG - Intronic
935409492 2:102745642-102745664 TGTCTAGGGCTGAGAGGGACTGG - Intronic
936014327 2:108946278-108946300 TACCTACGGGTGACAGTGACGGG + Intronic
937970594 2:127546037-127546059 TCCCCAGAGCTGAGAGTACCTGG - Intronic
938776279 2:134544216-134544238 TACACAGGGCAGAGAATGGCAGG + Intronic
942971487 2:181962481-181962503 TATCCAGGGAGGAGAGTGAGAGG + Intronic
944957419 2:204828377-204828399 TAGCCAGGGTTGAGAATCACTGG - Intronic
948105989 2:235414197-235414219 TAACCAGTGCTGAGAAAGACTGG - Intergenic
1170634628 20:18093581-18093603 TCCCCTGGGCTGGGAGTGCCTGG - Intergenic
1171012355 20:21515480-21515502 TTCCCAGAGCCGAGAGTGGCTGG - Intergenic
1171035489 20:21709639-21709661 TACCCGAGGTTGAGAGAGACTGG + Intronic
1171211654 20:23321548-23321570 TTCCCAGGGCTGAGGGTTAGAGG - Intergenic
1171250632 20:23643758-23643780 AATCCAGGGCTGCGAGTGTCAGG - Intergenic
1172248954 20:33465574-33465596 AGGCCAGGGCTGAGAGTGATTGG + Intergenic
1172609080 20:36236087-36236109 CCCCGAGGGCTGAGTGTGACTGG + Intergenic
1173188476 20:40858898-40858920 TCCTCAGGGCTGGGTGTGACAGG - Intergenic
1175293394 20:57893131-57893153 TACGCAGGGCTGGGGGTGTCAGG - Intergenic
1175536938 20:59721419-59721441 CACCCAGAGCTGGGAGTCACTGG - Intronic
1175949716 20:62576827-62576849 TACCCAGGCCTGAGAAAGATCGG - Intergenic
1178539052 21:33434009-33434031 CACCCAGAGCTGTGAGTGCCAGG + Intronic
1179549568 21:42135475-42135497 TTCCCAGGGCTGAGAGTCCAGGG + Intronic
1180670564 22:17549351-17549373 AGCCCTGGGCTGAAAGTGACTGG - Exonic
1181019047 22:20088728-20088750 TACCTAGCCCTGAGAGTCACTGG + Intronic
1181032443 22:20155020-20155042 TGCCCAGGGGCGAGGGTGACGGG - Intergenic
1182875437 22:33687506-33687528 TCCCCAGGGCTGAGAACAACAGG + Intronic
1184380146 22:44140327-44140349 TTCTCAGAGCTGAGAGTGGCTGG + Intronic
1184653885 22:45931712-45931734 TCTCCAGCCCTGAGAGTGACTGG + Intronic
1184741906 22:46433429-46433451 TTCCCAGTGGTGTGAGTGACGGG - Exonic
1184872778 22:47251570-47251592 TACCCAAGGCCCTGAGTGACAGG - Intergenic
950045279 3:9945448-9945470 TACACAGGACTTAGAATGACTGG + Intergenic
950101451 3:10359368-10359390 TACCCAGGGCTGAGAACCACTGG + Intronic
951997497 3:28747365-28747387 TAACCAGGGCTGAGAGACAAGGG - Intergenic
954419938 3:50413395-50413417 GACCCAGGGCTGAGGGTCAGGGG - Intronic
958468096 3:94483277-94483299 GACCCAGGGCAGGGAGTGCCAGG + Intergenic
959973684 3:112434709-112434731 TTCCCATGGCAGAGAATGACTGG + Intergenic
960668015 3:120129808-120129830 TACCTACAGCTGAGAGTGCCAGG + Intergenic
961204001 3:125066470-125066492 CAGCCAGGGCTGAGAATCACCGG - Intergenic
962684085 3:137829841-137829863 TACCCATGGCAGAAGGTGACAGG + Intergenic
962696305 3:137950751-137950773 TTCCCTGGGCTAAGAGTCACAGG - Intergenic
963273719 3:143309847-143309869 TTCCCAAGGGTGAGAGTGAGAGG + Intronic
966988430 3:185203740-185203762 TACCCAGCTATGAGAGTGACAGG + Intronic
968703899 4:2069376-2069398 ATCCCAGGCCTGAGAGTGAATGG - Intergenic
969243717 4:5918944-5918966 CAACCAGGGCTGAGAATCACCGG + Intronic
969717806 4:8876791-8876813 TCCCCAGGCCTGAGCGTGAGGGG - Intergenic
969849188 4:9943212-9943234 GCCCCAGGGCTCAGAGTGAGTGG + Intronic
969869328 4:10094973-10094995 TACCCAGGTGGGAGAGGGACTGG - Intronic
974982820 4:68981485-68981507 TGACCATGGCTCAGAGTGACTGG - Intergenic
977653844 4:99499188-99499210 TGCCCTGGAGTGAGAGTGACAGG - Intergenic
978635637 4:110802426-110802448 TAGCCAGGGGTCTGAGTGACTGG + Intergenic
981076015 4:140593228-140593250 TACCCAGGGCTCAAAGTAAAGGG - Intergenic
982143483 4:152354723-152354745 TACTTAGGGCTGTGAGTTACAGG + Intronic
986861360 5:11929947-11929969 TACCCAAGGCTAATAGTGAGGGG + Intergenic
987061427 5:14247245-14247267 TACCCAGTTGTGACAGTGACAGG - Intronic
992294879 5:75317855-75317877 TACCCATGGATAACAGTGACAGG + Intergenic
994306667 5:98213701-98213723 TAACCAGGGCAAAGAGGGACAGG - Intergenic
994941406 5:106328176-106328198 TACTCAGGGTAGAGAGTGACAGG + Intergenic
997410055 5:133684191-133684213 AGCTCAGGGCTGAAAGTGACGGG + Intergenic
997830832 5:137148229-137148251 TACCCACTACTGAGAGTGTCTGG + Intronic
998914505 5:146999386-146999408 CATCCAGGGCTGAGAATGATGGG - Intronic
999608860 5:153347726-153347748 TAGCTAAGGCTGAGAGTCACTGG - Intergenic
1001685678 5:173593179-173593201 TACCCAAGGCTCACAGTGAGTGG - Intergenic
1002622804 5:180501009-180501031 GACACAGGGATGAGAGGGACAGG + Intronic
1003615519 6:7651826-7651848 TAGCCAGGGTTGAGAATCACTGG - Intergenic
1003941625 6:11034170-11034192 TATACAGGGCTGGGAGAGACTGG - Intronic
1004126809 6:12882103-12882125 CACCCGAGGCTGAGAGGGACAGG + Intronic
1004569857 6:16834670-16834692 CAGCCAGGGCTGAGAGCCACTGG + Intergenic
1004947628 6:20633198-20633220 TGCCTAGGGCTGAGAGGGATAGG - Intronic
1007896521 6:45367013-45367035 TACCAAGGGCTGAGATGGAAGGG + Intronic
1008537741 6:52519978-52520000 TACCAAGGGCTGGGAGTGAGAGG + Intronic
1008573400 6:52836322-52836344 TACCAATGGTTGAGATTGACGGG - Exonic
1008956574 6:57222203-57222225 TAGCCAGGGCTCAGATTGAGTGG + Exonic
1013288172 6:108698277-108698299 CACCGAGGGCTGAGGGGGACAGG - Intergenic
1013932756 6:115554388-115554410 TTCTCATGGCTGAGGGTGACTGG - Intergenic
1015768014 6:136739459-136739481 TACCCTGGGGTGGGAGTGAGGGG - Intronic
1016838646 6:148504636-148504658 TGGCCAGGGCTGAGAGCCACAGG + Intronic
1017348707 6:153414959-153414981 TGCTCAGGGCTGTGGGTGACAGG - Intergenic
1017503058 6:155043246-155043268 TAGCCAGTGCTGAGAGCCACTGG - Intronic
1018639672 6:165895005-165895027 TAGCCAGGACTGAGAGCCACTGG + Intronic
1019139750 6:169935922-169935944 TACCCAGAGGAGAGAGTGAAAGG + Intergenic
1019273612 7:164413-164435 TCCCCAGGGCTCTGAGTGTCAGG + Intergenic
1019361552 7:607408-607430 TCCCCAGCGATGTGAGTGACAGG + Exonic
1019451917 7:1103277-1103299 TCCCCTGGGCTGAGATTGTCGGG + Intronic
1019578679 7:1749621-1749643 TGCCCAGGGCTGAGAGTCCCGGG - Intergenic
1019661969 7:2229583-2229605 AACACAGTGCTGAGAGTGCCTGG - Intronic
1021992436 7:26151900-26151922 TAGACTGGGCGGAGAGTGACTGG - Intergenic
1022531407 7:31069122-31069144 TACCCAGGTCTGAGAACCACTGG + Intronic
1022870434 7:34472175-34472197 GACCCACTGCTGAGAGTGGCAGG + Intergenic
1023575767 7:41624959-41624981 TAGCAAGGGATGAGAGTGAGAGG + Intergenic
1023598461 7:41856881-41856903 GAGCTAGGGCTGAAAGTGACAGG + Intergenic
1024527330 7:50360034-50360056 TACCCATGGCCGAGAGCGGCGGG + Intronic
1026170206 7:67947219-67947241 TACCCAGGGTTGACAGATACTGG + Intergenic
1027565822 7:79792323-79792345 TACACAGGGATGAGACTGAAGGG - Intergenic
1029425602 7:100492294-100492316 AACCCAGGAATGAGAGTGAGGGG + Intronic
1029513941 7:101014209-101014231 CACCCAGGGCTGGGAGGGTCTGG - Intronic
1030246020 7:107385191-107385213 TACCCAGGATTGAGATTGATGGG + Intronic
1033070242 7:138195523-138195545 CACTCATGGCTGAGATTGACAGG + Intergenic
1034992036 7:155553980-155554002 TACACATGGATGACAGTGACTGG - Intergenic
1036168901 8:6464246-6464268 TACCCAGAGCTGGCAGTGGCGGG + Intronic
1037171261 8:15895119-15895141 TAACCTGGGCTGAGAGAGAGAGG - Intergenic
1038566527 8:28623531-28623553 TACCAAGGGGTGAGACTGAACGG - Intronic
1042480296 8:69295130-69295152 GACCCAGGTCTGAGAGTTGCAGG + Intergenic
1043736138 8:83746673-83746695 AACCCAGAGATGAGAGTGAGAGG + Intergenic
1043797898 8:84568560-84568582 TACCCAGTAATGAGAGTGGCTGG + Intronic
1045748859 8:105457815-105457837 TCCTCAGGTATGAGAGTGACAGG - Intronic
1046366636 8:113240368-113240390 TACCCAGTGATGAGATTGCCAGG + Intronic
1047199058 8:122748571-122748593 GACCCAGGGTTGAGAGCCACTGG + Intergenic
1049491989 8:142910014-142910036 TACCCAGGGCTGCGAGTCACAGG - Intronic
1050050445 9:1595684-1595706 AAGCCAGGGCAGAGAGAGACAGG - Intergenic
1051508599 9:17852235-17852257 TGCTCAGGGCTGAGAGCCACAGG + Intergenic
1052026130 9:23575336-23575358 AACCAAGAGCTGAAAGTGACAGG - Intergenic
1052372980 9:27686851-27686873 TAGCCAGGGCTGAGAACCACTGG + Intergenic
1052661003 9:31431772-31431794 AACCCATGGCCCAGAGTGACTGG - Intergenic
1053284005 9:36838922-36838944 GAGCCAGGGCAGAGAGAGACTGG - Exonic
1056547778 9:87627354-87627376 TACTGAGAGCTGAGAATGACAGG + Intronic
1056678483 9:88696837-88696859 TGCCCAGGGGTGAGGCTGACAGG - Intergenic
1056851267 9:90086467-90086489 TACCCAGGACAGGGAGTGAAAGG - Intergenic
1058517968 9:105794849-105794871 TAACCAGGGCTGGGAGAGAGGGG + Intergenic
1059417169 9:114169215-114169237 TTCCCAGGTCTGAGGGGGACAGG - Exonic
1059941698 9:119366396-119366418 GACCCAGTACTGAGTGTGACTGG - Intronic
1060219702 9:121757934-121757956 TCCCCAGGGCTGGGGGTGCCAGG - Intronic
1060668519 9:125447988-125448010 CACAAAGGGCTGAGAGTGCCTGG + Intronic
1061846697 9:133392361-133392383 TACCAAGGACTGAGTGTGGCCGG - Intronic
1062035663 9:134381517-134381539 GGCCCAGGGCTGAGAGGGGCTGG + Intronic
1062122657 9:134842019-134842041 TACCCAGGGCTGCGCTTGCCCGG - Intronic
1062176908 9:135168463-135168485 TTCCCTGGGCTGAGGGTGTCGGG - Intergenic
1203491396 Un_GL000224v1:108754-108776 TACCAAGGGCTGAGGGGGAAGGG - Intergenic
1203504020 Un_KI270741v1:50624-50646 TACCAAGGGCTGAGGGGGAAGGG - Intergenic
1187463591 X:19508963-19508985 TACCGTGGGCTGAGAGGGGCAGG - Intronic
1189928522 X:45983340-45983362 TAGCCAGGGAGGAGAGTGAGAGG - Intergenic
1190302522 X:49064987-49065009 CACCCAGGCCTGGGAGTGAGAGG + Intronic
1193373598 X:80730514-80730536 TACCAAGAGCTGGGAGTGAAGGG + Intronic
1197819256 X:130529308-130529330 TGCCCAGGGCTGAGAGGGCGGGG - Intergenic
1197819817 X:130531425-130531447 TAACCAGGGCTGAGAGTGCAGGG - Intergenic
1200100525 X:153687613-153687635 TTCCCAGGGCTGGGAGGGGCCGG + Intronic
1200217083 X:154372672-154372694 TACCGAGGACTGAGAGGGAGGGG - Intronic
1200389006 X:155924455-155924477 TACCAGGGGCTGAGAGTAAGGGG - Intronic