ID: 901494076

View in Genome Browser
Species Human (GRCh38)
Location 1:9611521-9611543
Sequence CTCTTTCAATGTCAGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901494072_901494076 6 Left 901494072 1:9611492-9611514 CCGGCCTCGAATGTTTAGATTTC 0: 1
1: 0
2: 1
3: 3
4: 85
Right 901494076 1:9611521-9611543 CTCTTTCAATGTCAGAGATCTGG 0: 1
1: 1
2: 0
3: 10
4: 171
901494070_901494076 15 Left 901494070 1:9611483-9611505 CCACTGCGCCCGGCCTCGAATGT 0: 4
1: 10
2: 121
3: 1277
4: 7121
Right 901494076 1:9611521-9611543 CTCTTTCAATGTCAGAGATCTGG 0: 1
1: 1
2: 0
3: 10
4: 171
901494071_901494076 7 Left 901494071 1:9611491-9611513 CCCGGCCTCGAATGTTTAGATTT 0: 1
1: 0
2: 0
3: 16
4: 235
Right 901494076 1:9611521-9611543 CTCTTTCAATGTCAGAGATCTGG 0: 1
1: 1
2: 0
3: 10
4: 171
901494073_901494076 2 Left 901494073 1:9611496-9611518 CCTCGAATGTTTAGATTTCCCAC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 901494076 1:9611521-9611543 CTCTTTCAATGTCAGAGATCTGG 0: 1
1: 1
2: 0
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901494076 Original CRISPR CTCTTTCAATGTCAGAGATC TGG Intronic
901494076 1:9611521-9611543 CTCTTTCAATGTCAGAGATCTGG + Intronic
903182022 1:21609628-21609650 CTCTTGCAGTGACAGAGACCTGG + Exonic
905420464 1:37839752-37839774 TTCTTTCATTTTCTGAGATCTGG + Intronic
906802004 1:48745998-48746020 GTCTTTTTATGTCAGAGACCAGG + Intronic
906829503 1:49016501-49016523 CTCTTACAATGTCAAAACTCCGG - Intronic
910420493 1:87056387-87056409 CTCTTGCTATGACAGAGACCAGG - Intronic
910681701 1:89872429-89872451 ATCTTTCAATGGCAGTGACCAGG + Intronic
911509537 1:98794301-98794323 CTCATTAAATGTCTGACATCTGG - Intergenic
911862413 1:102969517-102969539 CCCTTTCAAAATCAGACATCTGG - Intronic
912008186 1:104930002-104930024 TTCTTTCAATGTCTGCCATCGGG - Intergenic
912220148 1:107664957-107664979 CTCCTGCAATAGCAGAGATCTGG - Intronic
914248432 1:145902508-145902530 CTTCTTCAATGTCACAGATGAGG - Exonic
915170611 1:153974622-153974644 CACTTTCACTGTCTGAGATAGGG + Exonic
915797329 1:158751306-158751328 GTCTTTGAATGTCAGACATTGGG - Intergenic
919234418 1:194821118-194821140 CTCTTTCAGTATCTGAGTTCTGG + Intergenic
1062987990 10:1787794-1787816 ATCTTTAAATGTCAGATATTAGG + Intergenic
1064523815 10:16231861-16231883 CTGTTTCAATGACAGACAGCAGG + Intergenic
1064748938 10:18506175-18506197 CTATTTCACTGTCTGTGATCTGG + Intronic
1071138980 10:82484808-82484830 ATCTTTCCAGGTCTGAGATCTGG + Intronic
1073831733 10:107392121-107392143 TTTTTTCGATGTCAGAGTTCAGG - Intergenic
1075569479 10:123529377-123529399 CTCTGTGGATGTCAGAGAGCCGG - Intergenic
1077963469 11:7100586-7100608 CCCTATCAAAATCAGAGATCTGG + Intergenic
1079388669 11:20002377-20002399 CTCTCTCTATCTCAGAGATCAGG + Intronic
1079779820 11:24587394-24587416 CTCTTCCAAGGTGAGAGATGGGG + Intronic
1081381366 11:42419794-42419816 CTATTTCAATATCAGCGCTCTGG + Intergenic
1082925860 11:58546513-58546535 CTTTTTCAATCTCAGAATTCTGG + Intronic
1083740519 11:64708563-64708585 CTCTCTCTCTCTCAGAGATCTGG - Intronic
1085914950 11:80875276-80875298 CTCTTACAATTTCACAGATGAGG + Intergenic
1088810017 11:113385940-113385962 CTCGCTGAATGTCAAAGATCGGG + Intergenic
1089014116 11:115153057-115153079 CTTCTTCATTGTCAGAGAACGGG + Intergenic
1089545556 11:119221883-119221905 CTCTTTCATTTACAGAGACCCGG + Intronic
1090144549 11:124307342-124307364 ATCTTACATTGTCAGAGGTCAGG - Intergenic
1090362056 11:126180042-126180064 TGCTTTCAATGTCATAGATAAGG - Intergenic
1092893007 12:12986744-12986766 CCCTTTGAATGCCAGAGAGCAGG - Intronic
1093625269 12:21339011-21339033 ATATTTCAATATCAGAGATGAGG - Intronic
1097969995 12:65623247-65623269 CTCATCCAAAGTCAAAGATCTGG + Intergenic
1103233959 12:119356257-119356279 CTCTTTGAATATCTGAGATGAGG + Intronic
1103613862 12:122140055-122140077 CTCTATTAATGACAGGGATCAGG - Intronic
1107065453 13:36210048-36210070 CTCTTTCAGTTACAGAGATCGGG + Intronic
1111086621 13:83383109-83383131 CTCTTTCATTCTCTGACATCAGG - Intergenic
1111557197 13:89896061-89896083 CTCTTTAAATGTTAGAGATATGG + Intergenic
1115907589 14:38217822-38217844 CTCTTTCAAGGTCAGAAAGAAGG + Intergenic
1116438739 14:44925511-44925533 TTCTTACGATGTCAGAGATAAGG + Exonic
1118711604 14:68523967-68523989 CTCTTTTACTGTCACAGAACTGG - Intronic
1120488313 14:85143997-85144019 CTCTTACAATGTGAGAAATTTGG + Intergenic
1123779035 15:23607162-23607184 CTCTTTCCATGTCAGACCACTGG - Intronic
1125115125 15:36081312-36081334 CTCTTTCAATTTCATAGAATAGG - Intergenic
1128718166 15:69925362-69925384 CTCTTTCATCCTCAGAGTTCAGG + Intergenic
1128967699 15:72076936-72076958 TTGTTTCATTGTCAAAGATCAGG - Intronic
1133850068 16:9495099-9495121 CTCTTTAAATAACAGTGATCAGG + Intergenic
1134388150 16:13793644-13793666 CTTTCTCAATGTCATAGAGCTGG + Intergenic
1135101828 16:19612758-19612780 CCCTTTTAATGTTTGAGATCAGG + Intronic
1139652438 16:68369252-68369274 ATTTTTGAATGTCATAGATCAGG + Intronic
1140717980 16:77744149-77744171 ATGTTTAAATGGCAGAGATCTGG + Intergenic
1141381061 16:83577458-83577480 CTCTTTAAATGTCAGTGTGCAGG - Intronic
1142997659 17:3770507-3770529 CTCTTAAAATGTAAGAGACCAGG - Intronic
1143116109 17:4582679-4582701 CTCTGTCAAGGGCAGAGATGGGG - Intergenic
1144282271 17:13737990-13738012 CTCTTTCATTGTTAGAGGTGAGG + Intergenic
1146920477 17:36706811-36706833 CTCTCTCAAGGTCACAGAGCAGG - Intergenic
1148860016 17:50599886-50599908 CTCTTTCAAGGTCAGGGGTGAGG - Intronic
1149265069 17:54919562-54919584 CTGTTTTAATGCCAGAGCTCAGG + Intronic
1151824911 17:76518871-76518893 CTCTCTCTCTGTCAGGGATCAGG + Intergenic
1152911655 17:83008754-83008776 CTCGCTCAATGGCAGGGATCCGG - Intronic
1153566096 18:6419065-6419087 CTATCTCAAAGTCAAAGATCTGG + Intergenic
1156842144 18:41621665-41621687 CTATTTCTATGTCAGTGATGCGG + Intergenic
1159541809 18:69787434-69787456 CTCTTCCACTGTCAGAGAGGTGG - Intronic
1159645821 18:70916745-70916767 CTCTTTCCATGGGAGAGAACAGG + Intergenic
1160240113 18:77117675-77117697 CTCATTCAAAATCTGAGATCAGG - Intronic
1161488043 19:4546308-4546330 CCCTCTCACAGTCAGAGATCAGG + Intronic
1162253483 19:9467298-9467320 CTCTATCAATGTAAGAAATGTGG - Exonic
925647247 2:6048489-6048511 CGCTTTCAATTTCATACATCTGG - Intergenic
926104971 2:10144276-10144298 CTCTTCCAAGGTCAGAGACGAGG + Intronic
926945038 2:18178233-18178255 CCCTTTAATTGTCAGAGCTCAGG - Intronic
928426004 2:31178334-31178356 CTCTTCCAAACTCAGAGAGCTGG - Intronic
930229334 2:48827461-48827483 CTCTTTCAGTGGCAGAACTCTGG - Intergenic
930731878 2:54735736-54735758 CCCTTTCAATGTAAGAAATGTGG + Intronic
931784117 2:65603864-65603886 CTATTTTGATGTCAGAAATCTGG - Intergenic
933299413 2:80525359-80525381 CTCTTTCAATCTGAATGATCTGG + Intronic
933653933 2:84871927-84871949 CAGTTTCAATCACAGAGATCTGG + Intronic
933800315 2:85955171-85955193 TTCTCTCAATCTCAGAGATAAGG + Intergenic
935301919 2:101699840-101699862 CTCTTTCAAATTCAAAAATCTGG - Intronic
936534272 2:113299720-113299742 CTCTTGCAATCTTGGAGATCTGG + Intergenic
936629348 2:114184593-114184615 TTCCTTCAATGTCACACATCAGG + Intergenic
938553780 2:132404572-132404594 CATTCTCATTGTCAGAGATCAGG + Intergenic
939881783 2:147639637-147639659 CCCTTTCTCTGTCAGAGATTTGG - Intergenic
941317960 2:164018381-164018403 CTCATTCAATGTCATATAGCTGG - Intergenic
943581995 2:189694741-189694763 TCCTTTCCATGTCAGTGATCTGG - Intronic
944853258 2:203741996-203742018 CTCTTTCAATGTCATAGATCAGG + Intergenic
947382906 2:229562685-229562707 CTCTCTCAAAGTCACAGAGCTGG - Intronic
947942144 2:234066965-234066987 CTCTTTGAATGTCTTAGTTCAGG + Intronic
948774382 2:240275325-240275347 CTCTTTCTGTGTCAGAGATGAGG + Intergenic
1169636659 20:7699679-7699701 CTCTTGCAAAGTCAGAAATCAGG + Intergenic
1171462096 20:25303687-25303709 CTCTGTCCATGGCAGGGATCTGG + Intronic
1172233367 20:33352329-33352351 CTCCTGGAAAGTCAGAGATCTGG + Intergenic
1174140195 20:48407395-48407417 CTCTTTCATGGTAAAAGATCTGG + Intergenic
1174875121 20:54219675-54219697 ATCTATCAATATCAGAGATTTGG + Exonic
1177579949 21:23008445-23008467 TTCTTTCAACGTGAGAGAACAGG - Intergenic
1179244193 21:39616173-39616195 CTCTTTCATTTTCAGAGACGGGG - Intronic
1183145503 22:35987734-35987756 CACATTCTATGTCACAGATCAGG + Intronic
950633565 3:14299607-14299629 CTCTTCCACAGTCAGGGATCTGG - Intergenic
950945051 3:16936784-16936806 CTCTTGGCATATCAGAGATCAGG + Intronic
953890108 3:46744903-46744925 CTCTTCCCATTTCAGAGATGGGG + Intronic
955656346 3:61249098-61249120 CTCTTTCAAGGCCACAGACCAGG - Intronic
957557304 3:81779327-81779349 ATCCTTAAATGTCAGAGATCTGG + Intergenic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
959452839 3:106523989-106524011 CTCTATCAATGGCACAGAACTGG + Intergenic
963087026 3:141446881-141446903 CTCTTTCATTCTCTGAGATGAGG - Exonic
965664587 3:171079338-171079360 CTCTTTCAATTTCATCAATCTGG + Intronic
966654428 3:182339025-182339047 CTCTTCCAATGACAGAGCTTGGG - Intergenic
967109888 3:186283943-186283965 GACTGTCAATGTCAGAGATAGGG - Intronic
968938987 4:3628250-3628272 CTGTTTAAAAGTCAGGGATCCGG + Intergenic
970565605 4:17329472-17329494 CTTTTTCAGTGTCAGATATTTGG - Intergenic
971143559 4:23951110-23951132 GTCTTTCAAAGTCAGAGAGAGGG - Intergenic
973030930 4:45337810-45337832 CTTTTTCAAGGTTAGAGATAGGG + Intergenic
973927633 4:55755748-55755770 CTGTTATAAGGTCAGAGATCAGG + Intergenic
975847518 4:78540686-78540708 CTCCTTCATTGTCATAGATGAGG - Intronic
978106558 4:104909048-104909070 CACATTTAATGTCAGAGATAAGG - Intergenic
979057639 4:116016227-116016249 CTCTTTTAATGTCAGAAGGCTGG + Intergenic
981519099 4:145642502-145642524 CTTTTTCAATTGCAGAGGTCTGG + Intronic
984220682 4:176970970-176970992 CTCTTTCAATGTGACAAATAAGG - Intergenic
984429048 4:179625095-179625117 CTCTTTCAGTCTCATAGCTCAGG + Intergenic
985992607 5:3575696-3575718 CTCTGGCAATGGCAGAGACCAGG + Intergenic
986594065 5:9402428-9402450 CTCTTTCAAAGTCACAAAGCTGG - Intronic
986635480 5:9818302-9818324 CTCTCTCAGAGTCAGAGATTTGG + Intergenic
987779581 5:22416799-22416821 CTCTTTCAATTTCAGATGGCAGG - Intronic
989292600 5:39787236-39787258 CTCTTTAAATGTCTGATATGAGG + Intergenic
992085594 5:73275434-73275456 CTCTTTCTACCTCAGAGAACTGG + Intergenic
993028635 5:82676509-82676531 ATATTTCAATGTCTGAGCTCTGG - Intergenic
993953407 5:94202474-94202496 CTCTGCCAATGTCAGGGAACTGG + Intronic
998619051 5:143774390-143774412 CTCTTTTTAAGTTAGAGATCTGG + Intergenic
1000058214 5:157628234-157628256 CTCTTTCAAAGGCATAGAGCAGG + Intronic
1006285058 6:33086355-33086377 CTCTTTCAATGTCAGCCTTCAGG + Intronic
1009244461 6:61218756-61218778 CTCTTTAAAAGTCAAAAATCAGG - Intergenic
1010180954 6:73086142-73086164 CTCATTCAATGTCAGAGAGAGGG - Intronic
1014776874 6:125521119-125521141 CCCTTTCAATGTGTAAGATCTGG + Intergenic
1014880583 6:126719177-126719199 CTCTTTCTATGTCAGGGTTAAGG - Intergenic
1015033913 6:128629557-128629579 CTATTTTAATTTCAGAGTTCTGG + Intergenic
1015580235 6:134716392-134716414 CACGTTCAATCTCAGTGATCAGG + Intergenic
1016808807 6:148239515-148239537 CCTTTTCATTGTCAGAGTTCTGG + Intergenic
1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG + Intergenic
1020116760 7:5480439-5480461 CTCTTTCTTTTTCAGAGATGGGG + Intronic
1020785630 7:12569914-12569936 CTCTGTAAATCTCAGAGTTCAGG - Intergenic
1021503864 7:21359149-21359171 CTCCTTCAATGTCAGGGAACTGG + Intergenic
1023600791 7:41880146-41880168 ATCTTTCAAGGCCAGAGCTCTGG - Intergenic
1025830767 7:65047287-65047309 CTGTTTCATTGACAGAGAACAGG - Intergenic
1025917931 7:65881199-65881221 CTGTTTCATTGACAGAGAACAGG - Intronic
1026365055 7:69639918-69639940 CTCTTACAGTCTTAGAGATCTGG + Intronic
1026425669 7:70290353-70290375 ATGTTTCCATTTCAGAGATCAGG + Intronic
1028795688 7:94900257-94900279 TTCTTACAATGTCAGACAACAGG - Intergenic
1030938168 7:115612671-115612693 CTTCTTCAATGTCAGATATGAGG + Intergenic
1031496458 7:122454939-122454961 CGCTTTCTTTGTCAGAGAACTGG + Intronic
1031883608 7:127222983-127223005 CTCTCTCAAGGTCAGAGAACAGG - Intronic
1032673293 7:134105922-134105944 CTTGTTCAATGACAGAGATACGG - Intergenic
1033014916 7:137661870-137661892 CTCTTAGAATGTCAGGAATCTGG + Intronic
1033371750 7:140715177-140715199 CTCTTTGGATGTCACAGAGCAGG + Intronic
1039209125 8:35191550-35191572 CTCCTTGAAAGTTAGAGATCTGG - Intergenic
1042612561 8:70614723-70614745 CTCTGTCTCTGTCAGAGAACTGG - Intronic
1044825845 8:96196051-96196073 GTCTTGCAATGACAGAGTTCAGG - Intergenic
1045366427 8:101480278-101480300 CTCTTGCACGGTAAGAGATCTGG - Intergenic
1045722503 8:105130351-105130373 CTCTTTCAATGTCAATTACCAGG + Intronic
1046545854 8:115649202-115649224 CTAATTCATTGTCAGAGATAAGG - Intronic
1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG + Intergenic
1050062897 9:1729169-1729191 CTTTTTCATTGTCAGAGCTTTGG + Intergenic
1050710647 9:8458709-8458731 CTCTCTCCATGTAAGAGATAAGG - Intronic
1052546772 9:29889725-29889747 CTCCATCAAGGTCAGAGAACTGG + Intergenic
1054451760 9:65407070-65407092 CTGTTTAAAAGTCAGGGATCTGG - Intergenic
1055893522 9:81148514-81148536 ATCTTGGAATGTCAGGGATCAGG - Intergenic
1057543250 9:95996177-95996199 CTTTCTCCATGTCAGAGATAAGG - Intronic
1058187010 9:101866880-101866902 CTCTTTTAATTTCAGAAAGCTGG - Intergenic
1058650547 9:107171931-107171953 CTCTTTCAGGGAAAGAGATCAGG - Intergenic
1058801255 9:108546362-108546384 CTGTTACAATTTCAGAGATAAGG - Intergenic
1062360742 9:136186761-136186783 CCCTTCCAGTGTCAGAGGTCAGG - Intergenic
1188943489 X:36267060-36267082 TTCTTTCAATGTCAAAGACTTGG - Intronic
1192269247 X:69563414-69563436 TTCTTTCCATGTCAAAGATAAGG - Intergenic
1193394797 X:80970720-80970742 CTCTATCATTGTCAGACATTTGG + Intergenic
1195545821 X:106111480-106111502 CTCTTTCAATGTCAGTAGTGTGG - Intergenic
1195569393 X:106381804-106381826 CCCTGTCACTGGCAGAGATCAGG + Intergenic
1197999190 X:132414115-132414137 CTCTTTTAATGTGAGTAATCAGG - Intronic
1198713626 X:139532734-139532756 CTCTTTAAATGTCTGATATAAGG + Intronic
1198880695 X:141277888-141277910 CTGTTGCATTGTCAGAGGTCAGG - Intergenic
1201571985 Y:15424537-15424559 TTCTTTCAATGTCAGATGGCTGG + Intergenic
1202070941 Y:20990862-20990884 CTCTTTTAGTGTCAGAGGGCTGG + Intergenic
1202077161 Y:21048144-21048166 GTCTATCATTGTCAGACATCTGG + Intergenic