ID: 901494462

View in Genome Browser
Species Human (GRCh38)
Location 1:9613343-9613365
Sequence CCTTGGGGCTCCCTGGCTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 5, 3: 81, 4: 502}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901494462_901494473 -5 Left 901494462 1:9613343-9613365 CCCGAAGCCAGGGAGCCCCAAGG 0: 1
1: 0
2: 5
3: 81
4: 502
Right 901494473 1:9613361-9613383 CAAGGGGCTGCATGACCCTGGGG 0: 1
1: 0
2: 3
3: 17
4: 194
901494462_901494480 26 Left 901494462 1:9613343-9613365 CCCGAAGCCAGGGAGCCCCAAGG 0: 1
1: 0
2: 5
3: 81
4: 502
Right 901494480 1:9613392-9613414 ACAGTTCAGCCCTGCCTGGCAGG 0: 1
1: 0
2: 3
3: 21
4: 248
901494462_901494481 27 Left 901494462 1:9613343-9613365 CCCGAAGCCAGGGAGCCCCAAGG 0: 1
1: 0
2: 5
3: 81
4: 502
Right 901494481 1:9613393-9613415 CAGTTCAGCCCTGCCTGGCAGGG 0: 1
1: 0
2: 1
3: 24
4: 299
901494462_901494470 -7 Left 901494462 1:9613343-9613365 CCCGAAGCCAGGGAGCCCCAAGG 0: 1
1: 0
2: 5
3: 81
4: 502
Right 901494470 1:9613359-9613381 CCCAAGGGGCTGCATGACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 209
901494462_901494472 -6 Left 901494462 1:9613343-9613365 CCCGAAGCCAGGGAGCCCCAAGG 0: 1
1: 0
2: 5
3: 81
4: 502
Right 901494472 1:9613360-9613382 CCAAGGGGCTGCATGACCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 196
901494462_901494479 22 Left 901494462 1:9613343-9613365 CCCGAAGCCAGGGAGCCCCAAGG 0: 1
1: 0
2: 5
3: 81
4: 502
Right 901494479 1:9613388-9613410 CCACACAGTTCAGCCCTGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901494462 Original CRISPR CCTTGGGGCTCCCTGGCTTC GGG (reversed) Exonic
900014725 1:140091-140113 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
900044592 1:495293-495315 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
900044991 1:498700-498722 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
900065995 1:730199-730221 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
900066394 1:733608-733630 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
900066790 1:737014-737036 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
900067188 1:740430-740452 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
900711365 1:4116632-4116654 CCTTGGTGCTCCTTGGCTCCTGG + Intergenic
901184210 1:7361902-7361924 CCCTGGGGCTGCCTTCCTTCTGG + Intronic
901194095 1:7430626-7430648 CCATGAGGATCCATGGCTTCAGG + Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
901633688 1:10659877-10659899 CCTTGGCGGGGCCTGGCTTCTGG + Exonic
901742368 1:11350680-11350702 CCTCTCGACTCCCTGGCTTCGGG + Intergenic
902246339 1:15123413-15123435 CCTTGGGGACATCTGGCTTCAGG - Intergenic
902489854 1:16773343-16773365 CCTTGCCGCTTTCTGGCTTCTGG + Intronic
902601064 1:17540320-17540342 CCTTGGGGGTCCCTGGGATCGGG + Intronic
904120458 1:28194388-28194410 ACTTGGGGCTCACTGGATTTGGG - Intergenic
905253096 1:36662367-36662389 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
905563468 1:38945132-38945154 CCTTGGGGCACCTTGGCCTCTGG - Intergenic
906104421 1:43283338-43283360 CCCTGGGGCTGCCTGGCATCTGG - Exonic
906149077 1:43577368-43577390 CCCTGGTGCTCCCTGGCATCTGG + Intronic
906323428 1:44830198-44830220 CCTTGGGGCTTCCTGTCTGCGGG - Intronic
906415904 1:45621426-45621448 CCTTGAGGCTTCCTGGATTTGGG - Exonic
906568789 1:46818893-46818915 AGTTGGGGCCCCCTGCCTTCAGG + Exonic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
908598290 1:65711508-65711530 CCACTTGGCTCCCTGGCTTCAGG + Intergenic
911681376 1:100719752-100719774 CATCGGGCCTCACTGGCTTCAGG + Exonic
912036657 1:105324862-105324884 CCTTGAGATTTCCTGGCTTCAGG - Intergenic
912300691 1:108513699-108513721 CCTTGGCATTCCTTGGCTTCTGG + Intergenic
912518102 1:110228400-110228422 CCTTGACTCTCCCTGGCCTCAGG - Intronic
914916928 1:151824679-151824701 CCTTGGGGATGCCTGCCTTAGGG + Intronic
916142754 1:161713344-161713366 CCTTTGTGGTCCCAGGCTTCCGG - Exonic
916963653 1:169913426-169913448 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
916963663 1:169913478-169913500 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
916963673 1:169913530-169913552 CCTTGCTTCTTCCTGGCTTCTGG - Intergenic
917334631 1:173914880-173914902 CCTTGCTGCTCATTGGCTTCTGG - Exonic
920569067 1:207002733-207002755 CTTTGGGGCTGGGTGGCTTCTGG - Intergenic
920833627 1:209487644-209487666 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
921900395 1:220444098-220444120 CATTCGGGGTCCCTGACTTCTGG - Intergenic
922004591 1:221516899-221516921 CCTTGGCATTCCCTGGCTTGTGG - Intergenic
922262219 1:223952684-223952706 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
922695295 1:227728382-227728404 CCTGGGGCTTCCCTGGCTTCAGG - Intergenic
922780760 1:228250497-228250519 TCCTGGTGCTCCTTGGCTTCTGG + Intronic
923530586 1:234809185-234809207 CCTTGCCGCTTTCTGGCTTCTGG - Intergenic
924344044 1:243057665-243057687 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
924744846 1:246822367-246822389 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1063679336 10:8172129-8172151 CCTCTTGGGTCCCTGGCTTCTGG + Intergenic
1064178659 10:13097026-13097048 CCTTTGGGCTTCCTACCTTCAGG - Intronic
1065772858 10:29093807-29093829 CCCTGGGGTCACCTGGCTTCAGG - Intergenic
1065811492 10:29447655-29447677 CCCTGGGGCTCCCTGGGGGCTGG + Intergenic
1066456542 10:35577228-35577250 CCTTGGCGTTCCTTGGCTTGCGG - Intergenic
1066630315 10:37453485-37453507 CTTTGGTGCTCCTTGGCTTGTGG - Intergenic
1067176927 10:43956682-43956704 CCCAGGGGCTCCTTGGCTTGTGG + Intergenic
1067179752 10:43975799-43975821 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1067512774 10:46909593-46909615 CCTTCTGGGTCACTGGCTTCTGG + Intergenic
1067649471 10:48142229-48142251 CCTTCTGGGTCACTGGCTTCTGG - Intergenic
1068700052 10:60009987-60010009 GCTTGGGTCTCTCTGGCTTATGG - Intergenic
1069121905 10:64577507-64577529 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1069296358 10:66849682-66849704 CCTTGACCCTCCCTAGCTTCTGG - Intronic
1069634534 10:69917349-69917371 CCTTGGGGCTGCCTGGGATGTGG - Intronic
1069831000 10:71282374-71282396 CCTTCGGTCTCCCAGGCTTGAGG - Intronic
1069912932 10:71770863-71770885 CCTTGGGTGTCCCTGGCATTGGG + Intronic
1070201096 10:74207237-74207259 CTTTGGGGCTCTGTGGTTTCTGG - Intronic
1070494327 10:77007983-77008005 CCTGGGGACTCTCTGGCTCCAGG + Intronic
1073323824 10:102631161-102631183 CCCTGGGCCTCCCAGCCTTCAGG + Exonic
1073368649 10:102966985-102967007 CCATGGGGCTACCTGGGGTCTGG + Intronic
1074442059 10:113486663-113486685 CCTTCGTGCTCTCTGCCTTCTGG - Intergenic
1074753092 10:116606008-116606030 CCTGTGGTCTCCCTGGCTTTGGG + Intronic
1074813436 10:117126840-117126862 CCTTGGGCCCTCCTGCCTTCCGG + Intergenic
1074987886 10:118673543-118673565 CTTTGGGGCCAGCTGGCTTCAGG - Intergenic
1075025605 10:118981011-118981033 CCCTGGGACTCCCTCGCTGCAGG - Intergenic
1075383416 10:122037411-122037433 CCTTGGGGAGCCCTGACTGCTGG - Intronic
1075456530 10:122588574-122588596 CCATGGTCCTCCCTGGCTTCTGG - Intronic
1075965752 10:126610160-126610182 CCACAGGGCTCCCTGGCCTCTGG + Intronic
1076035605 10:127196518-127196540 GCTTGGGGCGCCCTCGCCTCTGG - Intronic
1076358634 10:129870693-129870715 CCATTGGGCTCCCTGGCCACAGG - Intronic
1076905179 10:133357790-133357812 GCTCGGGCCTCCCTGGCTTCCGG - Intronic
1076970923 11:131768-131790 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
1076971319 11:135191-135213 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
1076981552 11:207477-207499 GCTTCGGGCTCGCTGACTTCCGG + Intergenic
1077333217 11:1992512-1992534 CCTGAGGGTGCCCTGGCTTCTGG - Intergenic
1077436512 11:2541963-2541985 CCGTGGGGTCCCCTGGCTTGGGG + Intronic
1079083187 11:17428133-17428155 ACTTGGTGGTCCCTGGTTTCTGG + Intronic
1079867891 11:25758467-25758489 CCACTTGGCTCCCTGGCTTCAGG - Intergenic
1079997092 11:27305796-27305818 CTTTGGGGCTCTCTGGTTCCTGG + Intergenic
1080114400 11:28606028-28606050 TCTTGGTGCTCCTTGGCTTGTGG + Intergenic
1081321444 11:41696425-41696447 CCTTGGCGCAACCTGTCTTCTGG - Intergenic
1081637034 11:44727769-44727791 CCTTTGGGGTCCCTGGCAGCGGG + Intronic
1083328383 11:61885288-61885310 GTCTGGGGCTCCCTGGCTCCTGG - Intronic
1083624124 11:64063389-64063411 CCTTGGGCTTCCCTGACATCTGG - Intronic
1083725049 11:64623500-64623522 TCCAGGGGCTCCATGGCTTCAGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1083929544 11:65833356-65833378 GCTTGGGGCGCCCTGGCCGCGGG + Intronic
1084219416 11:67668067-67668089 CCCTGGGCCTCCCTCCCTTCTGG + Intronic
1084428594 11:69099170-69099192 CCTTGTGGCTCCGTGGATTTGGG - Intergenic
1084484505 11:69439905-69439927 CCTTGGCGTTCCCTGGTTTGTGG - Intergenic
1084564611 11:69921908-69921930 CCCTGGGGCTCCCTGGTGGCTGG + Intergenic
1084725635 11:70940006-70940028 TCTTGGTGCTCCTTGGCTTGTGG - Intronic
1087045398 11:93840029-93840051 CCATGTCGCTCCCTGGCTTCAGG - Intronic
1087191279 11:95257208-95257230 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1087377698 11:97365859-97365881 CCTTGAGACTTTCTGGCTTCCGG + Intergenic
1090012673 11:123059427-123059449 CCTTGGGCCTGCCTGCCTTTAGG + Intronic
1090264743 11:125346857-125346879 CCCTGGGTCTGCCTGTCTTCTGG - Intronic
1090465779 11:126931824-126931846 TCCTGGGGCTCCCTGGGTGCTGG - Intronic
1091237525 11:134032031-134032053 CCTTGGGGCTGCCTTGTTTCAGG + Intergenic
1202816197 11_KI270721v1_random:47693-47715 CCTGAGGGTGCCCTGGCTTCTGG - Intergenic
1092878129 12:12866219-12866241 CCTTGCGTCTTCCTGGCTTCTGG - Intergenic
1093772055 12:23029716-23029738 CCTTGCCTCTCCCTGGCATCTGG + Intergenic
1094642770 12:32292188-32292210 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1095163334 12:38941880-38941902 CCTTGGGGGTCCCTGATTCCAGG + Intergenic
1096469245 12:51865841-51865863 CCTGGGGCCTGCCTGGTTTCTGG - Intergenic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097388388 12:58978774-58978796 CCTTGGCGTTCCTTGGCTTGTGG + Intergenic
1098169455 12:67731912-67731934 CCTTGGTGTTCCCTGGCTTGTGG + Intergenic
1098204907 12:68098453-68098475 CCTTGCCTCTTCCTGGCTTCCGG + Intergenic
1098608492 12:72424183-72424205 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1098891336 12:76012905-76012927 CCTTGGGGATTACTGGGTTCAGG - Intergenic
1099925471 12:89011260-89011282 CCCAGGGGCTCCTTGGCTTGTGG + Intergenic
1100690292 12:97032294-97032316 CTTTGGGGCTTCCAAGCTTCGGG - Intergenic
1101425610 12:104585820-104585842 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1101634121 12:106523076-106523098 CCTTGCACCTCCCTGACTTCAGG + Intronic
1101875958 12:108597210-108597232 TCTTGGGGCCCCCAGGCCTCAGG - Intronic
1103273356 12:119691303-119691325 CTTTGTGGGTCCCTGACTTCTGG - Intronic
1103448181 12:121008566-121008588 CTTTGTGACTCTCTGGCTTCAGG - Intronic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1104074882 12:125380236-125380258 TCTTGGAGATCCCTGGCTTGTGG + Intronic
1104589815 12:130075287-130075309 TCTTGAGGCTCCCAGACTTCAGG - Intergenic
1104752506 12:131248607-131248629 CAGTGGGGCTCCCTGCCCTCTGG - Intergenic
1104779434 12:131410630-131410652 CAGTGGGGCTCCCTGCCCTCTGG + Intergenic
1105696798 13:22897443-22897465 ACTAGGGGCTTCCTGGCTGCGGG + Intergenic
1105850378 13:24328833-24328855 CTTTGGGTCTCCTTTGCTTCTGG - Intergenic
1106554296 13:30796921-30796943 GCTTGTGGCTCCATGGCTCCCGG + Intergenic
1108587466 13:51883080-51883102 CCTTGGGGCTCCACGGTTGCTGG - Intergenic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1109521160 13:63512057-63512079 CCTTGGGGCTCCAGGGTTGCTGG + Intergenic
1110135502 13:72062597-72062619 CCACTTGGCTCCCTGGCTTCAGG - Intergenic
1111055139 13:82938773-82938795 CTTTGGGACTCCATGGTTTCTGG + Intergenic
1111277295 13:85966926-85966948 CCTTGGGGCTAGGTGGCTGCTGG - Intergenic
1111485788 13:88896495-88896517 CCTTGGGGCTCTGTGGTTCCTGG + Intergenic
1112456581 13:99568628-99568650 CCTGGGGGGTCACTGCCTTCTGG + Intergenic
1113067197 13:106384544-106384566 CCTGGCCGCTCCTTGGCTTCAGG + Intergenic
1113638410 13:111938170-111938192 GCTGCAGGCTCCCTGGCTTCAGG + Intergenic
1113670314 13:112171457-112171479 CCAATGGGCTCCCTGCCTTCCGG + Intergenic
1115910323 14:38249381-38249403 CCTTGGTGTTCCCCGGCTTGCGG - Intergenic
1117369437 14:55063029-55063051 CCATGGGGATCCATGTCTTCTGG + Exonic
1117580881 14:57150625-57150647 CCTTGCCCCTCCCTAGCTTCTGG + Intergenic
1118616976 14:67580656-67580678 CCATGGGGCTGCCTAGCCTCTGG + Intronic
1119267273 14:73270340-73270362 CCTTGGGGCTCCGCGGTTGCTGG - Intronic
1119712207 14:76830370-76830392 CATCGGGCCTCCCTGGATTCTGG - Intronic
1119746903 14:77051236-77051258 TCTGGGGGCTGCCTGGCTTTTGG + Intergenic
1119862181 14:77944120-77944142 CCTTGGGCCTCTCTGGATGCTGG + Intergenic
1120130302 14:80799184-80799206 CGTTTGGGGTCCCTGACTTCCGG - Intronic
1120444675 14:84579315-84579337 CCTTGGGGCTCCGTGGTTGCTGG + Intergenic
1120736394 14:88057709-88057731 ACTTGGTGCTCCCTCGTTTCGGG - Intergenic
1121013606 14:90535412-90535434 CCCCAGGGCTCCCTGGCTTGGGG + Exonic
1121287864 14:92750529-92750551 CTTGTGGTCTCCCTGGCTTCAGG - Intergenic
1121316701 14:92965135-92965157 CCATGGAGCTCCCTGGCTCAGGG + Intronic
1121340232 14:93100627-93100649 CCTTGGGGCATTCTGGCTTCAGG - Intronic
1121530578 14:94649883-94649905 CCTTTGGGCTTCCTCGTTTCAGG - Intergenic
1122143361 14:99675212-99675234 CCCTCCGGCTCCCTGGCTGCTGG - Exonic
1122174908 14:99909681-99909703 GCTTGGTGCTCCCTGGGTCCAGG - Intronic
1122385999 14:101348711-101348733 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1123665736 15:22608492-22608514 CCCTGGGGCTCCAGGGCCTCTGG + Intergenic
1123752024 15:23364160-23364182 CCCTGGGGCTCCAGGGCCTCTGG - Intronic
1123931006 15:25171651-25171673 CCCTGGGACTCGCTGGCTTTGGG + Intergenic
1124111685 15:26795893-26795915 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1124189495 15:27562149-27562171 TATTGTGGCTTCCTGGCTTCTGG + Intergenic
1124284390 15:28388085-28388107 CCCTGGGGCTCCAGGGCCTCTGG - Intronic
1124298307 15:28523529-28523551 CCCTGGGGCTCCAGGGCCTCTGG + Intronic
1124482954 15:30092525-30092547 CCCTGGGGCTCCAGGGCCTCTGG - Intronic
1124489406 15:30144596-30144618 CCCTGGGGCTCCAGGGCCTCTGG - Intronic
1124520623 15:30404693-30404715 CCCTGGGGCTCCAGGGCCTCTGG + Intronic
1124538034 15:30561526-30561548 CCCTGGGGCTCCAGGGCCTCTGG - Intronic
1124544494 15:30613587-30613609 CCCTGGGGCTCCAGGGCCTCTGG - Intronic
1124564457 15:30801022-30801044 CCCTGGGGCTCCAGGGCCTCTGG - Intergenic
1124754122 15:32393731-32393753 CCCTGGGGCTCCAGGGCCTCTGG + Intronic
1124760616 15:32446059-32446081 CCCTGGGGCTCCAGGGCCTCTGG + Intronic
1124778017 15:32603003-32603025 CCCTGGGGCTCCAGGGCCTCTGG - Intronic
1125728301 15:41879345-41879367 CCTCTGAGCTCCCTGGCTGCAGG + Exonic
1127264997 15:57353981-57354003 CTCTGGGGCTCCCTGCCTACAGG + Intergenic
1127776531 15:62268283-62268305 CCTTTGGGCCCCCTGCCCTCAGG + Intergenic
1127790183 15:62391815-62391837 CCTTGGGGCTCCGAGGCTCAGGG + Intronic
1128407353 15:67356293-67356315 CCTCTGGTTTCCCTGGCTTCCGG - Intronic
1128453670 15:67821336-67821358 CCTGGGGGCGTCCTGGCTCCAGG + Intronic
1129057421 15:72830892-72830914 CCATGCGTCTCCCTGGCTTCTGG + Intergenic
1129664583 15:77572408-77572430 CCTGGAGGGTCCCTGGGTTCTGG + Intergenic
1130981643 15:88815978-88816000 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1130986435 15:88847699-88847721 CCTGGGGGATTTCTGGCTTCAGG - Intronic
1132286738 15:100668980-100669002 ACTAGGGGCTCCATGGCTTCTGG + Intergenic
1132745048 16:1433038-1433060 CCTTGGGGTACCCTGGGCTCCGG - Intergenic
1133403834 16:5507785-5507807 CCTTGGGGTTCATTGGCTTGTGG - Intergenic
1133614764 16:7465675-7465697 CCCTGGGGATCCTTTGCTTCTGG + Intronic
1133837423 16:9379247-9379269 CCTTGGTGTTCCTTGGCTTAAGG + Intergenic
1134061570 16:11202620-11202642 CCTTGGGGTGCCCAGGCTTGGGG + Intergenic
1135205246 16:20478429-20478451 TCTTGGGTTCCCCTGGCTTCTGG + Intronic
1135396353 16:22134626-22134648 CCTTGCCCCTCCCTGGCTTCTGG + Intronic
1135654127 16:24232935-24232957 CCTTAGGTCTTTCTGGCTTCAGG + Intergenic
1138268596 16:55678552-55678574 CTGTGGGGCTGCTTGGCTTCAGG - Intronic
1138613766 16:58148111-58148133 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
1139138618 16:64234149-64234171 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1139294024 16:65884455-65884477 CCCTGGGGCTCCCAGGCTTATGG - Intergenic
1139371429 16:66471776-66471798 CTTGGGGAGTCCCTGGCTTCTGG - Intronic
1139675337 16:68519585-68519607 ACTAGTGGCTCCCTGGATTCCGG + Intergenic
1140046124 16:71441622-71441644 CCTTGGTGCCCCCTGGCGGCCGG - Intergenic
1140141141 16:72259136-72259158 CCTAGGTGCTCCTTGGCTTGTGG - Intergenic
1140861905 16:79025518-79025540 CCTCAGTGCTCCCTGGCTTGTGG - Intronic
1141465586 16:84203926-84203948 CTCCTGGGCTCCCTGGCTTCAGG + Intergenic
1141551542 16:84809872-84809894 CCCTGGAGTTCCCTGGCTTCTGG - Intergenic
1141564927 16:84894984-84895006 CCTCGGGGCAGCCTGGCTTGGGG - Intronic
1142030421 16:87835804-87835826 CCCCGGGGCCCCCAGGCTTCGGG + Intronic
1142232807 16:88907661-88907683 CCTCGGGGTTCCCAGGCTGCAGG - Intronic
1142438160 16:90076328-90076350 CCTTGAGGCCCCCTGACTGCTGG + Intronic
1142448934 16:90162331-90162353 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1142449335 16:90165750-90165772 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1142457761 17:66131-66153 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
1142621936 17:1170820-1170842 CCTTGGGTCTCCCAGGATCCTGG - Intronic
1142811859 17:2399285-2399307 TGTTGGTGGTCCCTGGCTTCAGG - Intronic
1142953688 17:3505581-3505603 CCATGGGACTCTCAGGCTTCAGG - Intronic
1143031665 17:3971390-3971412 CCTTAGGGCAGCCTGGCCTCAGG + Intergenic
1143140803 17:4740794-4740816 CCTGGGGACTGCCTGGCTCCTGG + Exonic
1143202624 17:5122911-5122933 GCTTGGCGGTCCCCGGCTTCGGG - Intronic
1143367031 17:6415135-6415157 TCTTGGGGCTCCCTGGCCAGAGG + Intronic
1143377128 17:6473399-6473421 CCCTAGGGCTCCCTGGATGCTGG - Intronic
1143650596 17:8261911-8261933 CCCTGGAGCCCCCAGGCTTCAGG + Intronic
1143861850 17:9897050-9897072 ACTGGGGGCTCCCTGGAGTCAGG - Exonic
1145207518 17:20992528-20992550 CCTCGGGGGTCCCAGGCTGCAGG - Intergenic
1145790811 17:27625509-27625531 CTTTGGGGCCCAGTGGCTTCTGG - Exonic
1147262076 17:39214548-39214570 CCCTGGGGCTGCCTGCCTTTGGG + Intronic
1147727758 17:42577410-42577432 CCGTCGGACTCCCTGGATTCAGG - Intronic
1148245317 17:46026362-46026384 CCTTGGGGCTCCCTGTGTCAGGG + Exonic
1148480725 17:47957992-47958014 CCCTGGAGAACCCTGGCTTCTGG - Intergenic
1149849374 17:60026233-60026255 GCTTGGCGGTCCCCGGCTTCGGG + Intergenic
1149860794 17:60120291-60120313 GCTTGGCGGTCCCCGGCTTCGGG - Intergenic
1150383537 17:64739695-64739717 CCTGGGGTCTCCCTGGCAGCTGG + Intergenic
1150441674 17:65196654-65196676 CCATGGCACACCCTGGCTTCTGG - Intronic
1150596803 17:66613583-66613605 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1150652050 17:67016676-67016698 GCTTGTGGCTCCCAGGCTGCAGG + Intronic
1151162172 17:72175129-72175151 GCTGGGGTTTCCCTGGCTTCGGG - Intergenic
1151552109 17:74828202-74828224 GCTTGGGGCGCCCTGACCTCAGG + Intronic
1151684836 17:75640351-75640373 CCATGGCTCTCCCTGGCATCTGG + Intronic
1152375924 17:79919031-79919053 GCATGTGGCTCCCTGGCTTCTGG + Intergenic
1152422546 17:80201953-80201975 CTCTGGGGGTCCCTGGCTGCTGG - Intronic
1152581575 17:81167669-81167691 CCTTAGGGGTCCCTGGCTGTAGG + Intergenic
1152640500 17:81447358-81447380 CCTCGGGGCCCCCTGCCTCCAGG - Exonic
1152681476 17:81670550-81670572 CCATGGGGCAGCCTGGATTCAGG + Intronic
1152854871 17:82658999-82659021 CCTGGGCCCTCCCTGGCTTGTGG - Intronic
1152908784 17:82985022-82985044 CTTTGGGCCTCCCTGGAATCAGG + Intronic
1155319977 18:24609449-24609471 CCTTGGGTTGCTCTGGCTTCAGG - Intergenic
1156327365 18:36086173-36086195 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1157796874 18:50582845-50582867 CCTTGGGGCTCCATGATTGCTGG - Intronic
1158973322 18:62688335-62688357 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1160301672 18:77687318-77687340 GTTTGGGGATCACTGGCTTCGGG - Intergenic
1160370403 18:78368360-78368382 CTTCAGGGCACCCTGGCTTCGGG + Intergenic
1160415392 18:78706384-78706406 CCTGGGCTCTCTCTGGCTTCCGG - Intergenic
1160461460 18:79041987-79042009 CCTTGGGTCTCACTGCCTTCAGG - Intergenic
1160557648 18:79736438-79736460 CCCTGCGGGTCCCTGGCTTCCGG - Exonic
1160607158 18:80059722-80059744 GCTTGGGGCCCCCTGGCTGCAGG + Intronic
1160647874 19:202057-202079 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
1160648272 19:205471-205493 CCTTGCGGCTCCATGGCTCAGGG + Intergenic
1160773288 19:843423-843445 CCTGGGGGCTCCCTGACGCCTGG + Intronic
1161127429 19:2566286-2566308 CCTTGGCCTTCCCTGGCTTGTGG - Intronic
1161159650 19:2754870-2754892 TCCTGGGGCTCCCTGGCTCCTGG - Exonic
1161227040 19:3151526-3151548 CCTTGGGGCTCCATTGCCTCAGG + Intronic
1161764353 19:6198415-6198437 GTTTGGGGCTCCTTGGCTCCTGG + Intronic
1161942626 19:7415226-7415248 CCTGGGTTCTCCCGGGCTTCAGG + Intronic
1161981996 19:7634782-7634804 CCTTGCCCCTCCCTGGCTTTTGG + Intronic
1162148443 19:8628258-8628280 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
1162208223 19:9071859-9071881 CTTTGTGCCTCACTGGCTTCAGG - Intergenic
1162230288 19:9260416-9260438 GCTCTGGTCTCCCTGGCTTCAGG - Intergenic
1162765869 19:12919108-12919130 CATTGGGGCTCCCTCTCATCAGG - Intronic
1162792194 19:13068950-13068972 CATTCGGGGTCCCTGGTTTCTGG - Intronic
1163055193 19:14712661-14712683 CCTTGGTGCTCCTTGGCTTGTGG + Intronic
1163055458 19:14714404-14714426 ACTTGGGGCTCCTTGGCTTGTGG - Intronic
1163055471 19:14714441-14714463 CCTTGCCCCTCCCTGGCTTCTGG - Intronic
1163793073 19:19319640-19319662 CACTGTGGCTCCCTGGGTTCAGG - Intronic
1164981716 19:32619379-32619401 CGTTGGGGCTCCTTGGCTGCAGG - Exonic
1165118637 19:33544967-33544989 CCTTGGGAGTTCCTGGCTTCTGG + Intergenic
1166717438 19:44977502-44977524 CCTGGGGGCTCCCAGGATGCTGG - Intronic
1167107300 19:47437766-47437788 CCTTGTGGCTCCCCGCTTTCCGG + Intronic
1167230717 19:48281398-48281420 CCTTGGCATTCCCTGGCTTGTGG + Intronic
1167769867 19:51508475-51508497 CCTGGGGGCTGCCTGGCCTCGGG - Intergenic
1168563556 19:57403834-57403856 CCTTGGGGCTCTGTGGTTGCTGG + Intronic
925832249 2:7907286-7907308 CCTGGATGCTGCCTGGCTTCCGG - Intergenic
926028253 2:9563567-9563589 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
926171710 2:10556857-10556879 CCTTGGCACTCCTTGGCTTGTGG - Intergenic
926230955 2:11003506-11003528 CCTTGGGGTTCCTTGGCTAGTGG - Intergenic
926483471 2:13427771-13427793 CCACTTGGCTCCCTGGCTTCAGG + Intergenic
927743082 2:25590119-25590141 CCTTGGGGCTCTGTGGTTCCTGG - Intronic
927918207 2:26950091-26950113 CCTTGTGGTTCTGTGGCTTCTGG - Exonic
929278171 2:40048050-40048072 CCTTGAGGCTCTGAGGCTTCAGG + Intergenic
930176071 2:48302907-48302929 CCACTTGGCTCCCTGGCTTCAGG + Intergenic
930668226 2:54120837-54120859 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
931414967 2:62072408-62072430 CATTGGGACTACCTGCCTTCAGG + Intronic
931415010 2:62072686-62072708 CCTTGGGGCTCCATGTTTGCTGG + Intronic
932578126 2:72973825-72973847 CCTTGGAGCTGCCAGGCTTTCGG + Intronic
932960388 2:76406487-76406509 CCTTGGGGCTCTGTGGTTGCTGG + Intergenic
933598806 2:84308934-84308956 CCTTGGTGCTTCTTGGCTTAGGG - Intergenic
935300158 2:101686807-101686829 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
936448343 2:112614856-112614878 CCACTTGGCTCCCTGGCTTCAGG + Intergenic
937074483 2:119091027-119091049 CCTTGGGTCTCCGTCGCTTCTGG - Intergenic
937286738 2:120758710-120758732 CCTTGGGCCTCCTTGGCTTGCGG + Intronic
938310321 2:130285123-130285145 CTCTGGGGCTCCCAGGCTTCGGG + Intergenic
938444475 2:131366741-131366763 CCCCAGGGCTTCCTGGCTTCGGG - Intergenic
938444610 2:131367246-131367268 CCCTGGGGCTCCCAGGCTTCGGG - Intergenic
938943779 2:136192201-136192223 CCTTGGGGCTCCTTTGCTCTTGG + Intergenic
940128459 2:150354455-150354477 CCTTGGTGTTCCATGGCTTGTGG - Intergenic
940179343 2:150914547-150914569 CCTTGCCTCTCTCTGGCTTCTGG + Intergenic
940582490 2:155600209-155600231 CTTTGGGGCTCTGTGGCTCCAGG - Intergenic
941834132 2:169997428-169997450 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
942447557 2:176088179-176088201 GCCTCGGGCTCCCTGTCTTCAGG + Intergenic
944465626 2:199997004-199997026 CCTTGCTGATTCCTGGCTTCAGG - Intronic
945994593 2:216425408-216425430 CCTTAGGGCTCCATGGTTGCTGG - Intronic
946495675 2:220193024-220193046 CTTTGGGGATCTATGGCTTCTGG + Intergenic
947102060 2:226631259-226631281 CCTTGGGCATCCGTGGCTTCAGG - Intergenic
948262686 2:236615707-236615729 CCTTGACTCTTCCTGGCTTCTGG + Intergenic
948456486 2:238106838-238106860 CCGTGGGGCTCCTTCGCATCTGG - Intronic
948468245 2:238162331-238162353 ACAGGGGGCTCACTGGCTTCTGG + Intronic
948814765 2:240504244-240504266 CCTAGGGGTGCCCTGGCTTGGGG - Intronic
948836928 2:240630393-240630415 CCTGGTGGCTCGCTGGCTCCTGG + Exonic
948943607 2:241208383-241208405 CCTTGGTCCTCCCTGGCTTGTGG + Intronic
1169490851 20:6070395-6070417 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1170458469 20:16554752-16554774 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1171208776 20:23301306-23301328 CCATGCATCTCCCTGGCTTCTGG - Intergenic
1172648767 20:36488257-36488279 CCTTCAGGCACCCTGGTTTCAGG + Intronic
1172854119 20:37988105-37988127 CCTCAGGGCTCCCTGTCTGCTGG + Intronic
1172893551 20:38283874-38283896 CCTGGGGGTTTCCTGGGTTCTGG - Intronic
1173479302 20:43386547-43386569 CCTTGTGGCTTCCAGTCTTCTGG + Intergenic
1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG + Intergenic
1174189477 20:48730003-48730025 CGTCGGTGCTCCCTGGCTTGTGG - Intronic
1175170031 20:57073907-57073929 CCTTGGTGTTCCTTGGCTTTTGG + Intergenic
1175227701 20:57454422-57454444 CCTTGGAGCTCCTTGGCCTGCGG + Intergenic
1175607666 20:60324058-60324080 CCTTGGGGTTCCTTGGCTTATGG + Intergenic
1175803268 20:61813234-61813256 CCTTGGAGGTCCCCAGCTTCGGG + Intronic
1175862279 20:62156800-62156822 CCCTGGGGCTCCCCTGCTCCAGG + Intronic
1175978397 20:62725130-62725152 GGATGGGGCTCCCTGGCTCCTGG + Intronic
1176127590 20:63482848-63482870 CCTTCTCCCTCCCTGGCTTCTGG + Intergenic
1176260430 20:64176690-64176712 CCTTGGTGCCGCCTGGGTTCCGG + Intronic
1176298136 21:5085267-5085289 CCTTGGGGTTCCTTGGCTTGTGG - Intergenic
1176382311 21:6119564-6119586 CTTTGTGGCTCCCTGGGCTCTGG + Intronic
1177546207 21:22561949-22561971 CCTTGGGGCTCCAGGGCCACTGG + Intergenic
1177937525 21:27367895-27367917 CCTTTGGGCTCCATGCCATCAGG + Intergenic
1178166697 21:29985906-29985928 CCTTGGGGCTACGTGGTTGCTGG + Intergenic
1178599901 21:33986237-33986259 TTCTGGGGCTCCCTGCCTTCTGG + Intergenic
1178842164 21:36146453-36146475 CCTTGTGGCTCAGTGGCATCTGG - Exonic
1179466862 21:41581620-41581642 CCCTGGGACTCCCTGGCTCCTGG - Intergenic
1179719365 21:43306602-43306624 GCTTGGGGCTCCCTGGCTTGTGG - Intergenic
1179741161 21:43418675-43418697 CTTTGTGGCTCCCTGGGCTCTGG - Intronic
1179858893 21:44176682-44176704 CCTTGGGGTTCCTTGGCTTGTGG + Intergenic
1180007351 21:45028848-45028870 GCCTGGGGCTCCTTGGCTTGTGG + Intergenic
1180781297 22:18521354-18521376 CCTGGTGACTCCTTGGCTTCTGG + Intergenic
1180971567 22:19818865-19818887 CCTTTGGGCTGCCTGGATGCTGG - Intronic
1181238182 22:21460696-21460718 CCTGGTGACTCCTTGGCTTCTGG + Intergenic
1181347487 22:22230472-22230494 CGGTGGGGCTCCATGGCTCCTGG + Intergenic
1181592786 22:23895230-23895252 CCTCGGGGTTCCTTGGCTTGCGG + Exonic
1181991017 22:26836852-26836874 CCTTCTGGCTCCCAGGCTGCAGG + Intergenic
1182290623 22:29276329-29276351 GCTTGGGGCTTCCTGTTTTCTGG + Intronic
1182508697 22:30803397-30803419 CCTTGTGACTGTCTGGCTTCTGG - Intronic
1182910336 22:33978942-33978964 CCATGGGGGTCACTGCCTTCTGG - Intergenic
1183520483 22:38293774-38293796 CCTGGGGGCTCCCTGATGTCAGG + Intronic
1183872304 22:40749024-40749046 CCTTGGGGCTCTGTGGTTGCTGG + Intergenic
1183872824 22:40753460-40753482 CCTTGGGGCTCCATGGTTGCTGG - Intergenic
1184272418 22:43392411-43392433 GCATGGGGCTCCCTGGGATCTGG + Intergenic
1184607317 22:45581607-45581629 CCTTGGGCCTCCCGGGTTGCAGG + Intronic
1184745172 22:46451962-46451984 GCTTGCGGCTGCCTGGCTCCAGG - Intronic
1185042189 22:48510728-48510750 GCTCTGAGCTCCCTGGCTTCAGG + Intronic
949307667 3:2661255-2661277 CCTTGGGGCTGCCTGGCTTTGGG - Intronic
949369980 3:3324403-3324425 CCTTGCCTCTCCCTAGCTTCTGG - Intergenic
949996715 3:9623081-9623103 TCTTGCCTCTCCCTGGCTTCAGG - Intergenic
951661353 3:25070065-25070087 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
952240678 3:31528922-31528944 GCTTGGGACTCCATGGCTACGGG - Intergenic
952954780 3:38550216-38550238 CCTGGGGCCTTCCTGGCTTTGGG - Exonic
953147340 3:40290878-40290900 CCTTGGGGCTCTGTGGTTGCTGG - Intergenic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
953457810 3:43056473-43056495 CCTTGTGCCCCTCTGGCTTCTGG - Exonic
954461472 3:50629370-50629392 GCTTGGGGACCCCTGGCTTTAGG - Intronic
954461497 3:50629497-50629519 CCTTGTGGCTCCCTGGGAACAGG + Intronic
955059461 3:55483207-55483229 ACTTGGGTCTCCCTGGCTCCAGG + Intronic
955499478 3:59569958-59569980 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
958878023 3:99637991-99638013 GCTGGGGGCTGCCTGGCTCCAGG + Intergenic
959527042 3:107388926-107388948 CCTTGGGGCTCACAGGCCTTGGG - Intergenic
960404159 3:117238891-117238913 TCTTGGGGGTCCCTGATTTCAGG + Intergenic
960480209 3:118179018-118179040 CCTTGGGCCTCCCAGTCTTCAGG - Intergenic
961348243 3:126278704-126278726 CCAGGGAGCTCCCAGGCTTCTGG + Intergenic
961424497 3:126834513-126834535 CCTAGGAGCTCCCCTGCTTCTGG - Intronic
961457291 3:127030503-127030525 ACTTGGGGCTCCCTGGCGTGGGG + Intronic
961473518 3:127133288-127133310 CCTGGGGGTTCCCAGGGTTCAGG + Intergenic
961624578 3:128253032-128253054 CATTAGGGCACCCTGGCTTCTGG - Intronic
962663323 3:137627366-137627388 CCTTGGCACTCCTTGGCTTGTGG + Intergenic
962677740 3:137769014-137769036 GTCTGGGGCTCCCTGGCTACCGG - Intergenic
963071916 3:141311633-141311655 CCTGTGGTCTCTCTGGCTTCTGG - Intergenic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
964505113 3:157390880-157390902 CCTCGGGGCTCCATGGTTGCTGG + Intronic
965002887 3:162980512-162980534 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
965253153 3:166368719-166368741 CTCTGAGACTCCCTGGCTTCAGG + Intergenic
968369574 3:198214644-198214666 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
968369973 3:198218058-198218080 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
968717974 4:2175853-2175875 CCTTTGCCCTCCCTGGCCTCTGG + Intronic
969045005 4:4330296-4330318 CTTTGGTGCTCCCTGGCCTGTGG - Intergenic
969347021 4:6576074-6576096 CCTTGGAGCTCCCAGCCTTGGGG + Intronic
969359165 4:6650744-6650766 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
969432906 4:7166447-7166469 CCTTGGAGTTCCTTGGCTTGTGG - Intergenic
969471534 4:7392204-7392226 CCTTGTGTCTCCCAGGGTTCTGG + Intronic
970203045 4:13628239-13628261 CCGTGGGGGTCCCTTGTTTCTGG + Intergenic
970964892 4:21917014-21917036 CCTTGTGGCTTCTTTGCTTCAGG + Intronic
973967789 4:56181667-56181689 CCTTGGCTCTTCCTGGCTTCTGG + Intronic
974589250 4:63921897-63921919 CCTTGGGGCTCCATGGTTGCTGG - Intergenic
974875816 4:67701258-67701280 CCTAGGGGCGTCCTGGTTTCCGG + Intergenic
977987894 4:103406232-103406254 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
978635152 4:110795475-110795497 ACTCGGGGCTCCTAGGCTTCAGG + Intergenic
979724387 4:123942734-123942756 CCTTGGGGCTCCATGGTTGCTGG + Intergenic
981727364 4:147861937-147861959 CCCAGCGGCTCCCAGGCTTCAGG + Intronic
982494793 4:156077426-156077448 CCTTGGGGCTTCGTGGCTGCTGG - Intergenic
982635195 4:157887135-157887157 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
982807797 4:159788496-159788518 CATTTGGGGTCCCTGACTTCTGG - Intergenic
983187287 4:164714749-164714771 CCTTGGGTCTGCCCTGCTTCAGG - Intergenic
983804226 4:171973443-171973465 CCTGGGGGTTCCTTGGCTTGTGG + Intronic
984118338 4:175710052-175710074 TTTTGTGGCTCCCTGTCTTCTGG - Intronic
984373305 4:178894452-178894474 CCTTGGGGCTCCATAGTTGCTGG - Intergenic
985539003 5:479201-479223 CCCAGGGGCGCCCTGGCTGCAGG - Intronic
985699329 5:1361093-1361115 CCCTAGGGCTCCCCAGCTTCTGG - Intergenic
985767326 5:1786932-1786954 CCTTGGGACTCACAGGCCTCAGG - Intergenic
985999670 5:3620600-3620622 CCAGGGGGGCCCCTGGCTTCAGG + Intergenic
986304350 5:6504435-6504457 CCCGGGCGCTCCCTGGCTTGTGG + Intergenic
986632236 5:9784751-9784773 CCTTGGGTTTCCCTGGCTGGTGG + Intergenic
987134688 5:14889826-14889848 CCTTGGAGCTCCCCAGCTACAGG + Intergenic
987156624 5:15096012-15096034 CTTGGGGTCTCGCTGGCTTCAGG + Intergenic
989282914 5:39665457-39665479 CCTTGGGGCTCCGTGGTTGCTGG + Intergenic
992743305 5:79795263-79795285 ACATGGGGCACCCTGGCCTCTGG + Intronic
996616019 5:125441782-125441804 CAGTGGGGCTCCCAGGCTCCAGG - Intergenic
997695279 5:135856550-135856572 CCTTGGGGCAGCCAGGCCTCAGG - Intronic
998972805 5:147611149-147611171 CCACTTGGCTCCCTGGCTTCAGG + Intronic
999886169 5:155925483-155925505 CCTTGGCACTCCTTGGCTTGTGG + Intronic
1000991296 5:167914730-167914752 CCTTGTCTCTCCCTAGCTTCTGG + Intronic
1001085641 5:168698482-168698504 GCTTGTCCCTCCCTGGCTTCTGG - Intronic
1001587835 5:172845267-172845289 CCTTGGGGGGCCCTGGTTGCTGG + Intronic
1001772080 5:174304171-174304193 CCTGGGGGTTCCTTGGCTTGCGG + Intergenic
1002728853 5:181320229-181320251 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1002729252 5:181323636-181323658 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1003352514 6:5331415-5331437 CCTTGGGATTCCCTGGCCACAGG + Intronic
1003816768 6:9850844-9850866 GCTTGGTGCTGCCTGGCATCAGG + Intronic
1004220348 6:13741613-13741635 CCTTGGCACTCCTTGGCTTGCGG + Intergenic
1004645635 6:17558360-17558382 GGTTGGGGATCCCTGGCTTAAGG - Intergenic
1005594810 6:27368804-27368826 CTTTGGGGCTCTGTGGCTCCTGG + Intergenic
1005638906 6:27776197-27776219 GCTGGGGTCTCACTGGCTTCTGG + Intergenic
1006891983 6:37436602-37436624 CCTTGGTGTTCCTTGGCTTGTGG + Intronic
1007721330 6:43887122-43887144 CCCTGGGCCTCCCTGCCCTCTGG + Intergenic
1008909989 6:56721571-56721593 CGTTTGGGGTCCCTGACTTCCGG + Intronic
1009469876 6:64019174-64019196 CCTTGGTGTTCCTTGGCTTGTGG - Intronic
1009631205 6:66202990-66203012 CCTTGGGGCTCCATGGTGGCTGG + Intergenic
1010179869 6:73073725-73073747 CCTTGAAGCTCACTGGCTTCAGG - Intronic
1012091454 6:94902817-94902839 CCTTGAGACTTGCTGGCTTCAGG + Intergenic
1012316803 6:97791190-97791212 CCTTGGGGCTCCATGGTCGCTGG - Intergenic
1012582878 6:100890032-100890054 CCATGGGGATCCATGTCTTCTGG + Intergenic
1014726553 6:124978475-124978497 CCTTGGGGCTCCACGACTGCTGG - Intronic
1015027562 6:128555365-128555387 CCTTGGGTTTCCTTGGCTTGCGG - Intergenic
1015144397 6:129969131-129969153 CCTTGGGTAACCATGGCTTCTGG - Intergenic
1015629052 6:135212906-135212928 GCATGGGGCTCCCAGGCTTCAGG + Intronic
1016426655 6:143942416-143942438 CCTCGGTGCTCCCTAGCTCCAGG + Exonic
1017880624 6:158560288-158560310 AGTTGGGGATCCCTGGCTCCCGG + Intronic
1018643635 6:165928416-165928438 CCTGAGGGCTCCCTGGATCCTGG - Intronic
1018706839 6:166469687-166469709 CCTGGGGGCTCCCTGCCTGCAGG + Intronic
1019014092 6:168867330-168867352 CCCTGGGGAGCCCTGGCATCTGG - Intergenic
1019470053 7:1214689-1214711 CCTTGGTGCCCCCTGGCTCCCGG - Intergenic
1019647912 7:2140761-2140783 CCCTGGGACCCACTGGCTTCTGG + Intronic
1019909342 7:4089657-4089679 CCCTGGGGCTGCCTGACTCCTGG + Intronic
1020013903 7:4820304-4820326 CCCTGGGGCTCCTGGGCTCCCGG - Intronic
1020089815 7:5332834-5332856 CCTTGGGGCCCCGCAGCTTCCGG + Exonic
1021041735 7:15871294-15871316 CCTTGGCGCTCCTTGACTTGTGG - Intergenic
1021343030 7:19488433-19488455 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1022111613 7:27235738-27235760 GCCAGCGGCTCCCTGGCTTCTGG + Intergenic
1022495452 7:30850301-30850323 CCTTGGGGCTCCTGGGCTGCAGG + Intronic
1022565228 7:31392700-31392722 CCTTGAGGCTGTGTGGCTTCTGG + Intergenic
1022778809 7:33557075-33557097 CCTTTCCTCTCCCTGGCTTCAGG + Intronic
1023867437 7:44244894-44244916 CCTTGGGGGTCCCAGCCTGCTGG + Intronic
1023908180 7:44536721-44536743 CCTGGGGGTAGCCTGGCTTCTGG - Intronic
1024746201 7:52409123-52409145 CCTGGGGGCTCACAGGCTACAGG + Intergenic
1024856957 7:53793950-53793972 CTTTGGGGCTCTGTGGCTCCTGG - Intergenic
1026164723 7:67899737-67899759 TGATGGGGGTCCCTGGCTTCTGG + Intergenic
1026858313 7:73769244-73769266 CGCGGGGGCTTCCTGGCTTCTGG + Exonic
1028288946 7:89041340-89041362 CCTTGTGGTTCCCTGGCACCAGG - Intronic
1028602904 7:92621791-92621813 CCTGGGGGCTTCCTGGGTCCAGG - Intronic
1029482817 7:100823425-100823447 CCTTGGGCCTCCCTGGGGGCCGG + Intronic
1029550210 7:101233327-101233349 CCGGGGGTCTGCCTGGCTTCAGG - Intronic
1029705238 7:102272598-102272620 CCTCAGGGCTGCCTGGCTCCTGG + Intronic
1030722035 7:112882002-112882024 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1032050977 7:128650772-128650794 CCTTGTGGCTCCATGGCTCAGGG - Intergenic
1032417147 7:131744560-131744582 CCATGGGTCTACCTGGCTTCAGG - Intergenic
1032522531 7:132556620-132556642 CCTGGGTGCTCCCCTGCTTCTGG + Intronic
1032571907 7:133009476-133009498 CCCTCAGCCTCCCTGGCTTCTGG - Intronic
1032649038 7:133857783-133857805 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
1033305698 7:140223821-140223843 CCATGGGGCTGCCAGGCTCCAGG + Intergenic
1033662156 7:143409419-143409441 CCTTGAGGCTCCCTGCCTTCAGG - Intergenic
1033691315 7:143740310-143740332 CTTTGAGGCTTGCTGGCTTCAGG + Intergenic
1034200622 7:149281223-149281245 CCTCTGGGCTCCCTGGCTCCTGG + Intronic
1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG + Intergenic
1035058405 7:156051793-156051815 CTCTGTGGCTCCCTTGCTTCAGG - Intergenic
1035066131 7:156106186-156106208 CCCTGGGGCTCCCTGGTGTGAGG + Intergenic
1035087279 7:156271381-156271403 CTTGGGGACTCCCTGCCTTCTGG - Intergenic
1035250788 7:157595653-157595675 CCTCTGGGCTCCCTAACTTCCGG - Intronic
1035305074 7:157926900-157926922 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305088 7:157926960-157926982 CCCTGGGGCTTCCTGTGTTCAGG - Intronic
1035305102 7:157927020-157927042 CCCTGGGGCTTCCTGTCTTTGGG - Intronic
1035305117 7:157927080-157927102 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305132 7:157927140-157927162 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305147 7:157927200-157927222 CCCTGGGGCTTCCTGTCTTTGGG - Intronic
1035305175 7:157927319-157927341 CCCTGGGGCTTCCTGTCTTGGGG - Intronic
1035305190 7:157927379-157927401 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305203 7:157927438-157927460 CCCTGGGGCTTCCTGTCTTGGGG - Intronic
1035305218 7:157927498-157927520 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305232 7:157927557-157927579 CCCTGGGGCTTCCTGTCTTGGGG - Intronic
1035305247 7:157927617-157927639 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035418290 7:158707187-158707209 CTTTGGGGCTCTGTGGCTCCTGG - Intergenic
1035882768 8:3260297-3260319 CTGTGAGGCTCCCTGGCTTTGGG + Intronic
1036714281 8:11106358-11106380 CTCTGGAGCTCGCTGGCTTCTGG - Intronic
1036759035 8:11494288-11494310 CCTGTGGGCTCCCTGGGTTTGGG - Exonic
1037539569 8:19857998-19858020 CCTTGGGGCTCCGTGGTTGCTGG - Intergenic
1037625984 8:20607600-20607622 CCACTTGGCTCCCTGGCTTCAGG + Intergenic
1038055473 8:23853776-23853798 TCTAGGGGCTCTCTGGCTACGGG + Intronic
1038199463 8:25398613-25398635 TCTTGGTGCTCCGTGGCTTGAGG + Intronic
1039381907 8:37093317-37093339 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
1039984949 8:42439293-42439315 CCTGAGGCCTCCCTAGCTTCTGG + Intronic
1040471112 8:47736811-47736833 CCCTGGTGCTCGCTGGCTGCGGG + Intergenic
1040937551 8:52796899-52796921 CCTTGGTGCTCCCTGACCTCTGG + Intergenic
1042681313 8:71388206-71388228 CCTTGGGGATCACTGGTGTCTGG - Intergenic
1042795072 8:72652996-72653018 CCTTGGTGTTCCTTGGCTTTTGG + Intronic
1042863450 8:73335901-73335923 CCCTGGGGATCCCTGGGCTCTGG + Intergenic
1043388002 8:79767418-79767440 CCTAGGGGTTCCCTGGCCGCAGG + Intronic
1043926443 8:86042235-86042257 CCTTGGCGCTCCATGGCTCATGG - Intronic
1044688958 8:94857619-94857641 CCTTGCGTCTTCCTAGCTTCTGG + Intronic
1045231197 8:100309462-100309484 CCTTGGGTCTCCCCCGCTTTAGG + Intronic
1047248984 8:123167366-123167388 CCTTGGGGCCCCAGGGCTGCTGG - Intergenic
1047619796 8:126594781-126594803 CCTTGGTTCTTCCTAGCTTCTGG - Intergenic
1047941657 8:129832413-129832435 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1048153854 8:131922100-131922122 CCTTGGAGTTCCTTGGCTTGTGG + Intronic
1048269076 8:133013754-133013776 GCTTGGGCTTACCTGGCTTCCGG - Exonic
1048275581 8:133063248-133063270 GCTGGGGGCACCCTGGCATCTGG - Intronic
1048303350 8:133267087-133267109 GCCTGGGGCTGGCTGGCTTCGGG - Intronic
1048952359 8:139506886-139506908 CCTGGGAGCTCCCAGGATTCGGG - Intergenic
1049007628 8:139865688-139865710 TCTTGGGACCCCATGGCTTCAGG - Intronic
1049164465 8:141117654-141117676 CCTGGGGGCCCGCTGGCTTTGGG + Intronic
1049416017 8:142495611-142495633 CCTTGGTGTTCCTTGGCTTGTGG + Intronic
1049481355 8:142825185-142825207 CCTGGAGGATCCCTGGCTCCAGG - Intergenic
1049651300 8:143771198-143771220 CCTCGGGGCTCCCGAGCTGCGGG + Intergenic
1049771532 8:144384455-144384477 ACGTGGGTCTCCCTGGCATCTGG + Intronic
1051321962 9:15914612-15914634 CCACTTGGCTCCCTGGCTTCAGG + Intronic
1052361677 9:27567877-27567899 CCTTGCCTCTTCCTGGCTTCTGG - Intronic
1052542887 9:29833980-29834002 CCTCTGGGATCCCTGGCTTTTGG - Intergenic
1052668029 9:31519343-31519365 CCACTTGGCTCCCTGGCTTCAGG + Intergenic
1055351646 9:75394959-75394981 TCATGGGGCTCCCAGGCTGCTGG - Intergenic
1055380235 9:75698747-75698769 CCTTGGCTCTTCCTAGCTTCAGG + Intergenic
1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG + Intronic
1055882984 9:81024073-81024095 CCTGGGGGCTCTCTGGCCTTTGG + Intergenic
1057693728 9:97309392-97309414 CCTTGGTCCTCCCTGGATTCAGG + Exonic
1060007984 9:120017239-120017261 CCTTGCCTCTCCCTAGCTTCCGG + Intergenic
1060581122 9:124747698-124747720 CTTTGGGGATCTCTGGCTTGGGG - Intronic
1061284066 9:129612397-129612419 CCTTAGGGCAGCCTTGCTTCAGG + Exonic
1061798586 9:133102419-133102441 CCTTGGGGCTCAGAAGCTTCAGG - Intronic
1061862809 9:133476591-133476613 CCCGAGGGCTCCCAGGCTTCAGG + Intronic
1062008988 9:134257056-134257078 CCTCGGGGCTCCCTGGAGACAGG - Intergenic
1062187138 9:135224112-135224134 CCTATGGGCACCCTGGCTCCAGG + Intergenic
1062444531 9:136588088-136588110 CCTTGGGGGTCCTTGTCTTGGGG - Intergenic
1062454957 9:136631688-136631710 CCTCGGTGCTCCCTGGCCCCGGG - Intergenic
1062553093 9:137099369-137099391 CCTTGGGCCTCGGTGGCCTCTGG - Intronic
1062753913 9:138277328-138277350 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1203576432 Un_KI270745v1:12107-12129 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1203576829 Un_KI270745v1:15516-15538 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1203577231 Un_KI270745v1:18938-18960 CCTTGCGGCTCCATGGCTCAGGG - Intergenic
1187117669 X:16369880-16369902 CCTTGCGTCTTCCTAGCTTCTGG + Intergenic
1188647966 X:32592802-32592824 CCTTGGGGCTCTGTGGTTCCTGG + Intronic
1189475039 X:41345711-41345733 ACCTGGTGCTCCCTTGCTTCCGG + Intronic
1189996862 X:46647226-46647248 CCTTGTGGCTCCCGGGCTCAGGG + Intronic
1190058020 X:47193405-47193427 GCCTGGGTCTCCTTGGCTTCCGG + Intronic
1191269479 X:58444980-58445002 CCATGGGGGTCTCTGCCTTCTGG + Intergenic
1192503529 X:71667880-71667902 CCGTGGGGCTCCCGGGCTGGCGG - Intergenic
1192586976 X:72326832-72326854 TCCTGGGGTTCCCTGGCTTCAGG - Intergenic
1192676194 X:73199295-73199317 CCTTGGGACTTGCTGGTTTCTGG + Intergenic
1193213018 X:78829670-78829692 CCTTAGGGTTCCTTGGCTTGTGG - Intergenic
1193574393 X:83181707-83181729 CAATAGGGCTCCATGGCTTCAGG - Intergenic
1193886942 X:86994144-86994166 CTTTGAGACTCGCTGGCTTCAGG + Intergenic
1194123404 X:89987269-89987291 CCTTGGGGCTCCATGGTTGCTGG - Intergenic
1194419906 X:93660883-93660905 CCACTTGGCTCCCTGGCTTCAGG - Intergenic
1194975625 X:100393688-100393710 CCTTGGCGGTCTCTGCCTTCTGG - Intronic
1195525118 X:105879011-105879033 CCTTGTCTCTTCCTGGCTTCTGG + Intronic
1197350148 X:125372715-125372737 CCACTTGGCTCCCTGGCTTCAGG + Intergenic
1197581372 X:128288282-128288304 CTTTGAGACTTCCTGGCTTCAGG + Intergenic
1199374913 X:147097029-147097051 CATTTGGGGTCCCTGACTTCCGG - Intergenic
1199726095 X:150582717-150582739 CCTTGCCTCTCCCTAGCTTCTGG - Intronic
1200476290 Y:3644886-3644908 CCTTGGGGCTCCATGGTTGCTGG - Intergenic