ID: 901500989

View in Genome Browser
Species Human (GRCh38)
Location 1:9652447-9652469
Sequence CAACGCGGGAGGCCCGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901500989_901500995 -1 Left 901500989 1:9652447-9652469 CCAGTCCCGGGCCTCCCGCGTTG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 901500995 1:9652469-9652491 GCTCGCCGCGTTTGCTGCAGCGG 0: 1
1: 0
2: 1
3: 2
4: 35
901500989_901500999 28 Left 901500989 1:9652447-9652469 CCAGTCCCGGGCCTCCCGCGTTG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 901500999 1:9652498-9652520 CGAGATCAGCTCCGGATCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 46
901500989_901500998 20 Left 901500989 1:9652447-9652469 CCAGTCCCGGGCCTCCCGCGTTG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 901500998 1:9652490-9652512 GGCGCAGGCGAGATCAGCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 85
901500989_901500997 5 Left 901500989 1:9652447-9652469 CCAGTCCCGGGCCTCCCGCGTTG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 901500997 1:9652475-9652497 CGCGTTTGCTGCAGCGGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901500989 Original CRISPR CAACGCGGGAGGCCCGGGAC TGG (reversed) Intronic
900118995 1:1040708-1040730 CAACGCGGAGGGGCCGGGCCGGG + Exonic
901500989 1:9652447-9652469 CAACGCGGGAGGCCCGGGACTGG - Intronic
903145384 1:21368708-21368730 CAAGGTGGGAGGCCTGGGAATGG + Intergenic
903650159 1:24917154-24917176 GAAAGAGGGAGGCACGGGACGGG - Intronic
904039354 1:27575357-27575379 CAAGCCGGGAGGGGCGGGACTGG + Intronic
907442876 1:54489426-54489448 CAGCGCGGGAGCCCCCGGGCTGG + Intergenic
922286540 1:224175744-224175766 CAGCGCGAGAGGGCCGGGAGAGG + Intronic
922730600 1:227947166-227947188 CACCGCGGGACGCCCCGGCCGGG + Intronic
1064048727 10:12042534-12042556 CAACGCGGGAGCCCCCGGGCCGG - Intronic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1070167770 10:73911347-73911369 CCGCGGGGGACGCCCGGGACGGG - Exonic
1071857833 10:89644536-89644558 CAGCGTGCGGGGCCCGGGACTGG - Intronic
1074086157 10:110210087-110210109 CCACGCCGGAGCCCCGGCACGGG - Intronic
1075025336 10:118979790-118979812 CAAGGTGGGAGGCCCTGGCCAGG - Intergenic
1077115489 11:882831-882853 CAACCCAGGAGGCCCCGGCCCGG + Intronic
1077635905 11:3841094-3841116 GAACGTGGCAAGCCCGGGACTGG - Intergenic
1080258781 11:30323212-30323234 GAACGGGGGAGGCCCTGGAGAGG + Intronic
1080633811 11:34105798-34105820 CAACGCGGGAGGGCCGGGTATGG + Intronic
1083258067 11:61508768-61508790 CAACGGGGGAGGCCCGAGGGCGG + Intergenic
1083945106 11:65919186-65919208 CATCGCGGGAACCCCGGGAGGGG + Intergenic
1085174830 11:74476647-74476669 CTCTGTGGGAGGCCCGGGACTGG + Intergenic
1085312804 11:75526060-75526082 CCACGCGCGAGGCCCGGGAAGGG - Intergenic
1085385781 11:76157385-76157407 CAATGTGGGAGGCCTGGGAAGGG + Intergenic
1087505907 11:99020836-99020858 CAGCGCGGGCGGCCGGGGAGGGG + Intergenic
1088318395 11:108530530-108530552 CAGCAAGGGAGGCCGGGGACTGG + Intronic
1096396453 12:51270035-51270057 TAACGCGGGGGGCTCGGGGCGGG - Intronic
1102151087 12:110689350-110689372 AACTGCGGGAGGCCCAGGACAGG - Intronic
1104951830 12:132444546-132444568 CAACGCTGGAGGCCGGGGCTAGG + Intergenic
1113313399 13:109154324-109154346 AAACGTGGCAGGCCCGGGCCAGG - Intronic
1113788655 13:113016002-113016024 CAAGGCTGGAGGCCCAGGTCGGG - Intronic
1119898736 14:78242641-78242663 CAGCCAGGGAGGCCAGGGACAGG - Intronic
1122666640 14:103334548-103334570 CAACGCTGCTCGCCCGGGACTGG - Exonic
1122859018 14:104573965-104573987 CAAGGTGGCAGGCCCAGGACAGG + Intronic
1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG + Intronic
1202929178 14_KI270725v1_random:23562-23584 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1123423120 15:20147658-20147680 CACTGCGGGTGGCCTGGGACGGG - Intergenic
1123532345 15:21154197-21154219 CACTGCGGGTGGCCTGGGACGGG - Intergenic
1125508974 15:40282801-40282823 CCAGGCGGGAGGCCCGGGGAAGG - Intronic
1128498513 15:68211413-68211435 CAGTGGGGGAGGCCTGGGACTGG - Intronic
1131375422 15:91919105-91919127 CAATGCGGGTGACCCGGGGCAGG - Intronic
1134149690 16:11796572-11796594 CCGCCCGGGAGGACCGGGACCGG - Intronic
1136173557 16:28502742-28502764 GAACGCGGCAGGCATGGGACTGG - Intronic
1136861633 16:33707685-33707707 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1139653925 16:68376254-68376276 CCACGCAGCAGGCCCGGGCCAGG - Intronic
1141318952 16:82988648-82988670 CTACTCTGGAGGCCCGAGACAGG + Intronic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1142145031 16:88489347-88489369 CACCACGTGAGGCCCGGGATTGG - Intronic
1142194786 16:88734365-88734387 CAGCGCGGGAGGCGCGTGCCAGG + Exonic
1203123129 16_KI270728v1_random:1555869-1555891 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1142598273 17:1040049-1040071 CCACGCGTGAGGCCTGGAACGGG + Intronic
1143152905 17:4818229-4818251 CAAGGCTGGAGGCCGAGGACAGG + Intronic
1147614333 17:41819499-41819521 CAAGGCGGGAGGGCCAGGAAGGG - Intronic
1148086306 17:44995753-44995775 CAACCCGGGAGGCCGGGGCCAGG - Intergenic
1148341317 17:46875156-46875178 CAGCGCTGCAGGCCCGGGCCAGG - Exonic
1152236760 17:79142974-79142996 CGAAGAGGGAGGCCCAGGACAGG + Intronic
1152695231 17:81740890-81740912 CAGGGCGGGAGGCGCGGGGCAGG + Intergenic
1153202043 18:2656359-2656381 CAAGGCCGCAGGACCGGGACCGG - Intronic
1159040650 18:63320309-63320331 CGCCGCGGCAGGCCCGGGAGTGG + Intergenic
1160766851 19:812641-812663 CCACGCGGGCGGCCTGGGGCTGG - Exonic
1160827136 19:1085837-1085859 CAGCCCGGGAGGACGGGGACGGG + Exonic
1160908919 19:1465923-1465945 CAGCTCTGGAGACCCGGGACAGG + Exonic
1160969549 19:1761499-1761521 CCACGCAGGAGGCCAGGGTCAGG - Intronic
1160981793 19:1819631-1819653 CAAAGCAGGAGGCCCAGGGCTGG - Intronic
1161277190 19:3425114-3425136 CAAAGCGGCAGTCCCCGGACAGG + Exonic
1161284639 19:3463076-3463098 CCCCACGGGAGACCCGGGACAGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165493680 19:36140096-36140118 CGCTGCGGGAGGCCCGGGAGCGG + Exonic
1165741251 19:38206505-38206527 CAGCGGGGCAGGCCCGGGAGCGG - Exonic
1165809993 19:38606285-38606307 CTGGGCTGGAGGCCCGGGACTGG + Intronic
1166856712 19:45785965-45785987 CAAGGCGGGCGGCCCGGGTGTGG - Exonic
1166970306 19:46562718-46562740 CTACTCGGGAGGCCTGAGACAGG + Intronic
1166995093 19:46716368-46716390 CATGGGGGGAGGCCGGGGACCGG + Exonic
1166997189 19:46725239-46725261 CATCGCGGGAGGCCCACGGCAGG - Intronic
1168152402 19:54456082-54456104 CAGCGAGGGACGCCCGGGGCTGG + Exonic
926140791 2:10366723-10366745 CAATGCAGGAAGCCCGGGGCTGG - Intronic
926691009 2:15733404-15733426 CAAGGCAGGAGGCCCAGGAGAGG - Intronic
932349568 2:71021384-71021406 CAGAGCAGGAGGCCCCGGACAGG + Intergenic
932599508 2:73113548-73113570 CGGCGCGGGAGGCCCGAGAGCGG + Intronic
937974830 2:127576408-127576430 CAGCCGCGGAGGCCCGGGACAGG + Intronic
940005808 2:149008504-149008526 CACCGTGGGAGGACCGGGACTGG + Intronic
946431780 2:219630165-219630187 CGAGTCGGGAGGCCCGGGCCCGG - Exonic
948208012 2:236173108-236173130 CAAGCCGGGAGCCCCGGGGCGGG - Intergenic
948992342 2:241561464-241561486 CAGTGCGGGTGGCCCAGGACAGG + Intronic
948992376 2:241561566-241561588 CAGTGCGGGTGGCCCAGGACAGG + Intronic
948992410 2:241561668-241561690 CAGTGCGGGTGGCCCAGGACAGG + Intronic
1172284742 20:33732409-33732431 CGGCGCGCGGGGCCCGGGACGGG + Intronic
1172578744 20:36030300-36030322 CAAGGCTGGAGGGGCGGGACTGG + Intronic
1176591202 21:8652160-8652182 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180274048 22:10629271-10629293 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1181356183 22:22297638-22297660 CACTGCGGGTGGCCTGGGACCGG - Intergenic
1181574874 22:23787300-23787322 CCCCGCGGGAGCCCCGGGGCGGG + Intronic
1183106814 22:35620801-35620823 CAACTCAGGAGGCCAGAGACGGG - Intronic
1184648367 22:45908225-45908247 CTACCAGGGAGGCCCGGGGCTGG + Intergenic
953694583 3:45147341-45147363 CAACCTGGGAGGCTTGGGACAGG + Intergenic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
956406339 3:68932332-68932354 CCCCGCGGGAGCCCCGGGAGCGG + Exonic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968701218 4:2059118-2059140 CAGCGCGAGGGGCCCGGCACGGG - Intergenic
975556880 4:75673667-75673689 CAAGGCTGGAGCCTCGGGACCGG - Exonic
985995909 5:3596598-3596620 GAAAGCGGAAGGCCCGGGCCAGG + Intronic
989792227 5:45419692-45419714 CAAAGCGGGAGCCCCAGTACTGG - Intronic
997984602 5:138492340-138492362 CGGCGCGGGAGGCGCGGGACGGG + Intergenic
998205983 5:140157256-140157278 CAGGGAGGGAGGCCCGGGGCTGG - Intergenic
1002429347 5:179194105-179194127 CCCCGCGGGAGGCCAAGGACAGG + Intronic
1005661204 6:28001173-28001195 GAACGTGGGAGGCACGGGACGGG + Intergenic
1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG + Intergenic
1008520986 6:52362258-52362280 CGCCGCGGGAGGCGCGGAACGGG + Intronic
1019708630 7:2508285-2508307 CAAGGTGGGAGGCCAGGGCCAGG - Intergenic
1021450288 7:20778093-20778115 CAAGGTCAGAGGCCCGGGACTGG + Intergenic
1030541975 7:110842452-110842474 CAACTCGGAAGGCCTGGGGCTGG + Intronic
1034306684 7:150049208-150049230 GGACGCGGGAGGGCCGGGAGGGG - Intergenic
1034447613 7:151121582-151121604 CAAGGGAGGAGGCCGGGGACTGG - Intronic
1034756362 7:153624375-153624397 CAAGGTGGGAAGCCCAGGACTGG - Intergenic
1034800161 7:154051435-154051457 GGACGCGGGAGGGCCGGGAGGGG + Intronic
1034911564 7:155002660-155002682 GGGCGCGGGAGGCCCGGGCCCGG - Intronic
1035249512 7:157587905-157587927 CACCGCGGGAGCCCAGGCACGGG - Intronic
1035249522 7:157587934-157587956 CACCGCGGGAGCCCAGGCACGGG - Intronic
1035249532 7:157587963-157587985 CACCGCGGGAGCCCAGGCACGGG - Intronic
1035249542 7:157587992-157588014 CACCGCGGGAGCCCAGGCACGGG - Intronic
1045336080 8:101205470-101205492 CAGCGCGAGAGGGCCGGGAGAGG + Intronic
1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG + Intronic
1057192441 9:93095490-93095512 CAACGCGGCAGGGCCCGGAAGGG + Intergenic
1059383349 9:113945658-113945680 CAAAGCAGGAGACCCAGGACTGG - Intronic
1059740652 9:117146293-117146315 CATCGCGGCAGGCCCAGGAAAGG + Intronic
1061921991 9:133787560-133787582 CAGCCCTGGAGGCCAGGGACTGG + Intronic
1061961875 9:133992705-133992727 CGACGCGGGCGGCCCAGGCCCGG - Intergenic
1062493660 9:136821647-136821669 CGCGGCGGGAGGCCCGAGACGGG - Intronic
1203621227 Un_KI270749v1:130925-130947 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1188107625 X:26163303-26163325 CAAGGCAGGAGGCCCAGGACAGG - Intergenic
1188111016 X:26196532-26196554 CAAGGCAGGAGGCCCAGGACAGG - Intergenic
1188482866 X:30652920-30652942 AAACGCGGGAAGGCCGGGCCGGG + Intergenic
1196482734 X:116168582-116168604 CCACTCGGGAGGCCCTGGCCTGG + Intergenic
1196804742 X:119574396-119574418 CCCCACGGGAGGCCCGGGGCGGG - Intergenic
1197746322 X:129933844-129933866 AAACTCGGGAGGGCCAGGACCGG + Intergenic
1198750519 X:139932840-139932862 CAGCGCGGGAGGGGCGGGGCGGG + Intronic
1202584435 Y:26408782-26408804 CACTGCGGGTGGCCTGGGACGGG - Intergenic