ID: 901501662

View in Genome Browser
Species Human (GRCh38)
Location 1:9656135-9656157
Sequence CGGTGCCAGGAGTAGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901501655_901501662 -10 Left 901501655 1:9656122-9656144 CCGGAAGAGTGGGCGGTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 901501662 1:9656135-9656157 CGGTGCCAGGAGTAGGGTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 437
901501651_901501662 6 Left 901501651 1:9656106-9656128 CCACTTAGAGAAAATGCCGGAAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 901501662 1:9656135-9656157 CGGTGCCAGGAGTAGGGTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901501662 Original CRISPR CGGTGCCAGGAGTAGGGTGG GGG Intronic
900265085 1:1753298-1753320 AGGTCCCAGGAGGTGGGTGGGGG + Intronic
900542901 1:3212878-3212900 CTGTGCCAGGAGCAGGGAAGAGG - Intronic
900582461 1:3415776-3415798 CGGAGCCAGGAGGTGGGGGGCGG + Intronic
900862060 1:5240869-5240891 AGGAGCCAAGAGTGGGGTGGGGG + Intergenic
901501662 1:9656135-9656157 CGGTGCCAGGAGTAGGGTGGGGG + Intronic
902393408 1:16119152-16119174 GGGTGCCAGGAGTGGGGAGGGGG + Intergenic
902551268 1:17220976-17220998 TGGTGTGAGGGGTAGGGTGGGGG + Intronic
903211742 1:21822743-21822765 AGGTGCCAGGGGCTGGGTGGAGG + Exonic
903470421 1:23582990-23583012 TGGTACCAGGTGTGGGGTGGGGG + Intronic
903562498 1:24238367-24238389 GGGTGCCAGTTGTGGGGTGGCGG + Intergenic
903606582 1:24579175-24579197 AGGTGCATGGGGTAGGGTGGGGG + Intronic
904035861 1:27558198-27558220 CTGGGCCAGGAGTAGGGAGGTGG + Intronic
904406305 1:30290717-30290739 ATGTGGCAGGAGTAGGGTGTGGG - Intergenic
904443622 1:30550428-30550450 CGGTGCCGGGAGCAAGGTTGAGG - Intergenic
905061659 1:35145095-35145117 AGCTGCCAGGAGCAAGGTGGAGG + Intergenic
905222899 1:36461062-36461084 AGGTGCTAGGGGTATGGTGGGGG + Intronic
906033621 1:42738083-42738105 GGGCGCCAGGAGGAGTGTGGTGG - Intronic
906316024 1:44786846-44786868 CGAGGCCAGGAGGAGGGAGGAGG + Intronic
906510156 1:46406098-46406120 CAGTGCCCCGAGGAGGGTGGGGG + Intronic
906705870 1:47894985-47895007 CTGAGCCAGGACTGGGGTGGTGG - Intronic
908802021 1:67890063-67890085 GGGTGGCTGGAGTAGTGTGGAGG + Intergenic
908865497 1:68544520-68544542 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
913225528 1:116695127-116695149 CGGTTCCGAGTGTAGGGTGGTGG - Intronic
913243486 1:116851223-116851245 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
913406443 1:118497376-118497398 CGGGGCCTGTAGTGGGGTGGGGG + Intergenic
915126716 1:153670701-153670723 CGGGCCCAGGAGTGGGGAGGGGG - Intronic
915590698 1:156868570-156868592 CGGTGCCAGGTGGAGGGGCGGGG + Exonic
915935352 1:160087400-160087422 GGGTGCTGGGAGTAGGGTTGTGG + Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918429940 1:184449202-184449224 CGGGGCCTGTTGTAGGGTGGGGG - Intronic
920314239 1:205066249-205066271 GGGTGCCAGTTGTTGGGTGGAGG - Intronic
920696520 1:208185032-208185054 CAATGCCAGGAGTAGGGAGGGGG - Intronic
921604086 1:217136108-217136130 CAGTGCCAGTTGTTGGGTGGGGG - Intronic
922675104 1:227544853-227544875 TGGGGCCAGGACAAGGGTGGGGG - Intergenic
922794805 1:228334750-228334772 CGGGGCCAGGAGGCGGGCGGTGG + Intronic
923732912 1:236570424-236570446 AGTGGCCAGGAGCAGGGTGGTGG + Intronic
1065237317 10:23666570-23666592 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
1065480382 10:26187644-26187666 CGGTGCCTGTTGTGGGGTGGGGG - Intronic
1065802248 10:29363211-29363233 TGATACCAGGAGTAAGGTGGCGG + Intergenic
1066467988 10:35670316-35670338 CTGTGCCAGGAGCAAGGAGGAGG + Intergenic
1067358916 10:45558642-45558664 TGGTGCCAGGCGCACGGTGGTGG + Intronic
1068433362 10:56961039-56961061 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
1069604392 10:69730558-69730580 CTCCCCCAGGAGTAGGGTGGGGG - Intergenic
1070491069 10:76977075-76977097 TGGTGTCAGGAGTAGGGAGTAGG - Intronic
1072447880 10:95515357-95515379 TGATGTCTGGAGTAGGGTGGAGG + Intronic
1072447971 10:95515964-95515986 TGATGTCTGGAGTAGGGTGGAGG - Intronic
1072689018 10:97558238-97558260 TGATACCAGGAGTAAGGTGGCGG + Intronic
1074743164 10:116504684-116504706 AGGTGCCAGCAATAAGGTGGAGG - Intergenic
1074958861 10:118420422-118420444 CAGGGCCTGTAGTAGGGTGGGGG + Intergenic
1075091233 10:119445147-119445169 CGCAGCCAGGGCTAGGGTGGGGG + Intronic
1076139079 10:128065125-128065147 CGGAGCCAGGTGTAAGGAGGGGG + Intronic
1076202544 10:128569812-128569834 CGGTGCCAGGAGCATGTTGCAGG + Intergenic
1076381627 10:130027845-130027867 GGTTGCCAGGATTGGGGTGGTGG - Intergenic
1076874892 10:133211117-133211139 TGGTGTCAGGAGAGGGGTGGTGG + Intronic
1077132239 11:978879-978901 CTGCGCCCGGAGTTGGGTGGTGG + Intronic
1077284417 11:1759368-1759390 CAGTGGCTGGAGCAGGGTGGAGG + Intronic
1078371128 11:10746262-10746284 CGGGGGTGGGAGTAGGGTGGAGG + Intergenic
1078551963 11:12287376-12287398 CTGAGCCAGGGGTGGGGTGGAGG - Intronic
1078696522 11:13637766-13637788 AGTTGCCAAGAGTAGGGTGAGGG - Intergenic
1079102415 11:17549838-17549860 AGGTGACAGGAGTTGGGGGGTGG + Intronic
1081567933 11:44271059-44271081 AGGTGCCTGGCGTAGAGTGGTGG - Intronic
1081757808 11:45557059-45557081 AGGTGCCAGGCGTGGGATGGGGG + Intergenic
1081839930 11:46192626-46192648 TGTTGCCAGGAGTTGGGGGGAGG + Intergenic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1083227701 11:61295108-61295130 CGGCGCCAGGAGGAGGGGCGAGG - Exonic
1083333065 11:61908029-61908051 GGGTGCCTGCAGTAGGCTGGGGG - Intronic
1083544383 11:63537974-63537996 AGGTCCTAGGAGTGGGGTGGCGG + Intronic
1083820947 11:65171109-65171131 GGGTGCCAGGAGGAGGGTGAGGG + Intronic
1084005491 11:66321161-66321183 CGGTGACTGTTGTAGGGTGGGGG + Intergenic
1084748132 11:71186271-71186293 TGGTTCCAGGAGTAGGGGTGAGG - Intronic
1084852625 11:71955072-71955094 CAGGGCCAGGACTAGGGTGAGGG + Intronic
1085450636 11:76630054-76630076 TGCTGCCAGGAGGAGGGTGCTGG - Intergenic
1085512169 11:77093923-77093945 CTGTGCCAGGGATGGGGTGGGGG + Intronic
1085645593 11:78220298-78220320 AGGTGCCTGGAGTAGAGTTGGGG - Exonic
1089294810 11:117461197-117461219 CAGAGCCAGGAGCAAGGTGGGGG - Intronic
1089576195 11:119446063-119446085 GGTTGCCAGGAGTTGGGGGGAGG + Intergenic
1090169136 11:124582816-124582838 CCTTACCAGGAGGAGGGTGGGGG - Intergenic
1090527896 11:127557052-127557074 CGGGGCCTGTAGCAGGGTGGGGG + Intergenic
1090636162 11:128691886-128691908 AAGTGCTAGGAGGAGGGTGGGGG + Intronic
1090689953 11:129170333-129170355 CGGGGCCAGTTGTGGGGTGGAGG - Intronic
1091237638 11:134032742-134032764 CGGAGCCTGGAGGAGGATGGAGG - Intergenic
1091387738 12:105319-105341 CGCTGGCAGGGGCAGGGTGGGGG + Intronic
1091424051 12:370768-370790 CGGGGCCTGTCGTAGGGTGGGGG - Intronic
1092209716 12:6638446-6638468 AGGTGCCAGGAGTGGGGAGGAGG + Intronic
1092210098 12:6640281-6640303 GGGTGGCAGGGGTGGGGTGGTGG - Intronic
1092972636 12:13712217-13712239 CGGGGCCTGTTGTAGGGTGGGGG + Intronic
1093022842 12:14219271-14219293 CGGGGCCATGAGTAAGGTGGCGG - Intergenic
1093516292 12:19990575-19990597 CAGGGCCAGGATTAGGGTGCAGG + Intergenic
1093900862 12:24630551-24630573 CAGTCCCAGGAGATGGGTGGAGG - Intergenic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1095506554 12:42905000-42905022 CGGTGCCACGAAAGGGGTGGGGG - Intergenic
1095970175 12:47896448-47896470 CGGGGCTCGGAGTAGAGTGGGGG + Intronic
1096196089 12:49649662-49649684 CAGAGCCATGAGTTGGGTGGGGG + Intronic
1097124364 12:56762041-56762063 GGTTGCCAGGAGTGGGGTGTGGG + Intronic
1097223099 12:57461773-57461795 CGGGACCGGGAGTAGGGGGGCGG + Intronic
1097545830 12:61000511-61000533 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
1099109989 12:78546833-78546855 CGGAGCCTGTCGTAGGGTGGGGG + Intergenic
1102519895 12:113471672-113471694 GGCTGCCCGGAGTGGGGTGGTGG + Exonic
1103091951 12:118103929-118103951 CGCCGGCAGGAGTAGGCTGGCGG - Exonic
1104262538 12:127197629-127197651 GTGAGCAAGGAGTAGGGTGGTGG - Intergenic
1104715436 12:131013116-131013138 CAGGGCCAGGAGGAGGGTGAGGG - Intronic
1107119168 13:36778746-36778768 CTGTGCAGGGAGTGGGGTGGGGG - Intergenic
1108211720 13:48146066-48146088 CTGTGCTGGGAGCAGGGTGGAGG - Intergenic
1108349190 13:49575046-49575068 GGGTGCCAGGAGCTGGGGGGAGG + Intronic
1109390293 13:61683419-61683441 AGGTGCCAGAATTATGGTGGTGG + Intergenic
1112494791 13:99896109-99896131 CCGGGCCAGGAGGAGTGTGGCGG + Exonic
1113072059 13:106431567-106431589 CAGTGCCAGAAGTAGGGAGGTGG + Intergenic
1113649785 13:112027304-112027326 GGGTCCCAGGAGTCAGGTGGGGG + Intergenic
1113649838 13:112027454-112027476 GGGTCCCAGAAGTTGGGTGGGGG + Intergenic
1115221999 14:31067425-31067447 CGGGGCCTGTGGTAGGGTGGGGG - Intronic
1116376678 14:44211140-44211162 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
1117847279 14:59924532-59924554 TGGTGATTGGAGTAGGGTGGTGG - Intronic
1119441355 14:74630906-74630928 AGGGGCCAGGTGTAGGGAGGAGG + Intergenic
1120480030 14:85038026-85038048 CAGTGCAAGGAGGTGGGTGGGGG - Intergenic
1121030663 14:90656003-90656025 CGGTTCCAGGAGTGGGCAGGCGG - Intronic
1122267470 14:100553419-100553441 GGGGGCCAGGAGTATGGTGTTGG - Intronic
1122444447 14:101759164-101759186 CGGTGGCAGGAGTGTGGAGGAGG - Intergenic
1124621728 15:31277832-31277854 GGCTGCCAGGACTAGGGGGGAGG + Intergenic
1125685621 15:41561576-41561598 TGGTGCCAGGTGGAGGATGGGGG + Exonic
1127340092 15:58032343-58032365 CGGGGCCTGGTGTGGGGTGGGGG + Intronic
1129000035 15:72325278-72325300 AGGTGCCAGGAGGAGCATGGGGG - Intronic
1129075529 15:72992546-72992568 TGGGGCCAGGAGTGGGGTCGGGG - Intergenic
1129113197 15:73350268-73350290 CGGTGCCAGGAGGAGGGGCATGG - Intronic
1129156209 15:73719736-73719758 AGCTGCAAGGAGGAGGGTGGGGG - Intergenic
1129189462 15:73928904-73928926 CAGGGCCAGGACTAGGGTGAGGG - Intronic
1129257232 15:74340534-74340556 CCCTGCCAGGAGGAGGGAGGTGG - Intronic
1129572172 15:76699906-76699928 CGGTGCCAGTAGCAGCATGGTGG + Intronic
1129753756 15:78083548-78083570 CTGGGGCAGGGGTAGGGTGGTGG + Intronic
1130512429 15:84600834-84600856 CGGTCCCCGGAGTAGGGTTTGGG - Intergenic
1131832188 15:96361124-96361146 CGGAGCTAGGAGAAGGATGGGGG - Intergenic
1132016362 15:98320819-98320841 CCGTGCCAGGCGTGGGGAGGTGG + Intergenic
1132656605 16:1044238-1044260 GGGTCCCAGGAGGAGGGCGGGGG - Intergenic
1133052268 16:3124020-3124042 CGGTGTCAGGAGCACGGTGAGGG + Intergenic
1133332979 16:4987843-4987865 AGGTTCCAGGATGAGGGTGGCGG + Intronic
1134217579 16:12327898-12327920 CGGTGCCATGAGCAGGATGGTGG - Intronic
1135079433 16:19421656-19421678 CAGGGCCAGGACTAGGGTGAGGG - Intronic
1135857998 16:26029760-26029782 CAGTTCCAGGAGAAGGGTGCTGG + Intronic
1136244920 16:28969487-28969509 GGGTGACAGGGGTAGGGAGGTGG - Intergenic
1137293710 16:47070094-47070116 GGTGGCCAGGAGCAGGGTGGGGG - Intergenic
1138790852 16:59902472-59902494 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
1139081798 16:63530789-63530811 GGGGGCCAGGAGTAGGGAAGAGG - Intergenic
1139543502 16:67636638-67636660 TGGGGCAAGGAGAAGGGTGGTGG - Intronic
1139545837 16:67649178-67649200 GAGGCCCAGGAGTAGGGTGGGGG - Intronic
1139632585 16:68239562-68239584 GGGAGCGAGGAGTGGGGTGGGGG - Intergenic
1140478169 16:75249318-75249340 CTGGGGCAGAAGTAGGGTGGAGG - Intronic
1140716372 16:77728948-77728970 GGGTGCAGGGAGGAGGGTGGAGG - Intronic
1142344856 16:89547471-89547493 CGGCGCCAGGAGCAGGGGTGGGG - Intronic
1142470697 17:161778-161800 CAGTGCCAGGAGTAGCCAGGAGG + Intronic
1142486280 17:249495-249517 AGGTGGCAGGAGGGGGGTGGCGG - Intronic
1143029690 17:3961015-3961037 CGGTGCCAGGAGGAGCACGGTGG - Intronic
1143539028 17:7558646-7558668 TTGTGCCAGGAGCAGGATGGGGG - Exonic
1143639523 17:8188230-8188252 TGGTGCTGGGAGTGGGGTGGGGG - Intergenic
1144508643 17:15856266-15856288 AGGTGGCAGGAGGAAGGTGGGGG - Intergenic
1145172762 17:20673906-20673928 AGGTGGCAGGAGGAAGGTGGGGG - Intergenic
1146012910 17:29209897-29209919 CAGGGCCAGGACTAGGGTGAGGG - Intergenic
1146926789 17:36751032-36751054 CGGTGACAGGAGGAGGAAGGAGG + Intergenic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147659818 17:42111537-42111559 TGGGGCCAGGGGTAGGGAGGCGG + Intronic
1148233745 17:45953461-45953483 CTGTCCCAGGATCAGGGTGGAGG + Intronic
1148534882 17:48430535-48430557 GGGTGCCTGAAGTAGGGTGCAGG + Intergenic
1148624046 17:49055351-49055373 CACTGGCAGGAATAGGGTGGGGG - Exonic
1149064184 17:52460573-52460595 CGGGGCCTGGCGTGGGGTGGGGG + Intergenic
1149606963 17:57931920-57931942 GGGTGAGAGGAGCAGGGTGGGGG - Intronic
1149865624 17:60149704-60149726 AGGGACCAGGAGTAGGATGGGGG + Intergenic
1149939664 17:60850320-60850342 TGGTGCCAGGAGTTAGGGGGAGG - Intronic
1151814207 17:76463136-76463158 CGGTGCCCGGGATGGGGTGGGGG + Intronic
1154004449 18:10514990-10515012 CTGTGCAAGGTGTGGGGTGGAGG + Intergenic
1155257822 18:24014360-24014382 CGGACCCAGGAGTCGGGAGGAGG - Intronic
1157867362 18:51197771-51197793 CGGGGCCCGAAGGAGGGTGGGGG - Intronic
1160318374 18:77868475-77868497 AGGTCCCAGGATTAGGGTGAGGG - Intergenic
1160737072 19:667775-667797 CCCTGCCAGGATGAGGGTGGAGG - Intergenic
1161267758 19:3372695-3372717 GGGGCCCAGGAGTGGGGTGGGGG + Intronic
1162509587 19:11110061-11110083 GGGTGCCAGGAGTTGGGGAGGGG - Intronic
1163113224 19:15174108-15174130 CGGAGCCAGGACTAGGCCGGTGG + Exonic
1163718602 19:18886867-18886889 CAGTGCCTGGACTGGGGTGGGGG - Intronic
1163815997 19:19464889-19464911 CTGTTCCAGGAGCAGGGTCGGGG - Intronic
1163976433 19:20857468-20857490 CGGGGCCTGTTGTAGGGTGGGGG + Intronic
1165472045 19:36009509-36009531 CGGTTCCAGCAGTAGCGAGGTGG + Exonic
1166305288 19:41934062-41934084 GGGTGCCAGGAGAAGGGCAGAGG + Intergenic
1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG + Exonic
1166674182 19:44729533-44729555 GGTTGCCAGGGGTGGGGTGGGGG + Intergenic
1167284113 19:48589154-48589176 CGGTGGCTGGACTAGGGTGATGG + Intronic
1167729494 19:51243132-51243154 GGGAGCCAGGAGAAGGGAGGAGG - Intronic
1167755732 19:51412254-51412276 TGGTGCCCGGGGTGGGGTGGGGG + Intronic
1168640714 19:58029536-58029558 CAGTTCCAGGCGGAGGGTGGAGG + Intergenic
926023093 2:9514345-9514367 CGGTGCCTGTCGTGGGGTGGGGG + Intronic
929278988 2:40057567-40057589 CGGTGCCTGTTGTGGGGTGGGGG + Intergenic
929868679 2:45739677-45739699 GGCTGCCAGGAGTGGGGTGGGGG + Intronic
930651752 2:53970833-53970855 CGGAGCCCGGAGAGGGGTGGGGG - Exonic
931687336 2:64805780-64805802 CTGGGCCTGGAGTCGGGTGGGGG + Intergenic
931698436 2:64889580-64889602 TGGTACCGGGAGTAAGGTGGCGG + Intergenic
931929532 2:67114717-67114739 TGGTGCCAGGAATTGGGTGTTGG - Intergenic
932316308 2:70786250-70786272 GGGTGCAGGGAGTGGGGTGGGGG + Intronic
932657732 2:73624855-73624877 CTGTGCCTTGAGTCGGGTGGGGG + Intergenic
932664409 2:73685139-73685161 CTGTGCCTTGAGTCGGGTGGGGG + Intergenic
932673666 2:73759431-73759453 CGGTGGCAGGATAAGGGTAGGGG - Intergenic
933493116 2:83013918-83013940 GGTTGCCAGGAGTTGAGTGGTGG + Intergenic
934579621 2:95427723-95427745 AGGTGGGAGGAGTAGGGAGGAGG - Intergenic
934599824 2:95649002-95649024 AGGTGGGAGGAGTAGGGAGGAGG + Intergenic
934916668 2:98305787-98305809 CTGTGGCAGGAGGAGGCTGGAGG - Intronic
935834109 2:107031546-107031568 CGGGGCCTGTTGTAGGGTGGAGG - Intergenic
936450632 2:112631252-112631274 GGGTGCCTGGAGTTGGGAGGAGG - Intergenic
936533169 2:113291007-113291029 AGGTGGGAGGAGTAGGGAGGAGG + Intergenic
937050717 2:118886472-118886494 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
937277273 2:120693037-120693059 CGGTGCCAGGAAGAGGGTGTGGG - Intergenic
937645222 2:124259010-124259032 CGGGGCCTGTTGTAGGGTGGGGG - Intronic
940308003 2:152247127-152247149 CTGTGCAGGGGGTAGGGTGGGGG - Intergenic
940353813 2:152717835-152717857 GGCCGCCAGGGGTAGGGTGGAGG + Exonic
940981850 2:160012323-160012345 CGATGCCAGGAGGACAGTGGGGG - Intronic
940994113 2:160128642-160128664 TGGTGCCAGGCGGAGGGTTGAGG + Intronic
941589587 2:167403175-167403197 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
943329246 2:186539157-186539179 TAGTTCCAGGAGTAGGGAGGAGG + Intergenic
943384734 2:187187142-187187164 CGGGGCCTGTAGTGGGGTGGAGG + Intergenic
943775280 2:191758953-191758975 AGGTGCCAGGTGTAGAGTGTGGG + Intergenic
943874087 2:193039866-193039888 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
944315229 2:198277420-198277442 CTTTGCCAGGAGTAGAGTCGGGG + Intronic
944882871 2:204032237-204032259 GGCTGCCGGGAGTATGGTGGGGG - Intergenic
945347096 2:208731581-208731603 TGGTGGCAGGGGCAGGGTGGTGG + Intronic
946172103 2:217901795-217901817 CGGAGCCAGGAGAGGGGTGCAGG - Intronic
946347130 2:219119581-219119603 CTGGGCCAGGGGCAGGGTGGCGG - Intronic
946484142 2:220084768-220084790 GGTGGCCAGGAGTGGGGTGGTGG - Intergenic
947400801 2:229729785-229729807 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
947732172 2:232437350-232437372 AGGTGGCAGGAGATGGGTGGAGG + Intergenic
948558196 2:238832082-238832104 CGTTGCCAGGGGTTGGGAGGAGG - Intergenic
1169087145 20:2834448-2834470 GGGTGCCAGGATAGGGGTGGTGG - Intergenic
1170390559 20:15868394-15868416 TGATACCAGGAGTGGGGTGGTGG - Intronic
1170400942 20:15982663-15982685 TGATACCAGGAGTAAGGTGGCGG + Intronic
1171872071 20:30536464-30536486 CGGGGCCTGTTGTAGGGTGGAGG - Intergenic
1172761715 20:37328014-37328036 CGGAGCCAGGAGCAGGGCCGAGG + Intergenic
1172834804 20:37866283-37866305 CGCTGCCCGGGGTAGTGTGGTGG + Intronic
1173235312 20:41239756-41239778 CAGTGCCAGGTGAAGGGTGGAGG - Intronic
1173434112 20:43017130-43017152 TGGGGCAAGGAGTAGAGTGGTGG - Intronic
1173525750 20:43731309-43731331 AGGTGCCAGGAGGAGGCTGCAGG - Intergenic
1173992998 20:47317395-47317417 TGGGGGCAGGAGTGGGGTGGAGG - Intronic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1174510710 20:51050209-51050231 GGTTGCCAGGGGTTGGGTGGAGG + Intergenic
1174529672 20:51201049-51201071 GGGTGCCTGGAGTAAGGTGGGGG - Intergenic
1174705711 20:52653870-52653892 CAGTGCCTGGACTAGGGTGAGGG - Intergenic
1175235478 20:57507627-57507649 CGGTGCCAGCAGTTGTGTGGCGG + Intronic
1175517494 20:59578341-59578363 CAGAGCCCGGAGTGGGGTGGAGG + Intronic
1175665276 20:60853332-60853354 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
1176214048 20:63939930-63939952 AGGAGGCAGGAGGAGGGTGGTGG + Exonic
1176236310 20:64055379-64055401 GGGTGCCAGGTGTAGGGAGGGGG + Intronic
1176262374 20:64188796-64188818 CGGTGCCTGGACTAGTGAGGAGG - Intronic
1177774504 21:25553138-25553160 CGGTGCTAGGTTTAGGGTGTGGG - Intergenic
1180583791 22:16867583-16867605 CGGGGCCAGTTGTGGGGTGGGGG - Intergenic
1182566909 22:31206859-31206881 GGGTGGCAGGAGGAGGGTGGAGG - Exonic
1183397656 22:37581692-37581714 CGGTGCCAGGAGTCTGCAGGTGG + Intronic
1183467384 22:37986527-37986549 CTGTGCCAGGATGGGGGTGGGGG + Intronic
1184767104 22:46577575-46577597 CGGGGCCCGGACTGGGGTGGGGG + Intronic
1184986797 22:48141366-48141388 CCGTGCCTGGTGCAGGGTGGAGG - Intergenic
1185183550 22:49378554-49378576 CTGTGTCAGGTGTAGGGTGTGGG + Intergenic
1185323713 22:50215527-50215549 CTGTGCCAGGTGGAGGGTGTGGG + Intronic
949158068 3:850791-850813 TGATACCAGGAGTAAGGTGGTGG - Intergenic
950457052 3:13099107-13099129 CAGGTCCAGGAATAGGGTGGTGG + Intergenic
950669865 3:14519588-14519610 TGGGGCCAGGGGCAGGGTGGGGG - Intronic
950894647 3:16437781-16437803 CTGGGCCAGGATTAGGGTGAGGG - Intronic
953516511 3:43597600-43597622 CGGGGCCTGTTGTAGGGTGGGGG + Intronic
953667938 3:44939534-44939556 AGGAGCCAGGAGCAGGGAGGTGG - Intronic
954010249 3:47630156-47630178 CGGGGCCTGGGGCAGGGTGGGGG + Intronic
954784890 3:53085331-53085353 GGATGCCAGGAGCAGGGAGGTGG - Intronic
954800770 3:53185845-53185867 CGGGGCCTGGGGTAGGCTGGGGG - Intronic
956572654 3:70713572-70713594 TGGTACCAGGAGTAGGGTACTGG - Intergenic
956794348 3:72704455-72704477 CGGGGAGAGGAGTAGGGTTGTGG + Intergenic
956795732 3:72716970-72716992 GGGTGGGAGGAGCAGGGTGGGGG - Intergenic
957172222 3:76752276-76752298 CGGGGCCTGTAGTGGGGTGGGGG + Intronic
958107663 3:89098231-89098253 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
958942878 3:100334668-100334690 CGGGGCCAGGAGGAGGGGTGGGG + Intergenic
959772507 3:110116553-110116575 AGTTGCCAGGGGTTGGGTGGTGG - Intergenic
960226615 3:115176823-115176845 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
960228765 3:115199166-115199188 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
960490626 3:118313328-118313350 CATTGCCAGGGGTAGGGTTGGGG - Intergenic
960628323 3:119702973-119702995 CGGGGCAAGGAGGAGGGAGGAGG - Intergenic
961039624 3:123668493-123668515 GGTTGCCAGAGGTAGGGTGGGGG + Intronic
961674411 3:128555881-128555903 GGGTGCCCGGGGGAGGGTGGCGG - Intergenic
962022645 3:131516112-131516134 CGGGGCCTGTCGTAGGGTGGAGG + Intergenic
962122146 3:132573082-132573104 CGGGGCCAGTTGGAGGGTGGGGG - Intronic
962139548 3:132773881-132773903 CAATGGCAGCAGTAGGGTGGCGG + Intergenic
962683885 3:137827780-137827802 CGGGGCCAGTTGTGGGGTGGGGG - Intergenic
964373971 3:156031401-156031423 CAGTGGAAGGAGTGGGGTGGAGG + Intergenic
964918211 3:161861519-161861541 CGGGGGCAGGCGGAGGGTGGGGG + Intergenic
964932839 3:162047290-162047312 TGATACCAGGAGTAAGGTGGCGG + Intergenic
965143578 3:164869311-164869333 GGGTTTCAGGAGTAGGGTGTTGG + Intergenic
966880179 3:184345645-184345667 GGGGGCCAGGAAAAGGGTGGAGG - Intronic
967571372 3:191032693-191032715 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
967929622 3:194681346-194681368 CGGAGCCTGGAGGAGGGAGGTGG + Intergenic
968529979 4:1086592-1086614 GGGTGGCAGGAGAGGGGTGGGGG + Intronic
969153814 4:5192873-5192895 GGGTGCCAGGGGCTGGGTGGAGG - Intronic
969296343 4:6272307-6272329 AGGTGCCAGGTGTGTGGTGGGGG + Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969491883 4:7504096-7504118 GGGTGCCAGGGGTAGGGCAGGGG + Intronic
969608050 4:8212025-8212047 TGGGGGCAGGAGTGGGGTGGGGG + Intronic
969715606 4:8866826-8866848 AGGAGCCGGGAGTAGGGAGGAGG - Intronic
969723699 4:8907141-8907163 CGGGGCTAGGAGAAGGGTGCAGG - Intergenic
970579704 4:17464092-17464114 GGGAGACTGGAGTAGGGTGGGGG - Intronic
971560062 4:28067966-28067988 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
972275084 4:37549667-37549689 TGATACCAGGAGTAAGGTGGCGG - Intronic
973715854 4:53675204-53675226 CGGTGGCAGGAAGAAGGTGGTGG - Intronic
974947961 4:68551330-68551352 GGCAGCAAGGAGTAGGGTGGAGG + Intronic
975036771 4:69694254-69694276 CGGGGCCTGTTGTAGGGTGGAGG - Intergenic
975492731 4:75006295-75006317 CGGGGCCTGCCGTAGGGTGGGGG - Intronic
975996340 4:80320741-80320763 CGGGGCCTGAAGTGGGGTGGGGG - Intronic
976990169 4:91355890-91355912 TGATACCAGGAGTAAGGTGGTGG + Intronic
978136033 4:105261479-105261501 CTGTGCCAGGAGTAGGGTTAGGG - Intronic
979451996 4:120883570-120883592 CGGTGCCTGTTGTGGGGTGGGGG + Intronic
979557239 4:122062776-122062798 CGGTGCCATTGGGAGGGTGGTGG - Intergenic
979558252 4:122075545-122075567 GGGTGGCAGGAGGAGGGTGGAGG + Intergenic
982872929 4:160607127-160607149 CGGTCCCTGTAGTGGGGTGGGGG + Intergenic
984258947 4:177420725-177420747 GGTTGCCAGGAGTAGTATGGAGG - Intergenic
986153276 5:5147605-5147627 AGTTGCCAGGGATAGGGTGGTGG + Intronic
986321249 5:6633891-6633913 CCGGGCCGGGAGTAGGGTAGGGG - Intronic
986565045 5:9104722-9104744 GGGTGGAAGGAGCAGGGTGGTGG - Intronic
986889381 5:12282935-12282957 AGTTGCCAGGAGTAGAGAGGAGG - Intergenic
987032048 5:13985266-13985288 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
987914246 5:24190793-24190815 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
988172794 5:27681385-27681407 TGGGGCCTGGAGAAGGGTGGGGG + Intergenic
989418801 5:41211225-41211247 CGGGGCCTGTAGTGGGGTGGGGG + Intronic
989441971 5:41482933-41482955 CGTTGCCAGTGCTAGGGTGGAGG - Intronic
990107425 5:52281391-52281413 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
991436052 5:66597445-66597467 AAGAGGCAGGAGTAGGGTGGGGG + Intronic
993328187 5:86567361-86567383 TGATACCAGGAGTAAGGTGGTGG + Intergenic
994357096 5:98805251-98805273 CAGTGCCAAGAGTGGGGTGTTGG - Intergenic
994414194 5:99447582-99447604 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
996124516 5:119708573-119708595 CTGGGACATGAGTAGGGTGGAGG - Intergenic
997071100 5:130623014-130623036 CGGTGCCTGTTGTGGGGTGGGGG + Intergenic
997078095 5:130704916-130704938 CGGTGCCTGTTGTGGGGTGGGGG + Intergenic
997419701 5:133756272-133756294 GGGTGGCAGGAGTGAGGTGGAGG + Intergenic
997766518 5:136509904-136509926 GTGTGCCAGTAGCAGGGTGGTGG + Intergenic
998181413 5:139948077-139948099 GGCTGCCAGGGGTTGGGTGGGGG - Intronic
998926749 5:147135184-147135206 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
999498279 5:152121824-152121846 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
999504379 5:152179912-152179934 TGGTGTCTGGAGTATGGTGGTGG + Intergenic
1000354768 5:160383927-160383949 GGCTGCAAAGAGTAGGGTGGTGG + Intergenic
1001104798 5:168843982-168844004 AGGGGCCAGGGGTAGGGGGGCGG - Intronic
1002021141 5:176365326-176365348 CCCTGCCAGGTGCAGGGTGGAGG - Intergenic
1002061034 5:176626284-176626306 TGGTGGCAGGATTAGGGGGGCGG + Intronic
1002066378 5:176654111-176654133 AGGTGCCAGGAGGCAGGTGGAGG + Intronic
1002431068 5:179204173-179204195 GGGTGCCAGGAGTCGGGGGGAGG + Intronic
1002475346 5:179461982-179462004 CGGTGCCAGGCATGGGGTGGAGG - Intergenic
1002641144 5:180631135-180631157 AGGTGTCAGGAGTGGGGTGCAGG + Intronic
1002922043 6:1579836-1579858 CCTTGCAAGGAGTAGGGGGGAGG - Intergenic
1004781503 6:18913602-18913624 CGTTGCCAGGAGCAGGCTGCTGG + Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1005964818 6:30719940-30719962 GGGTTCCAGAAGTTGGGTGGTGG - Intergenic
1007335309 6:41151238-41151260 GGAGGCCAGGAGAAGGGTGGTGG - Intronic
1007765469 6:44157219-44157241 AGGTGCCAGGGGTAGGGTGCAGG - Intergenic
1008523069 6:52381037-52381059 CAGTGGGAGGAGGAGGGTGGGGG - Intronic
1009047239 6:58246876-58246898 CGGTGCTGGGGGTAGGGGGGCGG - Intergenic
1009734517 6:67659719-67659741 CGGTGCCTGTCGTGGGGTGGGGG - Intergenic
1009813527 6:68700809-68700831 CGGGGCCTGTCGTAGGGTGGGGG + Intronic
1009987133 6:70794555-70794577 CGGTGCCTGTCGTGGGGTGGTGG - Intronic
1010375448 6:75163500-75163522 CGGGGCCTGTAGTAGGGTAGGGG + Intronic
1013559131 6:111286945-111286967 TGATACCAGGAGTAAGGTGGCGG + Intergenic
1015080698 6:129222495-129222517 CGGGGCCTGTCGTAGGGTGGGGG - Intronic
1017231055 6:152074253-152074275 AGTTGCCAGGAATGGGGTGGAGG - Intronic
1017660895 6:156671392-156671414 CGGGGCCAGTCGTGGGGTGGGGG + Intergenic
1017999931 6:159570039-159570061 CGATACCAGGAGTGGGGAGGGGG - Intergenic
1019363489 7:618009-618031 GGGTCCCAGGCGGAGGGTGGGGG - Intronic
1019471439 7:1223649-1223671 CTGTGGCAGGAGGAAGGTGGAGG - Intergenic
1019709946 7:2513602-2513624 CGGGGTCATGACTAGGGTGGGGG + Intronic
1020247110 7:6438191-6438213 CGGGGCCTGTAGTTGGGTGGGGG + Intronic
1021131417 7:16916899-16916921 TGGTGCTAGGAGTTGGGCGGGGG + Intergenic
1021334774 7:19385914-19385936 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
1021789007 7:24181107-24181129 GAGTGCCAAGAGTTGGGTGGAGG + Intergenic
1022043407 7:26602428-26602450 CAGTGCCAGGCATAGGATGGGGG + Intergenic
1023773594 7:43583007-43583029 CGGGGCCAGAAGCAGGGTGCAGG + Intronic
1024043675 7:45573917-45573939 CGGGGTCAGGAGGAAGGTGGAGG - Intergenic
1024048571 7:45601833-45601855 TGGTGCCAGGAGAAGGGAAGGGG + Intronic
1024338283 7:48231556-48231578 CGGTGTGAGGAGTAGATTGGAGG + Intronic
1027225396 7:76240675-76240697 CTGGGACAGGAGTAGGGTGAGGG - Intronic
1028046911 7:86131399-86131421 AGTTGTCAGGAGTTGGGTGGTGG - Intergenic
1029089396 7:98036358-98036380 GGGTGCCAGGAGGTGGGGGGAGG - Intergenic
1029111185 7:98213745-98213767 CGGTGGCAGGGGCTGGGTGGGGG - Intergenic
1029607692 7:101609047-101609069 CGGAGCCAGGCTTGGGGTGGAGG + Intergenic
1029799094 7:102926979-102927001 CAATGCTGGGAGTAGGGTGGGGG + Intronic
1030033883 7:105392176-105392198 GGTTGCCAGGAGTTGGGGGGTGG + Intronic
1031194969 7:118601579-118601601 GGGTGCCAGGATAGGGGTGGGGG - Intergenic
1034360479 7:150492483-150492505 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
1034776494 7:153832044-153832066 AGGTGACAGGTGCAGGGTGGTGG + Intergenic
1035117159 7:156534163-156534185 CAGTGCCGGGAGTGGGATGGTGG - Intergenic
1035718620 8:1773383-1773405 CGGTGGCAGGAGGAGGTTGGGGG + Intronic
1035962069 8:4148356-4148378 CGGTGCCTGTTGTGGGGTGGGGG + Intronic
1036185631 8:6620447-6620469 CGGAGGCAGGGGTAGGGTGCAGG - Intronic
1036665408 8:10734117-10734139 AGGTGCCAGGGGTACCGTGGCGG - Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1037473818 8:19237341-19237363 CGGTGGGAGGAGTTGGGTGCAGG + Intergenic
1037504060 8:19513154-19513176 TGGAGCCTTGAGTAGGGTGGTGG - Intronic
1038477981 8:27882045-27882067 GGTTGCCAGGGGTAGGGAGGAGG - Intronic
1039605642 8:38878067-38878089 AGGAGCCAGGAGCAGGGAGGAGG + Intergenic
1039639080 8:39199774-39199796 CGGTGCCTGTTGTGGGGTGGGGG - Intronic
1040453579 8:47573576-47573598 AGGTGACAGGAGTAAGTTGGAGG + Intronic
1042585685 8:70335606-70335628 GGTTGCCAGGAGTAGGGAGCAGG - Intronic
1043163673 8:76876347-76876369 GGGTGCCAGGAATTGGGGGGAGG - Intergenic
1044298069 8:90551479-90551501 TCATGCCAGCAGTAGGGTGGTGG - Intergenic
1044718034 8:95119177-95119199 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
1045431138 8:102116096-102116118 CGGGGCCTGTCGTAGGGTGGGGG + Intronic
1046000914 8:108420202-108420224 ATTGGCCAGGAGTAGGGTGGAGG + Intronic
1046383239 8:113476814-113476836 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
1046520454 8:115318825-115318847 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
1047880145 8:129184070-129184092 CGGGGCCTGTTGTAGGGTGGGGG + Intergenic
1048144690 8:131829959-131829981 CTGTGCCAGGTGTTGGGTGATGG + Intergenic
1048466850 8:134672395-134672417 CGGGGCCTGTTGTAGGGTGGGGG + Intronic
1048489898 8:134883048-134883070 CTGTGTCAGGAGTAGGGATGTGG + Intergenic
1048859003 8:138709625-138709647 TGGGGCCTGTAGTAGGGTGGGGG + Intronic
1049720418 8:144112985-144113007 CAGTGCCAGGAATATGCTGGGGG - Intronic
1049973511 9:841539-841561 CGGTGGCTGGAGTCGGGGGGCGG + Intergenic
1050326929 9:4506936-4506958 AGGTTCCAAGAGTAGGCTGGCGG + Intronic
1052154813 9:25172581-25172603 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
1053264398 9:36700077-36700099 TGGTGGCAGGAGGAAGGTGGGGG + Intergenic
1053900737 9:42793094-42793116 CGGTGGCCGGAGGAGGGGGGAGG + Intergenic
1055074312 9:72197976-72197998 CAGGGCCAGGATTAGGGTGAGGG + Intronic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1056062780 9:82901079-82901101 CCTTGCCAGGAGTAGGGTTCTGG - Intergenic
1057053580 9:91944800-91944822 CGATCCCAGGACTGGGGTGGGGG + Intronic
1057397270 9:94691288-94691310 CAGAGGCAGGAGCAGGGTGGAGG - Intergenic
1057405633 9:94768240-94768262 GGCTGCCAGAAGTAGGTTGGAGG - Intronic
1057853712 9:98585479-98585501 CGGGGACTGGCGTAGGGTGGGGG + Intronic
1057856640 9:98605927-98605949 CGGGGCCTGTAGTGGGGTGGAGG - Intronic
1058563627 9:106257467-106257489 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
1058800484 9:108540406-108540428 GGGTGCTGGGGGTAGGGTGGTGG + Intergenic
1058860461 9:109113078-109113100 CGGGGCCAGGGGCAGGGCGGGGG + Intronic
1058880991 9:109285864-109285886 CGGGGGCAGGAGTAGAGTTGGGG - Intronic
1058897016 9:109409232-109409254 AGGTGCCTGGAGGAGAGTGGTGG + Intronic
1059409686 9:114124253-114124275 AGTAGCCAGGGGTAGGGTGGGGG - Intergenic
1059691217 9:116687517-116687539 GGGGGGCAGGACTAGGGTGGGGG + Intronic
1061408059 9:130403495-130403517 TGGTGACAGGAGAAGGGTTGGGG - Intronic
1061578113 9:131520356-131520378 TGGAGCCAGGAGTAGGGGTGTGG + Intronic
1062358592 9:136176907-136176929 CGGGGCCTGGAGTACGGGGGAGG - Intergenic
1062590319 9:137271761-137271783 CGGGGACAGGAGGAGGGTGGAGG - Intronic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1062605506 9:137346780-137346802 TGGTACCAGGAGTGGGGTGCTGG - Intronic
1186523844 X:10229547-10229569 CGGGGCCTGTAGTGGGGTGGGGG - Intronic
1186558555 X:10586515-10586537 TGATACCAGGAGTAAGGTGGCGG + Intronic
1188840481 X:35011086-35011108 ATTTGCCAGGAGTGGGGTGGTGG - Intergenic
1190007993 X:46758640-46758662 CGGCGCCAGGAGGAGCGCGGCGG + Intronic
1190892215 X:54580151-54580173 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
1190895432 X:54613810-54613832 AGGTGGCAGGGGCAGGGTGGGGG + Intergenic
1190904818 X:54716531-54716553 CGGGGCCTGTTGTAGGGTGGGGG - Intergenic
1191726673 X:64288856-64288878 CGGGGCCTGTTGTAGGGTGGGGG + Intronic
1192283875 X:69713051-69713073 CGGGGCCTGTTGTAGGGTGGGGG + Intronic
1193606741 X:83578436-83578458 CGGGGCCTGTAGTGGGGTGGGGG + Intergenic
1193682331 X:84538021-84538043 CGGGGCCTGTGGTAGGGTGGCGG + Intergenic
1193991563 X:88314327-88314349 CGGGGCCTGTTGTAGGGTGGTGG + Intergenic
1194823290 X:98531489-98531511 CAGTGCCAGGAGTAGGGGAGGGG - Intergenic
1195354330 X:104024216-104024238 CGGGGCCTGGTGTGGGGTGGGGG + Intergenic
1196683817 X:118494909-118494931 CTGCACCAGGAGTGGGGTGGGGG - Intergenic
1196683835 X:118494980-118495002 CTGCACCAGGAGTGGGGTGGGGG - Intergenic
1197120625 X:122886839-122886861 CGGGGCCTGTAGTGGGGTGGGGG + Intergenic
1197306058 X:124843480-124843502 TGGTGAAAGGAGTAGGGAGGGGG - Intronic
1198172703 X:134123157-134123179 CGGGGCCTGATGTAGGGTGGGGG + Intergenic
1198469681 X:136934700-136934722 AGTTGCCAGGAGCAAGGTGGCGG + Intergenic
1199767163 X:150949632-150949654 AGGTCCCAGGAGCAGGCTGGAGG - Intergenic
1199918758 X:152373780-152373802 CGGGGCCTGTTGTAGGGTGGGGG - Intronic
1200075616 X:153549188-153549210 GGGAGCCAGGTGTGGGGTGGTGG + Intronic
1200090295 X:153632850-153632872 AGGTGCCAGGAGAAGGGAGCAGG + Intergenic
1201072407 Y:10160225-10160247 CGGTGCCTGTTGTGGGGTGGGGG - Intergenic
1201246338 Y:12007540-12007562 CGGGGCCTGTAGTGGGGTGGGGG - Intergenic
1202161542 Y:21940434-21940456 AGGTCCCAGGAGCAGGGTTGCGG + Intergenic
1202229814 Y:22645939-22645961 AGGTCCCAGGAGCAGGGTTGCGG - Intergenic
1202313342 Y:23550226-23550248 AGGTCCCAGGAGCAGGGTTGCGG + Intergenic
1202557461 Y:26120369-26120391 AGGTCCCAGGAGCAGGGTTGCGG - Intergenic