ID: 901504954

View in Genome Browser
Species Human (GRCh38)
Location 1:9678958-9678980
Sequence ATGTGTAAGGCCCCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901504944_901504954 24 Left 901504944 1:9678911-9678933 CCACTGTATCATCGGCTCATTTC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 901504954 1:9678958-9678980 ATGTGTAAGGCCCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 79
901504950_901504954 -9 Left 901504950 1:9678944-9678966 CCATCCTTTGGGGCATGTGTAAG 0: 1
1: 0
2: 2
3: 9
4: 141
Right 901504954 1:9678958-9678980 ATGTGTAAGGCCCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901504954 Original CRISPR ATGTGTAAGGCCCCTTTTGT GGG Intronic
901504954 1:9678958-9678980 ATGTGTAAGGCCCCTTTTGTGGG + Intronic
902906805 1:19564228-19564250 TTTTTTAAGGCCCATTTTGTGGG + Intergenic
904273609 1:29366394-29366416 ATGTGTAAAGGCCCTGTGGTGGG + Intergenic
908395287 1:63719819-63719841 ATGTGTGAGCTCCCTTTTATAGG + Intergenic
909233862 1:73126964-73126986 ATGTCTAAGGCCACTTTATTGGG - Intergenic
910118967 1:83763007-83763029 ATTTGCAGGGCCCCTTTTCTAGG + Intergenic
918393341 1:184089368-184089390 ATGGCTAAGGCCCTATTTGTTGG + Intergenic
921387468 1:214585380-214585402 AAGTGTAAGGTCCTTTTTCTTGG + Intergenic
923951580 1:238961758-238961780 ATGTGTAAGTTCCTTTTTATTGG + Intergenic
924530328 1:244888442-244888464 ATGTGCAAAGTCCCTTTTGCAGG - Intergenic
1065911900 10:30314558-30314580 ATGTGGCAGAGCCCTTTTGTTGG - Intronic
1074859695 10:117501052-117501074 ATGTGTGTGGACCCTTTGGTTGG - Intergenic
1081739374 11:45427404-45427426 ATGTGTGAGACCCCATTTGGTGG - Intergenic
1081930198 11:46864608-46864630 AGCTGAAAGGCTCCTTTTGTAGG + Intronic
1082779013 11:57271651-57271673 CTGTCCCAGGCCCCTTTTGTTGG + Intergenic
1083146456 11:60763425-60763447 ATGTGGAAAGCTCCTTTTGGAGG - Intronic
1086285569 11:85245842-85245864 ATGCATAAGGCACATTTTGTTGG + Intronic
1090349385 11:126097787-126097809 AAGTGTCAGGCCCCTTTCCTGGG - Intergenic
1090935648 11:131339575-131339597 ATGTGACATGCCCTTTTTGTAGG + Intergenic
1092042459 12:5396527-5396549 CTGTGTATGTCCCCTTTTCTGGG - Intergenic
1094020114 12:25904936-25904958 CTGTCTAAGGCCACTGTTGTAGG - Intergenic
1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG + Intergenic
1097007099 12:55927454-55927476 ATTTATAAGGCCCCCTTTTTGGG - Intronic
1102672241 12:114630012-114630034 ATGAGTAAGACAACTTTTGTCGG + Intergenic
1105807464 13:23963527-23963549 ATGTGAAAATCCCCTTTTCTAGG - Intergenic
1113630908 13:111883128-111883150 ATGTGGCAGGCCCCTTTGGAGGG + Intergenic
1119959388 14:78837311-78837333 GTGTCTAAGGCCCTCTTTGTTGG + Intronic
1122730136 14:103790482-103790504 ATGTCTTGGGCCTCTTTTGTAGG - Intronic
1124015901 15:25875449-25875471 ACGTGTTAGGCCCCATTTGTGGG + Intergenic
1128577025 15:68783278-68783300 ATGTGAAAGGCCCCTTCTGGAGG + Intronic
1131209724 15:90484174-90484196 ATGTGTATGTCCCTTTTTGGGGG + Intronic
1131739408 15:95371218-95371240 ATGTGTAAGGCACCATTTATCGG + Intergenic
1132286207 15:100664694-100664716 ATGTGGAAGGCTCTTTATGTTGG - Intergenic
1133436146 16:5781717-5781739 ATTTGAAAGCCCCCTTTTCTAGG + Intergenic
1138820097 16:60249056-60249078 ATATGAAAGTCCCCTTTTGGAGG - Intergenic
1139108489 16:63858923-63858945 ATGTGAAAGGCCTATTTTGGGGG + Intergenic
1139380282 16:66526220-66526242 GTGTCTTAGGACCCTTTTGTGGG - Intronic
1140220184 16:73038136-73038158 GTGTACAAGGTCCCTTTTGTTGG - Intronic
1143663494 17:8342108-8342130 ATGTGAAATTCTCCTTTTGTAGG - Intronic
1148957126 17:51363091-51363113 CTTTCTAAGGCCCCTTTTGCAGG + Intergenic
1150612170 17:66742273-66742295 ATGTGTCAGACCCCCTGTGTGGG + Intronic
1155065709 18:22267322-22267344 ATGTGTTCTTCCCCTTTTGTGGG + Intergenic
1155739851 18:29275517-29275539 ATGTATAAGAGCTCTTTTGTTGG + Intergenic
1156071218 18:33212454-33212476 ATGTGTAAGTCACATTTAGTGGG - Intronic
1159928074 18:74286420-74286442 ATGTGGAAGGTCCATTTAGTAGG - Intronic
1160366112 18:78327465-78327487 AAGTATCATGCCCCTTTTGTTGG + Intergenic
1162534536 19:11254971-11254993 ATGTGCAAGGCCCTCTTTGGGGG - Intronic
1163836116 19:19575341-19575363 ATCTGTAAGGCCCAGATTGTAGG - Intronic
1168505706 19:56932998-56933020 AGGTGGAAGGCCTCTATTGTGGG + Intergenic
1168669566 19:58230289-58230311 ATGTGTTGTGCCCCTTTTGCAGG + Intronic
927296328 2:21457987-21458009 ATATGTGAGGCCCTTTTTCTGGG + Intergenic
928898927 2:36297080-36297102 ATGTGTCAGGTCCCTGTTGCAGG + Intergenic
935785023 2:106541060-106541082 ATGTGCAAGGGCCCTGTGGTGGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1171154501 20:22859765-22859787 ATGTGCAAGGGCCCTGTGGTGGG - Intergenic
1171371866 20:24667628-24667650 ATCAATAAGGCCCATTTTGTGGG + Intergenic
1178124913 21:29505936-29505958 ATGTGGAAAGCCCCTTATCTGGG + Intronic
1178204051 21:30442510-30442532 ATATGTAAGGCTCCTTTGATGGG - Intergenic
1182665900 22:31959712-31959734 GTGTGTAAGGCACCTTCTTTGGG + Intergenic
1184404288 22:44291494-44291516 ATGAGTCAGGCCCCTTGTGTTGG + Intronic
953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG + Intronic
955940172 3:64139798-64139820 ATGTGTAAAGGCCCTGTGGTAGG - Intronic
956304953 3:67813607-67813629 ATATTTAAGGCCCATTTAGTTGG + Intergenic
963079473 3:141377393-141377415 ATGTGTCGGGCTCCTTTTGATGG - Intronic
963917796 3:150875688-150875710 CTCTGTAAGGCCACTTTTGGAGG - Intronic
971571210 4:28213268-28213290 TTCTGTAAGTCCCCATTTGTAGG - Intergenic
977485760 4:97643883-97643905 GTTTGTAAGGCCCAGTTTGTAGG - Intronic
985628149 5:1000794-1000816 AGGTAGAAAGCCCCTTTTGTGGG + Intergenic
986917079 5:12633688-12633710 ATGTTTAAAGCCACTTTAGTTGG + Intergenic
992893847 5:81230360-81230382 ATATGTAAGGCTCATCTTGTTGG - Intergenic
995542601 5:113199322-113199344 AGGAGTAAGGCCCTCTTTGTGGG + Intronic
996210113 5:120798300-120798322 AGTTGTAAGGCCCCCTTTGCAGG + Intergenic
1002602976 5:180364643-180364665 ATGTGGAAGCCCCGTTTTATTGG - Intergenic
1004246327 6:13980152-13980174 ATGGGTTAGGTCCCCTTTGTTGG - Exonic
1004925871 6:20414627-20414649 ATTTGCAACACCCCTTTTGTTGG + Intronic
1016373981 6:143401881-143401903 ATGTGTAAGGCCCACGTGGTTGG - Intergenic
1017202630 6:151772571-151772593 ATGATTGAGGCCCCTTTTGAGGG + Intronic
1020514958 7:9106697-9106719 AGATGTAAGGCCCCTTTTCTAGG + Intergenic
1022676446 7:32504043-32504065 ATGTGTTAGGCTCCCTTTGGTGG + Intronic
1027438915 7:78197200-78197222 ATGTGGAAGGCCACATTTGTGGG + Intronic
1034459944 7:151192628-151192650 ATGTGCAAGGCCCCAGTGGTTGG + Intronic
1041629926 8:60075727-60075749 ATGTGCAAGGCTCTTTTTTTGGG - Intergenic
1042224450 8:66504601-66504623 ATTTTTAAGGCCCATTTTGGTGG + Intronic
1042639730 8:70920517-70920539 ATTTTTAAAGCCCTTTTTGTGGG + Intergenic
1048511424 8:135065827-135065849 TTGTGTAATGCTGCTTTTGTGGG + Intergenic
1051740789 9:20249866-20249888 ATGTGTAAGGCTTATTTTCTGGG - Intergenic
1188664199 X:32799007-32799029 ATTTTTAAGGCCTCTTATGTTGG - Intronic
1192313986 X:70037949-70037971 ATGTGTAGAGCCCCTACTGTGGG + Exonic