ID: 901505291

View in Genome Browser
Species Human (GRCh38)
Location 1:9681343-9681365
Sequence CTTGAGAGGGTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2842
Summary {0: 1, 1: 0, 2: 37, 3: 500, 4: 2304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901505291_901505300 12 Left 901505291 1:9681343-9681365 CCCTCCAGCCTCACCCTCTCAAG 0: 1
1: 0
2: 37
3: 500
4: 2304
Right 901505300 1:9681378-9681400 CAGGTATGCATCACCATGCCTGG 0: 29
1: 789
2: 8801
3: 26317
4: 73312
901505291_901505299 -7 Left 901505291 1:9681343-9681365 CCCTCCAGCCTCACCCTCTCAAG 0: 1
1: 0
2: 37
3: 500
4: 2304
Right 901505299 1:9681359-9681381 TCTCAAGCAGCTGGGACTACAGG 0: 86
1: 3841
2: 56074
3: 175019
4: 257179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901505291 Original CRISPR CTTGAGAGGGTGAGGCTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr