ID: 901505291 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:9681343-9681365 |
| Sequence | CTTGAGAGGGTGAGGCTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2842 | |||
| Summary | {0: 1, 1: 0, 2: 37, 3: 500, 4: 2304} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901505291_901505300 | 12 | Left | 901505291 | 1:9681343-9681365 | CCCTCCAGCCTCACCCTCTCAAG | 0: 1 1: 0 2: 37 3: 500 4: 2304 |
||
| Right | 901505300 | 1:9681378-9681400 | CAGGTATGCATCACCATGCCTGG | 0: 29 1: 789 2: 8801 3: 26317 4: 73312 |
||||
| 901505291_901505299 | -7 | Left | 901505291 | 1:9681343-9681365 | CCCTCCAGCCTCACCCTCTCAAG | 0: 1 1: 0 2: 37 3: 500 4: 2304 |
||
| Right | 901505299 | 1:9681359-9681381 | TCTCAAGCAGCTGGGACTACAGG | 0: 86 1: 3841 2: 56074 3: 175019 4: 257179 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901505291 | Original CRISPR | CTTGAGAGGGTGAGGCTGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||