ID: 901505856

View in Genome Browser
Species Human (GRCh38)
Location 1:9685250-9685272
Sequence TTCTATTAGAATAAACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901505856_901505859 -1 Left 901505856 1:9685250-9685272 CCCTCCTGTTTATTCTAATAGAA 0: 1
1: 0
2: 0
3: 25
4: 306
Right 901505859 1:9685272-9685294 ATTAAAAGCAAACATGTAACTGG 0: 1
1: 0
2: 3
3: 43
4: 441
901505856_901505860 26 Left 901505856 1:9685250-9685272 CCCTCCTGTTTATTCTAATAGAA 0: 1
1: 0
2: 0
3: 25
4: 306
Right 901505860 1:9685299-9685321 TTTGTTTGTTTGTTTGTTTTTGG 0: 461
1: 643
2: 1126
3: 2751
4: 23032

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901505856 Original CRISPR TTCTATTAGAATAAACAGGA GGG (reversed) Intronic
900837450 1:5016318-5016340 TTTTGTTAGAACAAACAGGGAGG + Intergenic
901344150 1:8524074-8524096 TTTTATTAAAAGAAGCAGGAAGG + Intronic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
902975293 1:20083968-20083990 TTCTTTTAAAATCAAGAGGAAGG + Intronic
906819337 1:48912859-48912881 GTCTATTAGAATAAACGTAAGGG + Intronic
906920825 1:50062664-50062686 TTGAAATAGAATACACAGGAGGG + Intronic
906973309 1:50542301-50542323 TTCCATTATAATTAACAAGAAGG + Intronic
909009423 1:70317657-70317679 TTAAATTATAATGAACAGGAAGG - Intronic
909180254 1:72415059-72415081 ATCTATTAGAATACAAAGTAAGG - Intergenic
909752630 1:79181980-79182002 TTCTTTTTGAATAAACAGTATGG + Intergenic
910282639 1:85518355-85518377 TTCTCTTAGACTGTACAGGAAGG - Intronic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910616867 1:89208026-89208048 TTTTGTTAGAATAAACAATATGG - Intergenic
910743405 1:90546853-90546875 TCCTATTAGAATAATTATGATGG - Intergenic
911540435 1:99151317-99151339 ATCGATTGCAATAAACAGGAAGG - Intergenic
911878892 1:103207999-103208021 TTCTGTTAGAATAAATAAGGAGG - Intergenic
912162921 1:107008031-107008053 ATCTATTGGAAAAAACAGTACGG + Intergenic
912173014 1:107123764-107123786 TGCATTTAGAATAAAGAGGATGG + Intergenic
913086997 1:115448353-115448375 TCTTATTAGAAGAAACAGCATGG + Intergenic
914207375 1:145544628-145544650 TTCTCTTAGACTGTACAGGAAGG + Intergenic
914261818 1:146005305-146005327 TTCTATTAAAACAAACAAGGGGG - Intergenic
914397886 1:147288356-147288378 AACTATTGGAATAAACATGAAGG + Intronic
916361961 1:163980249-163980271 TTCTGTTAGAATAACCAGAATGG - Intergenic
916884297 1:169052199-169052221 TTCTATTGGAATGAACAGGTTGG - Intergenic
917147723 1:171910845-171910867 TACTTTTGGAAAAAACAGGAGGG + Intronic
917203632 1:172545015-172545037 TTAGAGTAGAATAAACAAGATGG + Intronic
920008314 1:202849663-202849685 TACTTTTGAAATAAACAGGAAGG - Intergenic
921169948 1:212538316-212538338 AGCTATAAGAATAAACAAGACGG + Intergenic
921468036 1:215514917-215514939 TAGTATTGCAATAAACAGGAGGG - Intergenic
922115166 1:222606486-222606508 CTCTATTAGAAAAACCAGAAAGG - Intergenic
924660756 1:246014691-246014713 TCCTATTAAAATACCCAGGAAGG + Intronic
1062957645 10:1550928-1550950 TGCTTTTAAAATAAAAAGGACGG + Intronic
1064056772 10:12104477-12104499 TTATTTTGGAATAAAAAGGAAGG - Intronic
1065422892 10:25566537-25566559 TTCAATTAGAGAAAAAAGGAAGG + Intronic
1066316131 10:34248304-34248326 AGCTATTAAAATAAACAGCATGG + Intronic
1067900727 10:50238707-50238729 TTCTTTAGGAATAAATAGGATGG - Intronic
1068038050 10:51785731-51785753 CTGTATTTGAATAAACATGATGG + Intronic
1068155503 10:53192498-53192520 TTCTCTTAAAATAAAAAGCAAGG + Intergenic
1072589677 10:96817983-96818005 TTTTAATAGAATAACCAGAAAGG - Intergenic
1073318327 10:102598469-102598491 TGCCATTAGAACAAACAGGAAGG - Intronic
1073536413 10:104280661-104280683 TACTTCTAGAATAATCAGGAAGG + Intronic
1073956798 10:108882057-108882079 TTATATTATAATCAACAGGAGGG - Intergenic
1074789575 10:116873280-116873302 TTCTATTAGCAGCAGCAGGAAGG + Intronic
1076089728 10:127672484-127672506 TTCTATGAGAAAATACAAGAGGG + Intergenic
1078157334 11:8810353-8810375 TTCTATTAGCTTAAGGAGGAGGG - Intronic
1079950320 11:26793857-26793879 TTCTTTTAGAATAAAGGTGAAGG + Intergenic
1081138399 11:39468557-39468579 TTCTTTTATAATGATCAGGAAGG - Intergenic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1086291471 11:85315326-85315348 TTCTGCTAGGAAAAACAGGATGG - Intronic
1086801122 11:91176641-91176663 TTTTATTAGGAGTAACAGGATGG - Intergenic
1087609624 11:100418421-100418443 TTCTATTAGTAAAAAGAAGATGG + Intergenic
1088087286 11:105996510-105996532 TTCCTTTAGAAAAAACAGGGTGG + Intronic
1090014899 11:123077296-123077318 TTTTATAAGAATAAATAGGCTGG - Intronic
1090566229 11:127995034-127995056 TTATATTACAATAAAATGGAGGG - Intergenic
1092480982 12:8858757-8858779 GTGTATCAGAATAATCAGGAGGG - Intronic
1092926632 12:13278157-13278179 TTCTTATAATATAAACAGGAAGG - Intergenic
1092927044 12:13280639-13280661 TTCTTATAATATAAACAGGAAGG - Intergenic
1094245931 12:28293378-28293400 TCCTATTATAATTAACTGGATGG + Intronic
1095372796 12:41489478-41489500 TTGTATTAGAGTAATCATGAGGG + Intronic
1095588349 12:43874203-43874225 TTGCATTACAATAAATAGGAAGG + Intronic
1095667588 12:44820269-44820291 TGGCATCAGAATAAACAGGAGGG + Intronic
1095670911 12:44859239-44859261 TTGAATTAAAATCAACAGGAAGG + Intronic
1095841290 12:46696317-46696339 TTTTAGTATAATAAACATGAAGG + Intergenic
1097359389 12:58641726-58641748 TTCCATGAGGCTAAACAGGAAGG - Intronic
1098454929 12:70661384-70661406 ATTTATTATAATAAACAAGATGG + Intronic
1098957934 12:76706680-76706702 TGCTATAAGAGTATACAGGAGGG - Intergenic
1099703902 12:86125642-86125664 AATTATTACAATAAACAGGAGGG + Intronic
1099983162 12:89630361-89630383 TTCTATTAGACTTAATAGCATGG - Intronic
1100034961 12:90239154-90239176 TATTATTAGAAAAAAAAGGAGGG - Intergenic
1100668420 12:96781622-96781644 TACTATTAGAACACAAAGGAAGG + Intronic
1101256501 12:102982683-102982705 TTCTATTACCATGAAAAGGAAGG + Intergenic
1105824823 13:24112948-24112970 TTCTAGCAGACTCAACAGGAGGG + Intronic
1106285469 13:28314693-28314715 TACTGTTAGAACAAACAAGAAGG + Intronic
1106302362 13:28480517-28480539 TTCTATTAGAATAAAGTTGGAGG + Intronic
1106532789 13:30609592-30609614 AACTATTGAAATAAACAGGACGG - Intronic
1107294077 13:38891335-38891357 TTCTATTAAAATAACCAGAGTGG + Intergenic
1109041533 13:57344846-57344868 ATATATAAGAATAAACTGGAGGG - Intergenic
1109382540 13:61583521-61583543 TTATATTAGAAAAAAAAGAAAGG + Intergenic
1109776728 13:67050896-67050918 TTCAATTAAAATAGACAGTAGGG - Intronic
1111028617 13:82567706-82567728 TGCCATTAGAATAAAAATGATGG + Intergenic
1111131658 13:83984619-83984641 TTCTATTTAAACCAACAGGAAGG + Intergenic
1111158863 13:84366551-84366573 TTCTCTTAGAAGAAGCAGGCTGG - Intergenic
1111205817 13:85009850-85009872 TTTTTTTCTAATAAACAGGAAGG - Intergenic
1115084508 14:29497843-29497865 TTCAATTTGAATAAACAAAAAGG + Intergenic
1115788716 14:36855662-36855684 GTGTATCAGAATAACCAGGAGGG - Intronic
1118436195 14:65772859-65772881 TTCTTTTTGAAGAAGCAGGAGGG + Intergenic
1118581195 14:67300105-67300127 TTCCATATGTATAAACAGGACGG - Intronic
1120308386 14:82799566-82799588 TTCTTTTAAAATAAAAAAGAGGG - Intergenic
1121806430 14:96828935-96828957 TTCCATTAGAAGCCACAGGAGGG + Intronic
1123141012 14:106078702-106078724 TTCTATTGGAAGAAACATTAGGG + Intergenic
1123483726 15:20663892-20663914 TTTTATTATAATAGGCAGGATGG - Intergenic
1126030079 15:44488326-44488348 TTGTATTAGAGAAGACAGGAAGG + Intronic
1126445312 15:48736584-48736606 TTCTATTATGATAAATATGAAGG - Intronic
1127070701 15:55286058-55286080 TTCTCTTAGAAAAAAATGGATGG + Intronic
1128992229 15:72270704-72270726 TTCTGTTTTAATAAATAGGATGG - Intronic
1130164908 15:81444682-81444704 TTATAATAGAATAAAAAGGAAGG - Intergenic
1130689505 15:86068936-86068958 TCCTGATAGAATCAACAGGAAGG + Intergenic
1131206122 15:90449175-90449197 TTTTTTTAGAACAAACATGAGGG + Intronic
1138825481 16:60314201-60314223 TTAAATCAGAACAAACAGGATGG - Intergenic
1139032274 16:62899493-62899515 TTTTCTTAGAATATACAGAAAGG + Intergenic
1140040925 16:71407314-71407336 TTCTATTACAAGAATCAGCATGG - Intergenic
1140258964 16:73360861-73360883 TTCCATTAGAAAAAACAGTGAGG - Intergenic
1142833892 17:2570171-2570193 TTCTATTTAAATAAACAGTATGG - Intergenic
1144200305 17:12935088-12935110 TTCTATCAGAATAGGCAGGAGGG + Intronic
1149075034 17:52586147-52586169 CTCTATTATAATAAAGAGTAGGG + Intergenic
1149383466 17:56118064-56118086 TTATTTTACAATAAAAAGGAAGG - Intronic
1150661123 17:67080454-67080476 TTCTATTTAATTAAACAGGCAGG + Intronic
1150832067 17:68531568-68531590 TTCTAGCTGAATAAAAAGGAAGG - Exonic
1150963814 17:69944749-69944771 TTCTAGAAGAAGAAACAGGAAGG + Intergenic
1151381793 17:73730786-73730808 TTCTATGGGAATGCACAGGATGG - Intergenic
1152990085 18:355282-355304 TGCTATGGGAACAAACAGGAAGG + Intronic
1155685859 18:28549435-28549457 TTGTATTTCAATAAACAGTAAGG + Intergenic
1156016730 18:32555173-32555195 TTCTAGTCGAATGAACAGGAAGG + Intergenic
1156028886 18:32689826-32689848 TTCTATTGAACTAAAAAGGAAGG + Intronic
1156657359 18:39304877-39304899 TCCAAATAGAATAAAAAGGAAGG + Intergenic
1157628136 18:49068812-49068834 TTCCAGTAGAATAAAAAAGATGG - Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158439920 18:57466631-57466653 TCCTATTAGAATAAATAGTTTGG - Intronic
1158860846 18:61590965-61590987 TTCTATAAGAATCTACATGACGG + Intergenic
1159078558 18:63709182-63709204 TTCTATTTTCATAAACATGATGG + Intronic
1160282533 18:77505416-77505438 TTCTATTATTATAAATTGGAAGG - Intergenic
1160335890 18:78039040-78039062 ATCTATTATAATAATCAGAATGG - Intergenic
1163479475 19:17546509-17546531 TTATTTTAAAATAAACAGGCCGG - Intronic
1166439545 19:42800105-42800127 TTCAATAAGAAAAAACTGGATGG + Intronic
1166457583 19:42955646-42955668 TTCAATAAGAAAAAACTGGATGG + Intronic
1166474527 19:43110872-43110894 TTCAATAAGAAAAAACTGGATGG + Intronic
1168012306 19:53543117-53543139 TACCATTAGAAAAAAAAGGAGGG + Intronic
925556812 2:5140096-5140118 TTCTAAAATAATAAAGAGGAAGG - Intergenic
926555162 2:14349194-14349216 GTGTATTAGAATATCCAGGAGGG + Intergenic
927675706 2:25104467-25104489 TTCTATTAGTAAAAACAGTTTGG - Intronic
928878554 2:36070660-36070682 TACTATTACAATAAACATGGGGG - Intergenic
931256071 2:60574040-60574062 TTCTATTTACATACACAGGATGG + Intergenic
931325438 2:61217177-61217199 TTCTTTAAGAACAGACAGGAAGG + Intronic
931356837 2:61544611-61544633 TTATATTCGAATAAAAAGGAAGG - Intergenic
932290176 2:70570568-70570590 TTCTAATAGAATTAGAAGGAGGG - Intergenic
934166995 2:89302856-89302878 TTATAATAGAAAATACAGGAGGG + Intergenic
934200283 2:89879598-89879620 TTATAATAGAAAATACAGGAGGG - Intergenic
938679846 2:133678284-133678306 ATCTATTAGAATAATCTGGTGGG + Intergenic
938764725 2:134453148-134453170 TTATTTTTGAATCAACAGGAAGG - Exonic
938993555 2:136654164-136654186 TTCTTCTGGAAGAAACAGGATGG + Intergenic
939309411 2:140455020-140455042 TTATTTTAGAATAACCTGGATGG + Intronic
939729761 2:145768253-145768275 TGCTTTTAGAATAAAGAGGCTGG - Intergenic
939749356 2:146022462-146022484 TGCTAGTAGAATGAGCAGGAGGG + Intergenic
940544609 2:155067801-155067823 TTCTCTTAAAATATACAGGTTGG - Intergenic
940608791 2:155964013-155964035 TTCTATTATAAGAAAACGGAAGG - Intergenic
941571042 2:167171194-167171216 ATCTATTAAAATAAAGAGGGCGG - Intronic
941954983 2:171194888-171194910 TTATATTAGAAAAAAGAGGGAGG + Intronic
942529784 2:176897286-176897308 TGCTCTTAGAATAATCAGGCTGG + Intergenic
943527305 2:189032600-189032622 TTCTTTTAAAATAAACAGCTGGG - Exonic
944240644 2:197482129-197482151 TTCTATATGTGTAAACAGGAAGG - Intergenic
944590507 2:201212812-201212834 TGCTACTAGAATAAACATTATGG + Intronic
945441391 2:209884316-209884338 GTCTATAATAATAAAGAGGAAGG + Intronic
946092996 2:217247573-217247595 TTCACTTGGAATAAACAGGCAGG - Intergenic
946505215 2:220292830-220292852 TTGTAAAAGAATAAACTGGATGG - Intergenic
947299404 2:228672078-228672100 TTTGAATAGAATAAAAAGGAGGG - Intergenic
948065214 2:235073361-235073383 TTTTATTGCAATAAACAAGAGGG - Intergenic
1171244437 20:23600010-23600032 CTCTAGTAGCATAAACAGCAAGG + Intergenic
1172823621 20:37761094-37761116 TTCTGATGGAATAATCAGGAAGG + Intronic
1174631239 20:51959743-51959765 TTCTTTAAAAATGAACAGGAAGG - Intergenic
1174975757 20:55331925-55331947 TTTTAATAGAAGAAACAAGAAGG + Intergenic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1176753203 21:10706865-10706887 TGGTATTAAAAGAAACAGGATGG - Intergenic
1177536924 21:22440068-22440090 TTAAATTAAAATAAACAGGCTGG - Intergenic
1179059775 21:37968996-37969018 TTTTATTACAATCAACAGGAAGG - Intronic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1179552806 21:42154210-42154232 CTCTGTTGGAACAAACAGGATGG - Intergenic
949514552 3:4795213-4795235 TCCTATTAGAAGCAGCAGGAAGG + Intronic
951267327 3:20584281-20584303 TTCAAATAAAAAAAACAGGATGG + Intergenic
951303047 3:21022129-21022151 TACTCTTGGAATAAAAAGGAAGG + Intergenic
952125129 3:30290998-30291020 TTATTTTAAAATAAACAGGTTGG - Intergenic
952519912 3:34146210-34146232 TTGTGTTAGAAACAACAGGAGGG + Intergenic
953238539 3:41127313-41127335 AGCTATTAAAATAAACAGCAGGG + Intergenic
953299688 3:41760400-41760422 TTTTATTAGAATACTTAGGATGG - Intronic
955070487 3:55568687-55568709 CTCTGTGAGAATAAACAGGATGG - Intronic
956660165 3:71589535-71589557 TTCTTTCTGAATAAACATGAAGG + Intergenic
957172334 3:76754100-76754122 TTCTAATAGAAATAGCAGGAAGG + Intronic
957364739 3:79208304-79208326 TTTTACAAGAATAAAAAGGATGG - Intronic
958699426 3:97569065-97569087 TTCTATAAGAATAGATATGAAGG + Intronic
958933488 3:100232419-100232441 TTCTATTAAAAAAAGTAGGAGGG + Intergenic
959637120 3:108588095-108588117 CTTTCTTTGAATAAACAGGAAGG - Intronic
960226027 3:115169433-115169455 TTCTATTAGAAGCCACAGGCTGG - Intergenic
960384755 3:117009299-117009321 TTCTCTTAGAAGAAAAAGAAAGG - Intronic
960480751 3:118186139-118186161 TTTTATTAGAATCATCAGGAAGG + Intergenic
960530134 3:118755106-118755128 TACTGTTAGAATCAACAGTATGG + Intergenic
961861774 3:129922268-129922290 TTCTAATAGAATACAAAGTAGGG + Intergenic
962096869 3:132301606-132301628 TTCTGTTAGAAAAAAAAAGAAGG - Intergenic
964446731 3:156767028-156767050 TTCTTTTAGGTTAGACAGGAAGG + Intergenic
964653307 3:159036714-159036736 TTCTAGTAGAATACTCAAGAAGG + Intronic
965007792 3:163047545-163047567 GTCTATTAGAATAAAATGTAGGG + Intergenic
965984246 3:174732767-174732789 TTCTATTAACTTATACAGGATGG - Intronic
966003239 3:174976542-174976564 TTCTATTAAATTAAACTGTATGG - Intronic
966243422 3:177779771-177779793 TTCTGTTAGAAAAAGGAGGAAGG + Intergenic
966388862 3:179430389-179430411 TTCTATTATAAGAGAAAGGAAGG - Intronic
967050398 3:185778146-185778168 TTGTATTGGAATAAGCAGGTTGG - Intronic
967529269 3:190530389-190530411 TTCTATTATAATAATCAAGGTGG + Intronic
967535369 3:190595754-190595776 TTCTATTACTGTAAACAGGGCGG - Intronic
968256871 3:197282536-197282558 TTATAATAGAATAAAGAGAATGG - Intronic
970983636 4:22129959-22129981 TTTTATTAGAAAAAAGAAGAGGG - Intergenic
972019275 4:34288981-34289003 TTTCATTAGAAGAAAGAGGAAGG + Intergenic
972753437 4:42017245-42017267 ATCCATTAGAAAAAATAGGAAGG - Intronic
972943720 4:44227877-44227899 ATATATTAGAATAAATAGGACGG - Intronic
973145097 4:46815423-46815445 TTTTATTAGAATTAACAAGTAGG - Intronic
973686278 4:53373054-53373076 TTTTAATAAAATAAACATGACGG - Intergenic
973914233 4:55617357-55617379 TTCTGTGAGGATAAAAAGGAAGG - Intronic
974095137 4:57354943-57354965 TTATATTAGAGAAAACAGCATGG + Intergenic
975108074 4:70591856-70591878 TTTTACTACAACAAACAGGAGGG + Intergenic
975115768 4:70678968-70678990 TTTTATGAGGATGAACAGGAAGG - Intronic
976483713 4:85575262-85575284 TTTTATAAAAACAAACAGGAAGG + Intronic
976758685 4:88525012-88525034 TTTTTTTAAAAAAAACAGGATGG - Intronic
976968110 4:91070345-91070367 TTCAACTAAAATAAAGAGGATGG - Intronic
978505998 4:109456905-109456927 TTTTATTAGATTAAAAATGATGG - Intronic
978857494 4:113409837-113409859 TTCTAAATGAATAAACAGGTTGG - Intergenic
979149934 4:117298653-117298675 TTCTATCAGAATAAGCAGGTGGG - Intergenic
979571627 4:122233164-122233186 TTGTATTAGAATCAACTGAATGG - Intronic
979826975 4:125249722-125249744 TTCTATTAGAGTACACATGGTGG + Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
980678740 4:136126656-136126678 TTCTATGACACAAAACAGGAGGG + Intergenic
980772341 4:137392508-137392530 GTCTCATAGAATAAACAGTATGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981149971 4:141369162-141369184 TTCTACTAGAGTATACAGTAAGG + Intergenic
981571038 4:146150824-146150846 TTCTCTTAGATGAGACAGGAAGG + Intergenic
984118266 4:175709431-175709453 TGCTATTAAAATAAACAGGCTGG + Intronic
984187478 4:176563684-176563706 TCCTATTAGAATAATCATAAAGG - Intergenic
984545909 4:181102447-181102469 GACTAGTAGAATAAAGAGGAAGG + Intergenic
984588054 4:181585831-181585853 TCCTATTAATTTAAACAGGAGGG + Intergenic
985173842 4:187179747-187179769 TTCTAATATAATAAACAGACAGG + Intergenic
985799164 5:1992299-1992321 TGCTATTACAGTAAACAGGTGGG + Intergenic
985938770 5:3117117-3117139 TTCTTTTAGAATGAGCAGCAGGG + Intergenic
986598735 5:9450016-9450038 TTTTATGAGCATGAACAGGATGG - Intronic
986793882 5:11190572-11190594 TTCTAACAGAATAAAGAAGAAGG - Intronic
987542014 5:19268289-19268311 TTATATTGAAATCAACAGGAAGG + Intergenic
988048817 5:25996879-25996901 AATTATTAGAATTAACAGGAGGG + Intergenic
989171729 5:38477354-38477376 TTCTTCTAGAATAAATAAGATGG + Exonic
989173004 5:38492383-38492405 AGCTTTTAGAATAATCAGGATGG - Intronic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
990967260 5:61462691-61462713 TTCTATTACAATAATGATGATGG + Intronic
992720467 5:79555800-79555822 TTCTAGTAGATTAAAGAGAATGG - Intergenic
992987572 5:82249058-82249080 TTCTAATAGAATAAAATGCATGG - Intronic
993612357 5:90070989-90071011 TTCATTTTGAATAAACAGAAGGG + Intergenic
994684997 5:102939196-102939218 TTCTATTGGGAGAAATAGGAAGG - Intronic
995957166 5:117791345-117791367 TTCAACTAGAATCAACAGGAGGG + Intergenic
997035597 5:130187562-130187584 TAATATTAGGACAAACAGGATGG + Intergenic
998205970 5:140157196-140157218 TTCTCTTGGATAAAACAGGAAGG + Intergenic
998511347 5:142717032-142717054 TTGTATTAGAATCACCTGGAAGG - Intergenic
998557822 5:143142926-143142948 TTATATTAAAAAAAATAGGAAGG - Intronic
1000361877 5:160455136-160455158 TTCTATTTAAATAAACAAAAGGG - Intergenic
1000579103 5:163013094-163013116 TTCTATTAGAAAAAGCAACATGG - Intergenic
1001276167 5:170353357-170353379 ATCTATCAGATTAACCAGGAAGG + Intergenic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1002140840 5:177137781-177137803 TTCTATTAAAAAAAAAATGAAGG + Intronic
1003957525 6:11177869-11177891 TTGTCTTAGAATAAACATGGAGG - Intergenic
1003983276 6:11409973-11409995 ATCTATTAGAACACACAGGAAGG + Intergenic
1004476271 6:15975724-15975746 TTCTATTAGAACATACACTAAGG + Intergenic
1004704343 6:18109869-18109891 TTCTATCAGAAAATAAAGGAGGG + Intergenic
1009372747 6:62927989-62928011 ATCTTTTAGAATAAACAATATGG + Intergenic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1010776761 6:79895667-79895689 TTTTATTACCAAAAACAGGAGGG + Intergenic
1011096684 6:83673894-83673916 TATTAATATAATAAACAGGATGG + Intronic
1011709898 6:90042562-90042584 TACTGTGAGAATAAACATGAAGG + Intronic
1012120654 6:95362256-95362278 AGCTATTAGAATTAACAAGAGGG + Intergenic
1013027429 6:106290611-106290633 TATTATTACAATAAACTGGATGG - Intronic
1013442844 6:110189119-110189141 TACTAATAGAATAAATGGGAAGG - Intronic
1016517692 6:144913709-144913731 TTCTATTAGAAGCAACTGAAAGG - Intergenic
1016839773 6:148514495-148514517 TTCTTTTGGAATAACCAGGGTGG - Intronic
1017250029 6:152270508-152270530 TTCCATTAGAATAATCAGGCAGG - Intronic
1021257743 7:18414649-18414671 TTCTTATTGAATAAACAGGTTGG + Intronic
1021259167 7:18432317-18432339 ATCTATTAGAAGAAACAGACAGG - Intronic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1021910475 7:25381141-25381163 TTTTAATTGAATAAACAGAAAGG - Intergenic
1023244920 7:38191904-38191926 TTCTATTAAAAAAAAAAGCATGG + Intronic
1024519138 7:50287565-50287587 TACCAGTAGAATAAACAGCATGG - Intergenic
1027649922 7:80853676-80853698 TACAGTTAGAATAAATAGGATGG + Intronic
1028713138 7:93933903-93933925 TTCCATTAGGATAAACTAGAAGG + Intergenic
1028772839 7:94646880-94646902 TTCCAATAGTATAACCAGGAGGG + Intronic
1029340368 7:99938779-99938801 TATTATTATAATAATCAGGAAGG - Intergenic
1031341470 7:120607797-120607819 TGGTATTAGAATATGCAGGATGG + Intronic
1032988937 7:137369168-137369190 TACCATTAGTATAAACAGGACGG + Intergenic
1033646514 7:143308918-143308940 CCCTATTAGAGGAAACAGGATGG - Intergenic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1040505523 8:48044448-48044470 TTCTTTTGTAATAATCAGGAGGG - Intronic
1043191327 8:77226054-77226076 GTATATCAGAATTAACAGGAAGG + Intergenic
1043430586 8:80190706-80190728 TTCTTTCACAATAAACCGGAAGG - Intronic
1043920328 8:85975207-85975229 TTTTTTTTTAATAAACAGGAGGG - Intergenic
1044607536 8:94060249-94060271 TTCTATTAGTATAAAAAAGGGGG - Intergenic
1044981977 8:97725823-97725845 TTCTATTGTAATAAACTGGCAGG + Exonic
1046018250 8:108632101-108632123 TGCTATAAGAATGCACAGGAAGG + Intronic
1046567672 8:115921521-115921543 TTCTAATAGCAAAAACAGGTAGG + Intergenic
1046930758 8:119839571-119839593 TACTATGACAATAAACAAGATGG - Intronic
1047213044 8:122855024-122855046 TTCATTCAGAATAAACAGTAAGG + Intronic
1047329965 8:123878013-123878035 TTCTATTCTAATAAAATGGAGGG + Intronic
1047378828 8:124335115-124335137 TTCTAGTGGAATAAACATGAAGG + Intronic
1047661394 8:127040770-127040792 TGTTTTTAGAATTAACAGGAGGG - Intergenic
1047816605 8:128471116-128471138 TTCCATTAGCTTAAAGAGGAAGG - Intergenic
1049896654 9:116000-116022 TTCTAAAAGAATGAATAGGAGGG - Intergenic
1050591837 9:7168766-7168788 TTATATAAGAGTAAACAGGCCGG + Intergenic
1050820138 9:9868549-9868571 TTCTATGTGAATAAAAAGTAGGG + Intronic
1050958708 9:11698859-11698881 TTATATTATAATAAACAAGAAGG - Intergenic
1051083828 9:13323637-13323659 TTCTTTTATAATAAAAAAGATGG - Intergenic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1051769021 9:20556375-20556397 TTATATTAGAATAAAAAGTGGGG + Intronic
1051928319 9:22354909-22354931 GTCTATTAGTATAGACAAGAAGG + Intergenic
1055055504 9:72020292-72020314 TTCAAGTAGAAAAAACAGGTGGG - Intergenic
1055120284 9:72652219-72652241 TTCTAATAAATAAAACAGGAAGG + Intronic
1056167075 9:83949734-83949756 ATCTATTATAATAAACTTGATGG - Intronic
1056182480 9:84099045-84099067 TTCTATTCGAATTAACTGAAGGG + Intergenic
1056805880 9:89728620-89728642 TTTTATAAAATTAAACAGGAAGG + Intergenic
1057517416 9:95733878-95733900 TTCCTTTAGTATAAACAGAAAGG + Intergenic
1058961011 9:109993055-109993077 TTCTTTAAGAATTAAAAGGAGGG - Intronic
1059106091 9:111512847-111512869 TTCTAGTAAAATACACAGAATGG + Intergenic
1059135924 9:111806440-111806462 TTCTATTAGCAGAGACAGGGAGG - Intergenic
1061704476 9:132442252-132442274 TTCAATAAGAAAAAACAGGCTGG + Intronic
1187352263 X:18531126-18531148 TTCTGTTAGATGAAACAAGAAGG + Intronic
1187690998 X:21866316-21866338 TGCTATAAGACCAAACAGGAAGG + Intronic
1188009773 X:25043345-25043367 TGCTATGAAAATAAACAGCAGGG + Intergenic
1188567075 X:31538671-31538693 TTCTATTATAATGAAAAGCATGG + Intronic
1189626740 X:42905340-42905362 TTCAATTAGAATAAATAGAGTGG + Intergenic
1190467957 X:50746163-50746185 TTCTATTACTATAATCAAGATGG + Intronic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1192572384 X:72217150-72217172 TTCTGCCAGAATAAACAGGAAGG - Intronic
1193756781 X:85418630-85418652 TTCTGTTTGATTAAACAAGAGGG - Intergenic
1194524623 X:94964306-94964328 TTCTATTAGAATAATTAATAAGG - Intergenic
1194737620 X:97531325-97531347 TTCTATTAGAAAACAAAGAAAGG - Intronic
1195617599 X:106925285-106925307 TACTGTAAGAATAGACAGGAGGG + Intronic
1195898969 X:109777796-109777818 TTCTTTTAGAATAGAAAGGATGG + Intergenic
1196554251 X:117068808-117068830 TTCAATTACAATAAACACTATGG + Intergenic
1198220576 X:134597633-134597655 CTCTAGTAGAAAAAACTGGAAGG + Intronic
1199279477 X:145983207-145983229 TTTTTTTAGAATAAATTGGAAGG + Intergenic
1199332009 X:146573168-146573190 TTCTCTTAGAGTACAGAGGAAGG - Intergenic
1202266416 Y:23023301-23023323 TTCTTTTAAAATAAAAAGGTAGG - Intergenic
1202419409 Y:24657044-24657066 TTCTTTTAAAATAAAAAGGTAGG - Intergenic
1202451377 Y:25013040-25013062 TTCTTTTAAAATAAAAAGGTAGG + Intergenic