ID: 901506282

View in Genome Browser
Species Human (GRCh38)
Location 1:9687910-9687932
Sequence GCCCAGAGCACCCCCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 192}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901506282_901506286 -8 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506286 1:9687925-9687947 CTCTGGGCATCCGGGACCCCTGG 0: 1
1: 0
2: 1
3: 20
4: 266
901506282_901506296 15 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506296 1:9687948-9687970 CAAGGCTGCCGGGTGCTGGGAGG 0: 1
1: 0
2: 1
3: 34
4: 325
901506282_901506298 24 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506298 1:9687957-9687979 CGGGTGCTGGGAGGACGCAGAGG 0: 1
1: 0
2: 4
3: 40
4: 404
901506282_901506289 4 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506289 1:9687937-9687959 GGGACCCCTGGCAAGGCTGCCGG 0: 1
1: 0
2: 0
3: 38
4: 319
901506282_901506290 5 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506290 1:9687938-9687960 GGACCCCTGGCAAGGCTGCCGGG 0: 1
1: 0
2: 6
3: 28
4: 287
901506282_901506294 11 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506294 1:9687944-9687966 CTGGCAAGGCTGCCGGGTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 273
901506282_901506295 12 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506295 1:9687945-9687967 TGGCAAGGCTGCCGGGTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 255
901506282_901506287 -3 Left 901506282 1:9687910-9687932 CCTCCTTGGGGGGTGCTCTGGGC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 901506287 1:9687930-9687952 GGCATCCGGGACCCCTGGCAAGG 0: 1
1: 0
2: 3
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901506282 Original CRISPR GCCCAGAGCACCCCCCAAGG AGG (reversed) Intronic
900495419 1:2973911-2973933 GACCGGACCACCCTCCAAGGGGG - Intergenic
900639628 1:3682462-3682484 GCCCAGAGTGCCTCCCAGGGGGG - Intronic
901441083 1:9278908-9278930 GCCCAGAGCCCCTCCCCATGGGG + Intergenic
901506282 1:9687910-9687932 GCCCAGAGCACCCCCCAAGGAGG - Intronic
901801015 1:11708032-11708054 GGCCTGAGAACCCCCCAAGAGGG + Intronic
901929228 1:12586137-12586159 GCCCAGAGCTGCTCTCAAGGCGG + Intronic
904473635 1:30750938-30750960 GCACAAAGCACCCCCTAATGAGG - Intronic
905434759 1:37948752-37948774 GACCATGGAACCCCCCAAGGGGG - Intergenic
908272076 1:62431847-62431869 GCCCAGATCCCCCTTCAAGGAGG - Intergenic
910963540 1:92785483-92785505 GCCCCGAGCTCCCCCAGAGGTGG + Intronic
912635167 1:111285087-111285109 GCCCAGAGCATCCTTCAGGGTGG - Intergenic
914960568 1:152202925-152202947 ACCCAGATCACTCCCCAAAGTGG + Intergenic
915083981 1:153371982-153372004 CCCCAGTGCACCCCCAAAGCTGG + Intergenic
916619916 1:166486040-166486062 CCCCTGAGCACCCACCAACGAGG + Intergenic
919901336 1:202046281-202046303 GCCCACATCACACCCCAGGGGGG - Intergenic
920201357 1:204261657-204261679 GCCCAGAGAGCCAGCCAAGGTGG - Intronic
920646436 1:207807428-207807450 GAGCAGAGCACAGCCCAAGGGGG + Intergenic
921155029 1:212432837-212432859 GCCCAGAGCCTCCCCGAGGGCGG - Intergenic
921183199 1:212647239-212647261 GCCCAGACCCCCGCACAAGGGGG - Intergenic
923494553 1:234513036-234513058 GCCCAGAGCCCCCGCAAAGCCGG + Intergenic
924740657 1:246792759-246792781 GCTCCGTGCACCCCCCAGGGCGG - Intergenic
1065371059 10:24987026-24987048 GCTGGGAGCACCCCACAAGGTGG - Intronic
1067821140 10:49531851-49531873 GCCCAGAACACTGCCCAACGGGG + Intronic
1069778744 10:70941814-70941836 CCCCAAAGCAGCCCCCCAGGTGG - Intergenic
1070811469 10:79300294-79300316 GTTCTGAGCACTCCCCAAGGAGG - Intronic
1070947890 10:80408456-80408478 GCCCGGAGCTCCTCCCACGGGGG + Intronic
1071565259 10:86668337-86668359 GCACCCAGCACCCCCCAGGGGGG - Intergenic
1071949166 10:90683232-90683254 TCCCAGAGGACCTTCCAAGGAGG + Intergenic
1072176549 10:92929083-92929105 GCCCAGAGCCCACCCAAAGTAGG + Intronic
1072617490 10:97059407-97059429 GCCCAGGGCATCCCCTGAGGAGG - Intronic
1072718499 10:97766961-97766983 GCCCAGAGCTCCCCCCAGACTGG - Exonic
1075746930 10:124734590-124734612 TTCCAGAGGACCCACCAAGGTGG - Intronic
1077110488 11:860003-860025 GCCCAGAGCCCCTCCCCAGCAGG - Intronic
1077164602 11:1129423-1129445 GCCGAGAGCACCACCCGGGGTGG + Intergenic
1077231997 11:1461909-1461931 GCCCCGAGCCCCCCCAGAGGTGG - Intronic
1077242482 11:1517834-1517856 GGCCAGAGCACCCTGGAAGGGGG + Intergenic
1077378407 11:2216195-2216217 GCCCAGTGCATCCCGCAGGGAGG - Intergenic
1077506355 11:2931589-2931611 ACCCAGAGAACTCCCCAAAGTGG + Intergenic
1077907485 11:6545593-6545615 GCCCAGAGGGCTTCCCAAGGTGG + Exonic
1078895616 11:15594592-15594614 GCTGAGAGCAACCCCCAGGGAGG + Intergenic
1080789708 11:35511478-35511500 GCCAAGACCACCCCAGAAGGTGG + Intronic
1081529983 11:43951617-43951639 CCCCAAAGCAACCCCCAAAGAGG + Intergenic
1081835208 11:46147807-46147829 GCCAAGACCACCCCCAAAGCTGG - Intergenic
1084573724 11:69975531-69975553 GCCCAAATCACCCCTGAAGGGGG - Intergenic
1089593257 11:119558684-119558706 ACCCAGGGCAACCCCCAAGTTGG + Intergenic
1089861182 11:121591208-121591230 GCCCAGAGCACACCCCCAGAAGG - Intronic
1091097589 11:132838863-132838885 GCACTGAGCACCCCCGAAGATGG + Intronic
1103048398 12:117758491-117758513 AACCACAGCATCCCCCAAGGTGG + Intronic
1103281787 12:119764119-119764141 CCCCCGACCACCCACCAAGGTGG + Intronic
1103447030 12:121001224-121001246 GCCCTCATCACCCCCCAAGCAGG - Exonic
1103555165 12:121761840-121761862 TCACAGAGCAACCCCCAAGGAGG - Intronic
1103559746 12:121787297-121787319 ACCCAGCGCACCTCCCAGGGTGG - Intronic
1103700207 12:122845329-122845351 GCTCAGAGCGCCACACAAGGAGG - Intronic
1103975700 12:124701240-124701262 GCACAGAGAGGCCCCCAAGGAGG - Intergenic
1104058737 12:125250162-125250184 GCCCAGATCCCCCCACAATGTGG - Intronic
1104295609 12:127509372-127509394 GCTCAGAACACCCCCCAAGTGGG + Intergenic
1105628282 13:22135289-22135311 GCCCAGAGCAGCCTCCACAGAGG - Intergenic
1114519724 14:23325588-23325610 CCCTTGAGCAGCCCCCAAGGGGG - Exonic
1118734462 14:68691599-68691621 GCCCACAGCACCCCAGGAGGGGG - Intronic
1119853703 14:77884009-77884031 GCCAAGAGCACCCCACAGGGAGG - Intronic
1121025571 14:90613725-90613747 GCCAGGAGCACTTCCCAAGGAGG + Intronic
1122275958 14:100590925-100590947 GCTCACAGCACCACCCCAGGAGG - Intergenic
1122319557 14:100845594-100845616 GCCCGGAGCACACCGCCAGGCGG + Intergenic
1123018877 14:105388330-105388352 GTCCAGAGCACACTCCCAGGAGG - Intronic
1125606523 15:40942423-40942445 TCCCAGAGCACCCGGCAATGAGG - Intergenic
1128244060 15:66120844-66120866 GCCCAGACCACCCCCCATTGCGG - Intronic
1129329954 15:74821939-74821961 TCCCAGAGCACCAGCCAAGCTGG - Intronic
1130114593 15:80995871-80995893 TACCAGAGCACCCTCCATGGAGG - Intergenic
1132345199 15:101103857-101103879 GCCCAGAACACTCTCCCAGGCGG + Intergenic
1132554382 16:566171-566193 GCCCACATCGCCCCCCCAGGAGG + Intergenic
1132952119 16:2568965-2568987 GCCCAGAGCACAGCCCAGGGAGG - Intronic
1132962231 16:2631205-2631227 GCCCAGAGCACAGCCCAGGGAGG + Intergenic
1133130387 16:3673035-3673057 CCCCAGCCCACCCCCTAAGGAGG + Intronic
1133188507 16:4116553-4116575 GCCCAGCGCGCGCACCAAGGCGG - Intergenic
1134207914 16:12252757-12252779 GCCCAGAGCCCCTCCAATGGCGG - Intronic
1134608065 16:15586830-15586852 GCCCAGGGCACCCCACGTGGGGG - Exonic
1138647139 16:58433963-58433985 CCCCACAGCACATCCCAAGGGGG - Intergenic
1139421781 16:66853582-66853604 GTCCCCAGCACCCCCCAGGGAGG - Exonic
1139574383 16:67831974-67831996 GCCCATAGCACAATCCAAGGTGG + Intronic
1140456124 16:75106578-75106600 GCCCGGAGCACCCCCAAACGCGG - Intronic
1142198181 16:88748445-88748467 GCCCAGCTCAGACCCCAAGGTGG + Intronic
1142354322 16:89595167-89595189 GCCCAGAGTGCCCGCCACGGAGG + Intronic
1143729150 17:8870577-8870599 TCCCAGAGCAGCTCCCACGGTGG - Intergenic
1143919213 17:10317597-10317619 GCTCAGAGCACCCTGCAAGGAGG + Intronic
1144406531 17:14957664-14957686 TCCCAGAGGACGTCCCAAGGGGG + Intergenic
1144788779 17:17846164-17846186 GCCCAGACCACCAGCCAAGCAGG - Intronic
1145746563 17:27324537-27324559 ACCCACACCACCCCCCAAGTGGG + Intergenic
1148158513 17:45436930-45436952 ACCCCGGGCACCCACCAAGGTGG + Exonic
1148670903 17:49409280-49409302 GCCCAGAGCACCACCCTGGGAGG - Intronic
1149473601 17:56940218-56940240 GCCCCCACCACCCCCAAAGGTGG + Intronic
1149551084 17:57540391-57540413 GCCCACAACACCCTTCAAGGTGG - Intronic
1150389930 17:64784329-64784351 ACCCCGGGCACCCACCAAGGTGG + Intergenic
1151480688 17:74368662-74368684 GACCAGAGCAGCCCACAAGCAGG - Intronic
1152147166 17:78575274-78575296 TCCCGGGGCACCCCCCATGGCGG - Intronic
1152244108 17:79176375-79176397 GCCCCCAGCACCCCCCAAGCAGG + Intronic
1152525716 17:80887288-80887310 AGCCAGCGCACCCCCCGAGGTGG - Intronic
1153905773 18:9659890-9659912 GCCCAGAGCCCCAGCCCAGGAGG + Intergenic
1157773799 18:50374725-50374747 GCCTAGAGTACACCCCAAGTCGG - Intergenic
1160246802 18:77165803-77165825 GCCCTCAGCATCCCCCCAGGTGG + Intergenic
1160444335 18:78915378-78915400 GCCAAGAGCAGCCGCCCAGGAGG - Intergenic
1160521362 18:79510122-79510144 ACTCATAGCCCCCCCCAAGGAGG + Intronic
1161208701 19:3055572-3055594 GCCCAGCACACCACCCAAGATGG + Intronic
1161800656 19:6415419-6415441 GCCCGGAGCACCCCCACAGCAGG - Exonic
1161968269 19:7561118-7561140 GCCCAGGGGACCCCCCAAGAGGG + Intronic
1163447883 19:17358147-17358169 GCCCTGAGCAGCCCACAGGGAGG - Intronic
1166524781 19:43504210-43504232 GCGGAGACCCCCCCCCAAGGAGG + Intronic
1167597461 19:50435192-50435214 CCCCAAAGGAGCCCCCAAGGAGG + Exonic
925427642 2:3763532-3763554 TGCAAGAGCACCCGCCAAGGTGG + Intronic
927173717 2:20391028-20391050 GCACAGAGCAACCCCCATGGGGG - Intergenic
932574069 2:72953208-72953230 GCCCACAGGACCCCCCAGGAGGG - Intronic
932669904 2:73728429-73728451 GCCCAGTGCACCTCCGAAGAAGG + Intergenic
933704302 2:85278235-85278257 GCCAAGTGCTCGCCCCAAGGAGG + Intronic
933949244 2:87314050-87314072 GCCCAGAGCAGCCTCCCACGGGG - Intergenic
936330953 2:111547547-111547569 GCCCAGAGCAGCCTCCCACGGGG + Intergenic
940766020 2:157790338-157790360 GCCCAGTGCTCCTCCCAAGATGG + Intronic
945661953 2:212697420-212697442 GCCCAGACAACTCCCCAAGTTGG - Intergenic
946194326 2:218024139-218024161 GCCCAGGGCACCCCACTAAGAGG + Intergenic
946333244 2:219022085-219022107 CCCCAGGGAACCTCCCAAGGTGG - Intronic
946384412 2:219373854-219373876 GCCCAGAGCAGCTCTGAAGGTGG + Exonic
946417965 2:219550074-219550096 ACCCTGAGCACACCCCAATGGGG - Exonic
947587373 2:231364891-231364913 GCCTGAAGCAGCCCCCAAGGTGG - Intronic
948261600 2:236607952-236607974 GCCCAGCACACCCCCCTGGGAGG - Intergenic
948602043 2:239112758-239112780 GCGCAGAGCTCCCAGCAAGGAGG - Intronic
948807373 2:240458887-240458909 ACCCAGGGCACCCCCCAGGCTGG + Intronic
948894235 2:240920921-240920943 GCCCTGAGTACCCCACAAGGTGG - Intronic
949048899 2:241886501-241886523 CCCCACCGCACTCCCCAAGGAGG - Intergenic
1169872845 20:10265757-10265779 GCACAGAGTCACCCCCAAGGTGG + Intronic
1170440805 20:16377187-16377209 ACCCACAGCACCTCCTAAGGGGG - Intronic
1173465941 20:43281508-43281530 CCCCAGCTCACCCCTCAAGGAGG + Intergenic
1175799976 20:61796075-61796097 GCCCAGACCACCATCCAGGGAGG + Intronic
1175923065 20:62458972-62458994 GCCCACAGCCTCCCCCCAGGTGG - Intergenic
1178690444 21:34745776-34745798 GCCCAGAGAAGCCCCCTAGGAGG - Intergenic
1180757192 22:18170302-18170324 GCCCCGAGGACACCCCATGGTGG + Intronic
1180802379 22:18637911-18637933 GCTCAGAGCCCCACCCCAGGAGG - Intergenic
1181219345 22:21357350-21357372 GCTCAGAGCCCCACCCCAGGAGG + Intergenic
1181276724 22:21692007-21692029 GCACGGAGCACTCCCCAGGGTGG - Intronic
1181634998 22:24170370-24170392 GTCCAGAGCACCCTCCAGGCGGG - Intronic
1181756633 22:25028953-25028975 GCCCAGAGCAGCGTCCAAGCTGG + Exonic
1181985787 22:26799128-26799150 CCCCAGAGCCCCCCCCAGGCAGG + Intergenic
1182268491 22:29137689-29137711 GCCCTGAAGAACCCCCAAGGAGG - Intronic
1183967255 22:41449265-41449287 ACCCAGAGCTCCCACCAAGGAGG - Intergenic
1184300107 22:43553725-43553747 GCCAAGAGCACCTCCCAGTGGGG - Intronic
1184504421 22:44892362-44892384 GGCCAGAGGACGCCCCATGGTGG + Intronic
1185133770 22:49056777-49056799 GCCCACAGCAGCCCCCCTGGAGG - Intergenic
1185342738 22:50299013-50299035 GCCAAGAGCAGCCCCCAAGCTGG - Intronic
950125450 3:10507215-10507237 GCCCAGGACACCCCTCAGGGAGG + Intronic
953570978 3:44071649-44071671 GCACAGATCACCCCCCAGGTTGG + Intergenic
954459387 3:50617630-50617652 CCCCGGAGCACCGCCCAAGCCGG - Exonic
954603520 3:51891318-51891340 GCCCAGAGGACCACCCACAGAGG - Intergenic
961530331 3:127536544-127536566 GCCCAAGGGACCCCCCAGGGAGG - Intergenic
963115276 3:141723674-141723696 ACCCAGAACACCCAGCAAGGTGG + Intergenic
964782276 3:160353381-160353403 CCCCACAGCAACCCCAAAGGAGG + Intronic
968853778 4:3103027-3103049 GCCTAGAACACTTCCCAAGGCGG - Intronic
969294071 4:6259066-6259088 GCACAGAGCTCCCCGCCAGGAGG + Intergenic
969511647 4:7621184-7621206 GCCCTGAGCCCCGCCCAGGGTGG + Intronic
969675317 4:8611292-8611314 GCCCAGAGCCCCCACAAAGGAGG + Intronic
974691806 4:65306072-65306094 GCCCAGAGCTCTCCGAAAGGAGG + Intergenic
974839309 4:67282912-67282934 GCCCAAGTCACCCCCCATGGTGG - Intergenic
978761219 4:112357734-112357756 GCCCAGAGCCTTCCCCAAAGAGG - Intronic
984937770 4:184904271-184904293 GCCCAGAGCAACTCCTCAGGGGG + Intergenic
985789101 5:1915847-1915869 GCCCAGAACTTCCCCCAAGATGG + Intergenic
986625722 5:9722195-9722217 GCCAAGAGGACCCCCCACAGGGG + Intergenic
997815171 5:137010059-137010081 GCCCTGGGGACACCCCAAGGAGG - Intronic
999088049 5:148910850-148910872 GCCCACAGCACCACCCACAGTGG + Intergenic
999319004 5:150601717-150601739 CCCCAGAGGACCCTCCCAGGGGG - Intronic
1001398484 5:171433126-171433148 GGCCAGATCAGCCCCCAGGGAGG - Intronic
1001424119 5:171612375-171612397 CCCCAGAGCACCCACGAAGCTGG + Intergenic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1004186543 6:13426217-13426239 GCCCAGAACTCCCTCCTAGGAGG - Intronic
1005139608 6:22613235-22613257 GCCCAGGGCATCCCTCCAGGAGG + Intergenic
1006030468 6:31173506-31173528 GCCCTGAGCACCCCAGAAGGGGG - Intronic
1006515221 6:34541837-34541859 CCCCAGAGCAGCACCCCAGGGGG - Intronic
1007092415 6:39192495-39192517 GCCCCCAGCACCCTCCAAGCTGG + Intronic
1008475093 6:51927856-51927878 ACCAAGACCAACCCCCAAGGTGG + Intronic
1012436159 6:99217149-99217171 GCCGAGAACACCCTCCAAAGGGG + Intergenic
1018799345 6:167210372-167210394 GCCCTGTGCACCCCCCATGCAGG + Intergenic
1019475861 7:1243969-1243991 CCCCAGGGCACCCCCCCAGAGGG + Intergenic
1019487744 7:1297045-1297067 GCCGAGCGCACCCCCCAGCGTGG - Intergenic
1019559300 7:1648006-1648028 GTCCTGGGCATCCCCCAAGGCGG - Intergenic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1024219578 7:47277409-47277431 GCACAGAGCACTCACCATGGTGG + Exonic
1026847479 7:73706027-73706049 GCCAGGAGCACCCCCAAGGGAGG - Intronic
1029614458 7:101647629-101647651 GGCCAGACCACACCCCTAGGAGG + Intergenic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1030614869 7:111728812-111728834 GCCCCCAGCACCCCCAAAGCCGG + Intronic
1032079079 7:128849731-128849753 CCCCACAGCACCCCCGAAGTGGG + Intronic
1032650174 7:133869325-133869347 GCCCAGAGCTGCCCCCAGGCTGG - Intronic
1039019750 8:33191932-33191954 GCCCAGAGCATTTCCAAAGGTGG + Intergenic
1039893687 8:41701485-41701507 GCTCCGGGCACCCTCCAAGGGGG - Intronic
1041689146 8:60672266-60672288 GCACAGAGCCCCCTCCAGGGTGG + Intergenic
1042521406 8:69715404-69715426 GCCCAGAGGACCTCCAAAGAGGG - Intronic
1047216493 8:122880324-122880346 TCCCAGAGGACCCACCATGGTGG + Intronic
1049220235 8:141425650-141425672 GCCCAGAGCCAGCCCCAGGGGGG + Intronic
1049539849 8:143203397-143203419 GACCAGTGCACCCACCAAGATGG + Intergenic
1049562120 8:143317108-143317130 GCCCACCGCACTCCCCAAGCAGG - Intronic
1049666104 8:143843490-143843512 GTCCAGAGAAGCCCCTAAGGAGG + Intergenic
1056105370 9:83341863-83341885 GCACAGAGCATCCCACAGGGAGG + Intronic
1056193326 9:84205958-84205980 GTCCAGCAGACCCCCCAAGGCGG - Intergenic
1057053781 9:91946358-91946380 GCCCCGAGGAGCCCCCAAGGAGG + Intronic
1059540405 9:115124790-115124812 GCCCAGAGTACTTCCCAAGGAGG - Intergenic
1059659614 9:116388113-116388135 GCCCAGGTCACCCCATAAGGCGG - Intronic
1061100080 9:128485584-128485606 GCCCAGTGCAGCCCCCAACCCGG - Intronic
1061374802 9:130217516-130217538 GCCCTGTGCTCCACCCAAGGGGG - Intronic
1061566895 9:131446720-131446742 GCCAAGAGGAGACCCCAAGGGGG - Intronic
1186850451 X:13574658-13574680 GCCAAGAGCATCCACCAAGATGG - Intronic
1187368749 X:18686353-18686375 GCTCAGAGCACCACACTAGGGGG + Intronic
1189115962 X:38342977-38342999 GTCAAGAGCACCTCCCAAGTAGG + Intronic
1189322995 X:40097506-40097528 GCCCAGAGCCCACCCCTCGGCGG - Intronic
1192147227 X:68689730-68689752 CCCCAGAGCACCCTGGAAGGAGG - Intronic
1192208213 X:69110034-69110056 TCCCAGCGCAGCTCCCAAGGTGG - Intergenic
1192826916 X:74706860-74706882 GCCCAGAGCAACCACTAAGAGGG - Intergenic