ID: 901506690

View in Genome Browser
Species Human (GRCh38)
Location 1:9689734-9689756
Sequence GACCCCGCAGACGCCCGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901506690_901506694 4 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG 0: 1
1: 0
2: 12
3: 116
4: 823
901506690_901506708 29 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506708 1:9689786-9689808 GTCCCACCCCGCCCAGCCCCGGG 0: 1
1: 1
2: 6
3: 170
4: 1205
901506690_901506695 5 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506695 1:9689762-9689784 GCCCCGCCCCCAGCCCCGCCGGG 0: 1
1: 1
2: 33
3: 242
4: 1422
901506690_901506707 28 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506707 1:9689785-9689807 CGTCCCACCCCGCCCAGCCCCGG 0: 1
1: 0
2: 8
3: 85
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901506690 Original CRISPR GACCCCGCAGACGCCCGCAC AGG (reversed) Intronic
900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG + Intronic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
900148675 1:1168960-1168982 GGCCCCGCAGACACCAGCCCAGG + Intergenic
901506690 1:9689734-9689756 GACCCCGCAGACGCCCGCACAGG - Intronic
902410788 1:16210357-16210379 GACCCCCCAGAGGCCCCCTCAGG + Intronic
905749466 1:40449984-40450006 GCCAGCGCAGACGCCCCCACCGG - Intergenic
917135813 1:171787123-171787145 GACCCTGCAGACTCAGGCACTGG - Intronic
1075698106 10:124450215-124450237 GTCCCCGCGGTCGCGCGCACCGG - Intergenic
1076847010 10:133074333-133074355 GGCCCTGTAGACGCCTGCACAGG + Intronic
1076852501 10:133099961-133099983 AACCCCCCAGACTCCCCCACAGG + Intronic
1077114009 11:874979-875001 GACCCCTCAGGAGCCCCCACAGG + Intronic
1078023659 11:7674253-7674275 CACCCCGCAAACACCCGCCCCGG - Intronic
1078156470 11:8804145-8804167 GACACGGCAGCCGCCCACACTGG - Intronic
1091124798 11:133084258-133084280 CACCCCCCAGACACCTGCACAGG + Intronic
1096983606 12:55743114-55743136 GCCCCCCCAGCCGCCCGCCCCGG + Intergenic
1105307876 13:19181704-19181726 CACCCCGCAGACGCCCAGGCTGG - Intronic
1105415082 13:20204834-20204856 GACACCTGAGACGCCCCCACAGG - Intergenic
1113655915 13:112067735-112067757 GCCCCCGCCGCCGCCCGCCCCGG - Exonic
1132553923 16:564533-564555 GACCCCGAGGACCCCCGCGCTGG - Intronic
1132584634 16:700845-700867 GACCCCGCAGCCGTCCGCGGTGG - Intronic
1136428208 16:30183229-30183251 GGCCCCGCAGACGCGAGCGCAGG - Intronic
1137499926 16:49003046-49003068 GACCCAGCAGAAGCCCTCCCAGG + Intergenic
1143116663 17:4585085-4585107 AACCCCGCAGACGCGAGCAGAGG - Intronic
1145810328 17:27760477-27760499 TAACCCGCAGAGGCCCGCACAGG + Intronic
1151383167 17:73739433-73739455 GAGCCCGCAGGCTCTCGCACTGG + Intergenic
1153643830 18:7177273-7177295 GACCAGGCAGAGGCCAGCACTGG + Intergenic
1158686119 18:59616178-59616200 GACCCCACAGCAGCCCTCACTGG - Intronic
1160310665 18:77787022-77787044 GACCCAGCAGAGGCCAGCATGGG + Intergenic
1160354568 18:78216109-78216131 GAGCCCGCAGGGGCCCGCAGGGG - Intergenic
1160790361 19:920171-920193 GCCCGCGCAGATGCCCCCACCGG - Intronic
1160994391 19:1875985-1876007 GACCCCGCGGCGGCCCCCACGGG + Intergenic
1161864269 19:6822146-6822168 GTCCCCGCAGACCCCAGCGCAGG - Intronic
1163450361 19:17373455-17373477 GACCACCCAGCCGTCCGCACTGG - Intronic
1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG + Intergenic
1166044996 19:40224748-40224770 GACCCCGGAGATGCGCGCCCTGG - Exonic
1168293810 19:55369493-55369515 GACCCCTTAGACGCCCTCCCAGG + Intronic
1168465073 19:56595324-56595346 GACCCCGCAGCCACACTCACCGG - Exonic
927112203 2:19871622-19871644 GACCCAGCAGATACCCACACAGG - Intergenic
935215675 2:100973660-100973682 GGCCACGCAGACGCACGCATGGG + Intronic
949022706 2:241750392-241750414 GACCCCCCACCCGCCCGCCCGGG - Intronic
1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG + Exonic
1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG + Intronic
1179953349 21:44724008-44724030 GACCCCGCTGGGGCCCGCCCTGG + Intergenic
1180794102 22:18593448-18593470 GACACCGCAGCCGGCCGCACAGG - Intergenic
1181227636 22:21401872-21401894 GACACCGCAGCCGGCCGCACAGG + Intergenic
1181251014 22:21532967-21532989 GACACCGCAGCCGGCCGCACAGG - Intergenic
1182511296 22:30822315-30822337 GACCCCGCGGACGCCCATGCAGG - Intronic
1185340691 22:50289643-50289665 GAACAGGCAGAGGCCCGCACCGG + Exonic
951907945 3:27722074-27722096 GAGCCCGCAGCCGCCAGCGCAGG - Exonic
959749743 3:109819528-109819550 GACCCCTCCCACGCCCCCACAGG + Intergenic
960141188 3:114153043-114153065 GACTCCGCTGACCCCAGCACTGG + Intronic
964622614 3:158732297-158732319 GACCCCGCGGGCGCCGCCACCGG + Exonic
969607193 4:8208260-8208282 CACCCCGCAGATGCCCCCATGGG - Intronic
971757486 4:30721546-30721568 GGCCCCGCCGACGTCCGCATCGG + Exonic
982243839 4:153328879-153328901 GACCCCACAGACCCCCACAAAGG + Intronic
992134006 5:73724027-73724049 GCCCCCGCAGACCCTGGCACAGG - Intronic
1002073731 5:176696026-176696048 GACCCCGCAGACCCCTGCTGGGG - Intergenic
1002701940 5:181130634-181130656 GACCCCACAGACTCCAGCCCTGG + Intergenic
1002703856 5:181147512-181147534 GACCCCACAGACTCCAGCCCTGG - Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1005851707 6:29827909-29827931 GACCCCGCACTCACCCGCCCAGG - Exonic
1005866644 6:29942618-29942640 GACCCCGCACTCACCCGCCCAGG - Exonic
1005875313 6:30006661-30006683 GACCCCGCACTCACCCGCCCAGG - Intergenic
1005931676 6:30489587-30489609 GACCCCGCACTCACCCGCCCAGG - Exonic
1008629263 6:53348313-53348335 GTGCCCGCAGACCCTCGCACAGG + Intronic
1018973270 6:168544167-168544189 GACCCCGCAGACCCCGAAACAGG - Intronic
1019424747 7:969226-969248 TACCCAGGAGACGCCCCCACAGG + Exonic
1019623260 7:2002849-2002871 GACCTCGGAGACCCCCGCCCTGG + Intronic
1032074849 7:128831457-128831479 GAGCCCGCAGACGCGGGCAGTGG - Intronic
1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG + Intronic
1035758498 8:2051754-2051776 TACCCCGCACATGCCCGCCCTGG - Intronic
1037802063 8:22041260-22041282 GACCCCGGAGCTGCCTGCACTGG + Intergenic
1042666749 8:71215594-71215616 GACCCCGCAGAGAGCCTCACCGG + Exonic
1049605410 8:143526974-143526996 GACCCCTGAGAGGCCGGCACAGG + Intronic
1056163501 9:83921156-83921178 GACCCCTCGGACGCCCCCATAGG + Intronic
1057211564 9:93203495-93203517 GACCCCGCAGCCACTCCCACAGG - Intronic
1059470933 9:114504715-114504737 GCCCCCGCCGCCGCCCGCCCCGG + Exonic
1061777842 9:132977780-132977802 GACACCCCAGAGGCCCCCACTGG + Intronic
1062286535 9:135775443-135775465 GCACCCCCAGACGCCAGCACCGG + Intronic
1189266241 X:39718831-39718853 GATCCAGCAGACACCAGCACAGG + Intergenic