ID: 901506690

View in Genome Browser
Species Human (GRCh38)
Location 1:9689734-9689756
Sequence GACCCCGCAGACGCCCGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901506690_901506694 4 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG 0: 1
1: 0
2: 12
3: 116
4: 823
901506690_901506707 28 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506707 1:9689785-9689807 CGTCCCACCCCGCCCAGCCCCGG 0: 1
1: 0
2: 8
3: 85
4: 864
901506690_901506708 29 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506708 1:9689786-9689808 GTCCCACCCCGCCCAGCCCCGGG 0: 1
1: 1
2: 6
3: 170
4: 1205
901506690_901506695 5 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506695 1:9689762-9689784 GCCCCGCCCCCAGCCCCGCCGGG 0: 1
1: 1
2: 33
3: 242
4: 1422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901506690 Original CRISPR GACCCCGCAGACGCCCGCAC AGG (reversed) Intronic