ID: 901506694

View in Genome Browser
Species Human (GRCh38)
Location 1:9689761-9689783
Sequence TGCCCCGCCCCCAGCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 1, 1: 0, 2: 12, 3: 116, 4: 823}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901506681_901506694 20 Left 901506681 1:9689718-9689740 CCCGGTACGGAGCCCACCTGTGC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG 0: 1
1: 0
2: 12
3: 116
4: 823
901506687_901506694 7 Left 901506687 1:9689731-9689753 CCACCTGTGCGGGCGTCTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG 0: 1
1: 0
2: 12
3: 116
4: 823
901506685_901506694 8 Left 901506685 1:9689730-9689752 CCCACCTGTGCGGGCGTCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 64
Right 901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG 0: 1
1: 0
2: 12
3: 116
4: 823
901506682_901506694 19 Left 901506682 1:9689719-9689741 CCGGTACGGAGCCCACCTGTGCG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG 0: 1
1: 0
2: 12
3: 116
4: 823
901506690_901506694 4 Left 901506690 1:9689734-9689756 CCTGTGCGGGCGTCTGCGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG 0: 1
1: 0
2: 12
3: 116
4: 823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901506694 Original CRISPR TGCCCCGCCCCCAGCCCCGC CGG Intronic