ID: 901508386

View in Genome Browser
Species Human (GRCh38)
Location 1:9701005-9701027
Sequence CTGCGGAGAAGCAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 0, 2: 3, 3: 76, 4: 665}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901508386_901508394 11 Left 901508386 1:9701005-9701027 CCTTCCTCCCTGCTTCTCCGCAG 0: 1
1: 0
2: 3
3: 76
4: 665
Right 901508394 1:9701039-9701061 CGCAGCCAGCAGCATAGTTGTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901508386 Original CRISPR CTGCGGAGAAGCAGGGAGGA AGG (reversed) Intronic
900112720 1:1015327-1015349 TGGCCGGGAAGCAGGGAGGACGG + Intergenic
900238492 1:1603721-1603743 CAGCGGAGAAGCAGTGAGGGTGG - Intergenic
900264039 1:1748309-1748331 CTGGGGAGAGGAAGAGAGGAAGG - Intergenic
900429154 1:2593751-2593773 CCGCGGAGAAGCAGCCAGGAAGG - Intronic
900472791 1:2863041-2863063 CCACGGAGAAGCTGGGAGGTTGG - Intergenic
900524177 1:3120408-3120430 CTGCAGAGTGGCTGGGAGGACGG + Intronic
900795269 1:4703967-4703989 GTGGGGAGAAGCAGGGTAGAGGG - Intronic
901051008 1:6425866-6425888 CTGCTGAGAAGCAGGTAGCCAGG + Intronic
901162722 1:7192378-7192400 CTGCGGAGGGGCAGAGCGGAGGG + Intronic
901215520 1:7552742-7552764 CTGCAGCAAAGCAGGGAGGCTGG + Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901672923 1:10866606-10866628 ATCCTGAGAAGCAAGGAGGAGGG - Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902972909 1:20067994-20068016 CTCCGGAGAAGCTGGGATTACGG - Intronic
903033595 1:20480473-20480495 CTGTTGGGAAGCAGGGAGTATGG - Intergenic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903166267 1:21522750-21522772 CTGAGCAGAAGCTGGCAGGAGGG + Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903331812 1:22600470-22600492 CTGTGGAGACGAAGGAAGGAGGG - Intronic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903541070 1:24096632-24096654 CTGATGAGAGGCAGGGAGGGTGG + Intronic
903967700 1:27100580-27100602 CTGCGGGGAAGCCGGGTCGATGG + Exonic
904265303 1:29315295-29315317 CTAAGGAGAAGAAGAGAGGAGGG - Intronic
904878090 1:33671935-33671957 CTGCCTATAAGCAGGGAGGTGGG - Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
905252660 1:36659461-36659483 CAGCGGAAAAGCAGGGACCAGGG - Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
906258268 1:44367195-44367217 CTGCTTACAAGCAGGGAGGGTGG + Intergenic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
906711103 1:47930521-47930543 CAGGGCAGTAGCAGGGAGGAGGG - Intronic
906732778 1:48097591-48097613 CTGAGGAGAAGCAGATTGGAGGG - Intergenic
907250267 1:53133467-53133489 CTGCTCAGCAGCAGGGAGGCTGG + Intronic
907305993 1:53513500-53513522 GAGTGGAGAAGCTGGGAGGAAGG - Intronic
908783811 1:67715502-67715524 CTGCTGACAAGCAGGGTGGTGGG + Intronic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
912209458 1:107542697-107542719 CTGCTGAGAAGCAAGGAAGTAGG - Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912491124 1:110063380-110063402 CCTCGGAGGAGCAGGGAGGCAGG + Intronic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913301872 1:117379633-117379655 CTAGGGGGAAGCAGGGAGGAGGG - Intronic
914245729 1:145884800-145884822 CTGGGGAAAAGCAGGCAGAAAGG + Intronic
915519559 1:156433868-156433890 TGGGGGAGAAGCAGGCAGGAGGG - Intergenic
915530814 1:156501036-156501058 CTGCCGGGAGGGAGGGAGGAAGG + Intergenic
915669060 1:157472123-157472145 CTGCAGAGAGGCAGAGAGGAAGG + Intergenic
916214637 1:162384587-162384609 CAGAGCAGAAGCAGGGAGAAGGG + Intronic
916888891 1:169097446-169097468 CAGTGGAGAAACAGTGAGGAGGG + Intergenic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917062008 1:171051583-171051605 TGGCAGAGAGGCAGGGAGGAGGG + Intronic
917441578 1:175073584-175073606 CTGCAGAGAAGCTGGAGGGAAGG + Intronic
917535176 1:175869313-175869335 CTGGGGAGAAGCAGGTGGCAGGG - Intergenic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
920096171 1:203487833-203487855 CTCCTGAGAAACAGGGAGGAAGG + Exonic
920369940 1:205472607-205472629 CTGCACAGTACCAGGGAGGAGGG - Intergenic
920441646 1:205984880-205984902 CTGGGAGGAGGCAGGGAGGAGGG - Intronic
921132225 1:212229689-212229711 GTGGGGAGAGGAAGGGAGGAGGG - Intergenic
921289202 1:213639464-213639486 CTGGGGTGGAGCAGGGAGGGAGG + Intergenic
922412696 1:225391550-225391572 GTGGGCAGAAGCAGGGAGTAGGG + Intronic
923030497 1:230245839-230245861 CTGCTGGGAGGCAGGGAGGGAGG - Intronic
923051669 1:230394681-230394703 GTGAGGAGAGGAAGGGAGGAAGG - Intronic
923051700 1:230394794-230394816 GTGAGGAGAGGAAGGGAGGAAGG - Intronic
1062822128 10:542271-542293 CTGCTGAGAAGCAGAAAGCATGG + Intronic
1062901225 10:1148157-1148179 ATGGGGAGGAGCAGGGAGGGAGG + Intergenic
1063694994 10:8326294-8326316 CTGTGGAGAAGCTGGGAGTATGG + Intergenic
1064174068 10:13059031-13059053 CAGATGAGAAACAGGGAGGAAGG + Intronic
1064453506 10:15465443-15465465 CTGGGAAGAAGCAGGGAGGCAGG - Intergenic
1064582876 10:16811751-16811773 CTGCGGAGAAGCCTGCAGGAAGG + Intronic
1064635242 10:17358596-17358618 AGGAGGAGAAGGAGGGAGGAAGG + Intronic
1064816823 10:19274816-19274838 CTGGGGGGAGGCAGGAAGGAAGG + Intronic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1065487619 10:26249921-26249943 GGGCGGAGAAGGAGGCAGGAGGG + Intronic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1067045304 10:42981995-42982017 CTGCAGAGGAGCAGGTGGGAAGG - Intergenic
1067280631 10:44869425-44869447 AGACGGAGAGGCAGGGAGGAAGG + Intergenic
1068912143 10:62389668-62389690 CAGCAGAGAGGAAGGGAGGAAGG + Intronic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1069782269 10:70964449-70964471 CGGCGGAGCAGCTGAGAGGAGGG - Intergenic
1069874895 10:71555799-71555821 CTCCTGAGAAGAAGGGAGGGAGG + Intronic
1069893083 10:71664115-71664137 CTGGGGAGATGCCTGGAGGAGGG - Intronic
1070079081 10:73168129-73168151 CCGCGGCAAAGCAGGGAGGTCGG + Intronic
1070217647 10:74403458-74403480 CTGCAGGGAAGCAGTGAGGCTGG - Intronic
1070527953 10:77311391-77311413 GTGCCGAGAAGCAGGGAGGAGGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070743748 10:78920041-78920063 CTGGGAAGAGGCAGGGAGGGAGG + Intergenic
1071301723 10:84261236-84261258 CAGAGGAGAGGCAGGGAGGAAGG + Intergenic
1071698869 10:87907404-87907426 CTGGGGAGAAGCAGGAATAAAGG + Intronic
1072996454 10:100249078-100249100 CTGCGGAGGTGCAGGCAGGGTGG - Intronic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1075227263 10:120640828-120640850 CAGCGGTGATGCAGGGAGCAAGG + Intergenic
1075579265 10:123604488-123604510 CGGCAGACAAGCAGTGAGGAAGG - Intergenic
1075730821 10:124635595-124635617 CCTCTGAGATGCAGGGAGGAAGG + Intronic
1076418770 10:130312959-130312981 CTAGGGAGAAGCAGAAAGGAGGG + Intergenic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076790552 10:132774873-132774895 GGGAGGAGAGGCAGGGAGGAGGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077198437 11:1293207-1293229 CGGGGGAGAAGCCGGGAGGGTGG + Intronic
1077235598 11:1480673-1480695 TCGAGGAGGAGCAGGGAGGAGGG + Intronic
1077251291 11:1561833-1561855 CTGCGAAGAACCAGGGAGAGTGG - Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077272222 11:1686735-1686757 AGGCAGAGAAGGAGGGAGGAGGG - Intergenic
1077303173 11:1856414-1856436 CTGCAGAGGAGCAGGGCGGTTGG - Intronic
1077385986 11:2269706-2269728 CAGCCGGGAGGCAGGGAGGAGGG - Intronic
1078194638 11:9125318-9125340 CTGCGTAGAAGCAGGGAAAAGGG + Intronic
1078575314 11:12496972-12496994 CAGCTGAGAAGCAGGGAGCAAGG + Intronic
1078593442 11:12665821-12665843 CTGGTTAGAAGCAGAGAGGAGGG + Intergenic
1079328233 11:19512448-19512470 CTGGGGAGAACCAGAGAGGGAGG + Intronic
1080891973 11:36416964-36416986 CTGGAGAGCAGCACGGAGGAGGG - Intronic
1081525531 11:43925149-43925171 CAGCAGAGAAGCCTGGAGGAGGG - Intergenic
1081626441 11:44658808-44658830 CTGAGCAGAGGGAGGGAGGAGGG + Intergenic
1082983485 11:59145184-59145206 GTGCGGAGAAGCAGGAAGAGAGG + Exonic
1083207397 11:61161096-61161118 CTGCAGAGACGCAGAAAGGAGGG + Intronic
1083246998 11:61436358-61436380 CTAGGGAGAAGCTGGGAGGTGGG + Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083440027 11:62669997-62670019 CCAGGGAGAAGCAAGGAGGATGG - Exonic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1083975829 11:66119101-66119123 CAGAGGACAAGCAGGGAGTAGGG - Intronic
1084085585 11:66853627-66853649 CTGCGGGGAGGCAGGAAGGGTGG - Intronic
1084104268 11:66970802-66970824 AGGCAGAGAAGCAGTGAGGAGGG + Intergenic
1084462381 11:69303080-69303102 CTGTGGAGCAGTAGGGAGGCTGG + Intronic
1084758910 11:71256067-71256089 GTGGGGAGCAGCAGGCAGGAGGG + Intergenic
1084931808 11:72561988-72562010 CTGGGGTGGAGCAGGGTGGATGG - Intergenic
1084951389 11:72667924-72667946 CTGAGAAGAAGCATGGAGGAGGG + Intronic
1084968836 11:72758488-72758510 CTGCGGTGGAGCAGGGGAGAGGG - Intronic
1085059975 11:73436749-73436771 TTGAGGAGAGGCAGGGAGGTTGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085277068 11:75307141-75307163 CTGCTGTGGGGCAGGGAGGAAGG - Intronic
1085457591 11:76674066-76674088 CTGGGCAGAAGCAGGGAGTGAGG - Intergenic
1085510955 11:77087977-77087999 CTGGGGAGATGCACGGAGAATGG + Intronic
1086260610 11:84935528-84935550 CTATGGAAAAGCAGGTAGGAGGG - Intronic
1087288876 11:96298311-96298333 TTGCAGAGAAACAGTGAGGATGG + Intronic
1087411285 11:97792941-97792963 CTGAGGAGAGGCAGGGACAAAGG - Intergenic
1088262730 11:107959622-107959644 CTGAGGAGAAACAGGGAAGCAGG + Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088579269 11:111299759-111299781 CGGGGGCGAAGGAGGGAGGAGGG + Intronic
1089534226 11:119150635-119150657 GTGCTCAGAAGCAGGGAGGGTGG + Intronic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091096198 11:132824592-132824614 CAGTGGAGAAGCAGAGATGAAGG - Intronic
1091204253 11:133808722-133808744 CTGTGGAGATGCAGTGATGATGG - Intergenic
1091286441 11:134411256-134411278 CTTCGGTGTAGCAAGGAGGAAGG - Intronic
1091586718 12:1821052-1821074 CTGCTGGGAAGTGGGGAGGAGGG + Intronic
1091986069 12:4910906-4910928 CCGAGGAGAAGCAGAGAGGGTGG + Exonic
1092239874 12:6829836-6829858 CTGAGGAGGCGAAGGGAGGAGGG - Intronic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093905786 12:24690627-24690649 CTGGAGGGAAGCAGAGAGGATGG - Intergenic
1095713443 12:45315398-45315420 CTGGGCAGAAGCAGGGAATATGG + Intronic
1095967515 12:47878940-47878962 CTGGGGAGAGCCTGGGAGGAGGG + Intronic
1095982924 12:47982999-47983021 CCAGGGAGAAGCAGGGAGGTGGG + Intronic
1096103244 12:48981866-48981888 CCGCGGAGAGGGAGGGAGGTAGG - Intergenic
1096154329 12:49333338-49333360 CTGGGGAGGACCAGGGAGGAGGG + Intronic
1096377387 12:51124557-51124579 CTGCGGAGGTGCAGGCAGGGTGG + Intronic
1096743982 12:53713661-53713683 CTGTGCAGAAGCAGTAAGGAGGG - Intronic
1096777741 12:53974295-53974317 CTGCCGAGGAGTGGGGAGGAGGG + Intronic
1097173041 12:57128189-57128211 CTCTGGAGCACCAGGGAGGAGGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097195819 12:57242013-57242035 ATGCCGAGAAGCAGGGAGAGCGG - Intergenic
1097336605 12:58390675-58390697 CTGAGGAGAAACATGGAAGAGGG - Intergenic
1097918881 12:65050023-65050045 CTGCTGAGAAAAAGGAAGGAGGG + Intergenic
1097929833 12:65170609-65170631 CGGCCGCGGAGCAGGGAGGAGGG + Exonic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1098384329 12:69902748-69902770 CTACAGGGAAGCAGGAAGGAAGG + Intronic
1098507471 12:71270768-71270790 CTGTTGAAGAGCAGGGAGGAGGG - Intronic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1101323856 12:103697598-103697620 CTGCTGTGGAGCAGGGAGGGAGG - Intronic
1101520252 12:105475660-105475682 CTACTGAGAAACAGAGAGGAGGG - Intergenic
1102132122 12:110540202-110540224 TGGCTGAGAAGGAGGGAGGAAGG + Intronic
1103859426 12:124000296-124000318 CTGCTGGGAAGCAGGAAGCAAGG - Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1103929344 12:124440966-124440988 CTGGGGAGGGGCAGAGAGGACGG + Intronic
1103938389 12:124488781-124488803 GGGCAGAGAAGCAGGGCGGACGG + Intronic
1103970302 12:124666652-124666674 GAGCAGAGAAGCAGGAAGGATGG + Intergenic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104487106 12:129161159-129161181 CTGAGGAACAGCAGGAAGGAGGG + Intronic
1104761770 12:131301035-131301057 CAGCGGATCAGCAGAGAGGACGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104896949 12:132169200-132169222 AGGGGGAGAAGCAGGGAGGGCGG + Intergenic
1104896975 12:132169268-132169290 AGGGGGAGAAGCAGGGAGGGCGG + Intergenic
1105425443 13:20291020-20291042 AAGAGGAGAGGCAGGGAGGAGGG - Intergenic
1106032827 13:26018089-26018111 GGGCTGAGCAGCAGGGAGGAGGG - Intronic
1106144642 13:27040212-27040234 CTGCGGAGCGTCAGGGAGCACGG - Intergenic
1106602485 13:31199944-31199966 CGGCGGAGACGGAGGGAGGAGGG + Exonic
1107413153 13:40176290-40176312 CAGTGGAGAGGCAGGGAGAAAGG - Intergenic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1108918220 13:55642592-55642614 CTGATTAGAAGCAGTGAGGAAGG - Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113849275 13:113408854-113408876 CTGCAGAGAGGAAGGGAGGAGGG + Intergenic
1113881043 13:113626506-113626528 CTGCGGGGAAGCGGGGCGCAGGG - Intronic
1114352023 14:21863240-21863262 CTCCGGTGAAGCTGGGAGCAGGG + Intergenic
1114558940 14:23577625-23577647 CTGCGGAGAAAGAGGGAGGGGGG + Intronic
1114662174 14:24354074-24354096 CTGGGGAGAAGCAGGGATGGAGG + Intergenic
1115185526 14:30683778-30683800 CTCCTGAGAAGTAGGGAGAAAGG + Intronic
1115308234 14:31953821-31953843 CTGAGGAGAAGCAGAGAGTTGGG - Intergenic
1116849392 14:49893233-49893255 CTGCAGAGAAACAGAGAGGGAGG - Intronic
1118206561 14:63728296-63728318 CCGCGGAGAAGAAGGGCTGAAGG - Intergenic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118320239 14:64748610-64748632 GGGGGGAGAAGCAGAGAGGAGGG + Exonic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118758526 14:68863326-68863348 CTGGGAAGAAGCAGGGGGGAAGG + Intergenic
1118971704 14:70642647-70642669 CTGGGGAGAACCCGGGAGGGAGG + Intronic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119588177 14:75858104-75858126 CTGCGGAGAGGTTGGGAGGAGGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119768654 14:77206390-77206412 CTGGGGTGGAGCAGGGAGGGAGG + Intronic
1120265134 14:82239062-82239084 AGGGGGAGAAGCAGGAAGGAAGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120840722 14:89082857-89082879 CTGCTGGCAAACAGGGAGGAGGG - Intergenic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1121608037 14:95255576-95255598 CTGCAGAGAAGGAGGCAGTAGGG + Intronic
1121816336 14:96931924-96931946 CTGCGGAAATGCAGGCAAGATGG + Intergenic
1121836602 14:97097993-97098015 CAGCTGAGAAGCAGAGAGGCTGG + Intergenic
1121902447 14:97706332-97706354 CTGGGAAAAAGCAGGGAGGCTGG + Intergenic
1122826534 14:104373548-104373570 TTGCTGAGAAGGAGGGAGGGAGG + Intergenic
1123010672 14:105348183-105348205 CTGTGGACAGGCAGGTAGGAGGG - Intronic
1123020517 14:105395834-105395856 CTGGGGAGAAGCAGGACTGAGGG - Exonic
1123146803 14:106141237-106141259 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1123697199 15:22887381-22887403 CTGAGGAGAGGCTGGGAGGAGGG - Intronic
1125039048 15:35161917-35161939 CTGAGGAGAAGCAGTCTGGAAGG - Intergenic
1125065895 15:35486138-35486160 CAAAGGAGAAGCAGGCAGGATGG + Intronic
1125446274 15:39760844-39760866 ATTAGGAGAAGCAGGGGGGAAGG + Intronic
1125675208 15:41498526-41498548 CTGTGCAGAAACAGTGAGGAGGG - Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125989433 15:44091855-44091877 CTGAGGGGAAGCAGGGAGAGAGG - Intronic
1126284629 15:46996832-46996854 CTGCGGAGCTCCTGGGAGGAGGG - Intergenic
1127899084 15:63328004-63328026 GTACAGAGAAGCAGAGAGGACGG + Intronic
1128454209 15:67823509-67823531 GCGCGGAGAACCAGGGAGCACGG + Intronic
1128520650 15:68372524-68372546 CTGCGGAGGCGCAGGGAGCAGGG + Intronic
1128610806 15:69071670-69071692 CGGGTGAGAAGCAGGGAGAACGG - Intergenic
1128870739 15:71153489-71153511 GTGGTGAGAAGCAGGGAAGATGG - Intronic
1128870909 15:71154621-71154643 CTGCGGGTAAGCAGGAAGGCTGG + Intronic
1129112397 15:73345050-73345072 CTGCAGGGAAGCCAGGAGGAAGG + Intronic
1129442492 15:75591880-75591902 CTGTGCAGCAGCAGAGAGGAGGG + Intergenic
1129916956 15:79282688-79282710 CTGCGAGGAAGGAGGAAGGAGGG - Intergenic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132841121 16:1978986-1979008 CTGGGGAGGAGCGGGGAGGGCGG - Exonic
1132934311 16:2473245-2473267 CTGCAGAGAGGGAGGGAGAATGG - Intronic
1132947679 16:2540928-2540950 GAGGGGAGAAGCAGGGAGCATGG + Intronic
1132968058 16:2670697-2670719 GAGGGGAGAAGCAGGGAGCATGG - Intergenic
1133229361 16:4359386-4359408 CTGCGGGGAAGAAGGCAGGCTGG + Intronic
1133330498 16:4970297-4970319 TTGCGGGGAAGCAGGGAGTGGGG + Intronic
1134014497 16:10878923-10878945 CTGCGGGGAGGCGGGGAGGTAGG + Intronic
1134076077 16:11292460-11292482 CTGAGGAGGAGCAGCTAGGAAGG + Intronic
1134849709 16:17470386-17470408 CCGCGGCGAGGGAGGGAGGAAGG - Intronic
1135229637 16:20693711-20693733 AAGTGGAGAAGCAGGCAGGAGGG - Intronic
1135623594 16:23976567-23976589 CACAGGAGAAGCATGGAGGATGG + Intronic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136110174 16:28059628-28059650 CTGAGGAGAGGCCTGGAGGAGGG - Intronic
1136115794 16:28093535-28093557 CTGCGGGGCAGCGAGGAGGAAGG + Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136614922 16:31392964-31392986 CGGCAGAGAGGCAGGGAGAAGGG - Intergenic
1136692263 16:32040311-32040333 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136792759 16:32983540-32983562 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136877096 16:33870514-33870536 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1137056542 16:35748985-35749007 CGGCGGCGAAGCAGGCAGGCGGG - Intergenic
1137446703 16:48536444-48536466 CTCGCTAGAAGCAGGGAGGAGGG + Intergenic
1137612128 16:49825569-49825591 CTTGGAAGAAGCAGGAAGGAAGG + Intronic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137735171 16:50718538-50718560 CTGCGGATAAGCAGGGGGCAGGG + Intronic
1137819050 16:51426167-51426189 CTGCTGTGCAGCAGGGAGGCTGG - Intergenic
1138532025 16:57639729-57639751 CAGGGGAGAAGCGGGGAGCAGGG - Intronic
1139561267 16:67743891-67743913 CTGTGGAGCAGCAGTGAGGGTGG - Intronic
1139678555 16:68541988-68542010 CTGCAGATAACCAGGGATGAAGG + Intronic
1140040850 16:71406691-71406713 CTCAGGAGAACCAGGGAGGGAGG - Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140225097 16:73070778-73070800 CTGGAGAGAGGCAGAGAGGATGG - Intergenic
1140751299 16:78026446-78026468 CTGTGCAGAAGCAGGTAAGAGGG + Intronic
1141263675 16:82476238-82476260 AGGAGGAGAAGGAGGGAGGAGGG - Intergenic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1142290962 16:89193387-89193409 CTGCGAAGGAGGTGGGAGGAGGG - Intronic
1142292986 16:89201234-89201256 CTGCGGGGCAGCAGGGACGGGGG + Intronic
1142376010 16:89707490-89707512 CTGGGGAGCATCAGGGAAGAGGG - Exonic
1203095016 16_KI270728v1_random:1245228-1245250 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1142473595 17:177204-177226 CTCCTGGGAAGCAGGGATGATGG - Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143320174 17:6063248-6063270 CTAAGGAAAGGCAGGGAGGAGGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144421008 17:15098454-15098476 ATGCGGAGAATGAGGGAGGTGGG - Intergenic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1144843875 17:18205777-18205799 CTGGGGAGAAGTAAGCAGGAGGG - Intronic
1146403652 17:32519402-32519424 ACGCAGGGAAGCAGGGAGGAGGG + Intronic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147254662 17:39174685-39174707 CTGCCAGGAAGCTGGGAGGAAGG + Exonic
1147458355 17:40552748-40552770 CTGTGGAGGAGCAGGGAGAGAGG - Intergenic
1147599832 17:41738793-41738815 CTGCAGGGGAGCAGGGTGGAGGG + Intergenic
1148109567 17:45136953-45136975 CAGGGCAGGAGCAGGGAGGAAGG + Intronic
1148444095 17:47727273-47727295 CTGCTGAGAGGCAGGAAGGGTGG + Intergenic
1148749088 17:49934564-49934586 CTGTGGTGGAGCAGGTAGGAAGG + Intergenic
1149793364 17:59498489-59498511 CTGAAGAGAAGCAGGGTGGAGGG + Intergenic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150633596 17:66897606-66897628 TTGCAGAGAAGGAAGGAGGAAGG - Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151162272 17:72175661-72175683 AGGCAGAGAAGCAGGGAGGGAGG - Intergenic
1151210230 17:72538936-72538958 CTGGAGAGAAACTGGGAGGAGGG + Intergenic
1151424843 17:74024358-74024380 CTGCGGGGTGGCAGGGAGAAAGG - Intergenic
1151553969 17:74837340-74837362 CTCCGGAGTAGCAGGCTGGATGG + Exonic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152352071 17:79789793-79789815 GTGCGGAGGGGCTGGGAGGACGG + Intergenic
1152420208 17:80188696-80188718 CTGGGGAACAGCAGGAAGGAAGG - Intronic
1152829180 17:82486630-82486652 CTGAGGAGCAGCCGGGAGGTGGG + Intronic
1152987001 18:330257-330279 CAGCTGAGCAGCAGGGAGGAGGG - Intronic
1153632801 18:7088222-7088244 CGGAGGAGACGAAGGGAGGAAGG - Intronic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153977047 18:10278551-10278573 TTGGGGAGAGGCAGGCAGGAAGG - Intergenic
1153979592 18:10297665-10297687 AGGGGGAGAAGCAGGAAGGAGGG - Intergenic
1154190922 18:12230658-12230680 CTCCGGTGCAGCAGGGAGGATGG + Intergenic
1155875220 18:31078074-31078096 CTGCGGAGATGTAGGAAGGCAGG + Intronic
1156521193 18:37723585-37723607 GTGCTGGGAAGAAGGGAGGAGGG + Intergenic
1156723821 18:40103377-40103399 CGGGTGGGAAGCAGGGAGGAAGG - Intergenic
1157226150 18:45866500-45866522 CAGCAGAATAGCAGGGAGGAAGG - Intronic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157725231 18:49958939-49958961 CAGGGGAGAAGCAGGGGAGAGGG - Intronic
1157856213 18:51107956-51107978 CTGCGTAGGAGAAGGGAGAAGGG + Intergenic
1158058715 18:53312965-53312987 GTGGGGAGAGGAAGGGAGGAGGG + Intronic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160703180 19:517911-517933 CTGGGTAGAGGCTGGGAGGAGGG + Intronic
1160703197 19:517960-517982 CTGGGTAGAGGCTGGGAGGAGGG + Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160985266 19:1835762-1835784 TTGGGGTGAAGCAGGGAGGAAGG - Intronic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161268180 19:3374857-3374879 CTGGGGAGGACAAGGGAGGATGG + Intronic
1161735586 19:5990476-5990498 CTGGGGAGTAGCAAAGAGGAAGG + Intergenic
1161980327 19:7626882-7626904 GTGGGGAGAAGCAGGCAGGGTGG - Intronic
1162675317 19:12294411-12294433 CTGGGGAGAAGCGGGGCTGAGGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1162982288 19:14247895-14247917 CTACGGCGAAGCAGGAAGGCTGG + Intergenic
1163123405 19:15231695-15231717 CTCCCAAGAGGCAGGGAGGAGGG - Intronic
1163635663 19:18436164-18436186 CTGCGGAGACCCATTGAGGAAGG + Exonic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164553616 19:29232967-29232989 CTGCGGAGACGCTGGGGTGATGG + Intergenic
1164670614 19:30070151-30070173 CTGAGGCCAAGCTGGGAGGAGGG - Intergenic
1164905189 19:31961374-31961396 GTGCACAGAAGAAGGGAGGAGGG - Intergenic
1164907662 19:31980527-31980549 CGGAGGAGTAGCAGGTAGGATGG - Intergenic
1165052591 19:33151440-33151462 CTGGGGACAGGCAGGCAGGAGGG + Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165293297 19:34906096-34906118 CAGAGAAGATGCAGGGAGGAAGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165431816 19:35777253-35777275 TTGCGGAAAAGCTGGCAGGAGGG + Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166329299 19:42069405-42069427 CTCCACAGGAGCAGGGAGGAAGG + Intronic
1166563365 19:43747953-43747975 GAGCAGAGAAGGAGGGAGGAGGG - Intronic
1166691381 19:44823135-44823157 CTGCCTAGAAGGACGGAGGAGGG + Intergenic
1167035422 19:46992544-46992566 CTCCAGATAGGCAGGGAGGAGGG - Intronic
1167254406 19:48418655-48418677 CGAGGGAGAAGGAGGGAGGAAGG + Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
925237726 2:2293767-2293789 CTCCAGAGGAGCCGGGAGGAGGG - Intronic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
927307531 2:21590638-21590660 CTGGGGAGCAGAAGAGAGGAAGG - Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927683362 2:25154619-25154641 CTCAGGAGAAGCCGGGGGGAGGG + Exonic
928412882 2:31067907-31067929 TTGGGGAGGAGCAGGCAGGAAGG + Intronic
928549441 2:32357022-32357044 AGGGGGAGAAGCAGGGAGGGAGG - Exonic
929607865 2:43247145-43247167 CAGTGGAGAAGCTGGGAGGAGGG + Intronic
929825977 2:45310071-45310093 CTGAGAAGACTCAGGGAGGATGG - Intergenic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
930221549 2:48751359-48751381 TTGCTGAGAAGCAAGGAAGAAGG - Intronic
930516924 2:52420129-52420151 CTGCAAAGCAGCAGGGAGGCTGG + Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931645584 2:64418927-64418949 CTGTGCAGATGCTGGGAGGATGG - Intergenic
931748095 2:65308134-65308156 CAGGGCAGCAGCAGGGAGGAAGG + Intergenic
932420771 2:71599999-71600021 CTTCGGAGCAGGAGGGAGGCAGG + Intronic
932571647 2:72941456-72941478 CTGCAGAGAAGCGGGCAGGGAGG - Intergenic
932651907 2:73567003-73567025 CACAGGAGAAGCTGGGAGGATGG - Intronic
933157754 2:78993548-78993570 CTACGGAGAAGAGGGGAGAATGG - Intergenic
933617329 2:84496025-84496047 CTGCTGAGAAGCGTGGAGGTGGG - Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934883117 2:98000485-98000507 CAGCAGAGAACCAGGGAGAAGGG - Intergenic
935222447 2:101027216-101027238 CTGGGTAGAAGCAGGTAGGCAGG + Intronic
935277994 2:101492275-101492297 CTGCGTAGAAACATGGAGCATGG - Intergenic
935287423 2:101578099-101578121 GTGAGGAGAGACAGGGAGGAAGG + Intergenic
935448337 2:103180315-103180337 CAGAGGGGAAGCCGGGAGGAGGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937311335 2:120905202-120905224 CTGCAAAGAAGAAGGGAGGGAGG + Intronic
937899960 2:127012278-127012300 CTGGGGAGTGGCAGGGAAGAGGG + Intergenic
937922251 2:127138615-127138637 CTGGGTGGAACCAGGGAGGAGGG - Intergenic
938000553 2:127731963-127731985 CTCCTGAGAAGCTGGGAGCATGG - Intronic
938100180 2:128493124-128493146 CTGGGCAGGAGCAGGGTGGACGG - Intergenic
938337310 2:130511363-130511385 CTGAGGAGCAGCAGGGAGGGAGG - Intergenic
938352528 2:130609372-130609394 CTGAGGAGCAGCAGGGAGGGAGG + Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
938593978 2:132767820-132767842 CTCCGGGGAAGAATGGAGGAAGG + Intronic
938919825 2:135985331-135985353 CTGCGCCGAGGGAGGGAGGAGGG - Intronic
940191668 2:151047117-151047139 CTGTGGAGCAGCAGGTGGGATGG - Intronic
940918975 2:159286813-159286835 CTGTGGAGACCCAGGGCGGAGGG + Intergenic
942089101 2:172471351-172471373 CTTCTGAGCAGGAGGGAGGACGG - Intronic
942301012 2:174562460-174562482 AAGGGAAGAAGCAGGGAGGAGGG + Exonic
942446759 2:176083294-176083316 CCGCGGAGGAGCAAAGAGGATGG + Intronic
942946591 2:181680655-181680677 GTGGGGAGAAGTGGGGAGGAGGG - Exonic
944606811 2:201359086-201359108 CTGAGGAGCAGCAGTGGGGATGG + Intergenic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
944893655 2:204142650-204142672 CAGCAGAGGATCAGGGAGGAGGG - Intergenic
946044534 2:216810399-216810421 CTGCAGGGAAGCTGGAAGGATGG + Intergenic
946121360 2:217517919-217517941 CTGCTGAGAAGAAATGAGGATGG + Intronic
947702484 2:232246130-232246152 CAGCAGAAGAGCAGGGAGGATGG + Intronic
947993101 2:234502545-234502567 CTACAGTGCAGCAGGGAGGATGG + Intergenic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948384869 2:237575095-237575117 CTGCAGAGAAGCGACGAGGAGGG - Exonic
948479913 2:238242844-238242866 CTGCTGTGAAGGAGGGAGGGAGG - Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948678046 2:239610651-239610673 ATGCAGGGAGGCAGGGAGGAGGG + Intergenic
948717448 2:239874451-239874473 GTGCCGTGAAGCAGGAAGGAGGG - Intergenic
948772241 2:240257579-240257601 CTGCGGGGAAGCTGGGTGGACGG - Intergenic
948995475 2:241576158-241576180 CTGCAGGGAAGGAGGGTGGAGGG - Intergenic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1169328552 20:4697758-4697780 CAGGGGAGGAGCAGGGAGGCTGG + Intronic
1169402589 20:5295624-5295646 CTGTGGAGAAACAAAGAGGATGG - Intergenic
1169425632 20:5495149-5495171 AGGAGGAGCAGCAGGGAGGAGGG + Intergenic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1170142513 20:13139090-13139112 AGGAGGAGAAGGAGGGAGGATGG - Intronic
1171849651 20:30299514-30299536 CTGTGGAGGAGCTGGGAGGTGGG - Intergenic
1171854748 20:30333888-30333910 CTTGGGAGAAGCAGGGACGGGGG + Intergenic
1171974922 20:31588150-31588172 CTGGGGAGAAGCAGGAGGGGCGG - Intergenic
1172630965 20:36377952-36377974 CCGAGGAGTAGCAGGGTGGACGG - Intronic
1172969156 20:38861001-38861023 ATGGGGAGAATCAGGGAAGATGG - Intronic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173401948 20:42733832-42733854 CTGGGGAGAAGCAGGCACGAGGG + Intronic
1173620477 20:44432017-44432039 CTGCGGTAAGGCAGGGAGGCTGG + Exonic
1173656950 20:44705986-44706008 CTGAAGAGAGGCAGGGAGGGAGG - Intergenic
1174563936 20:51451245-51451267 CTGCTGAGACGCAGAGGGGAAGG + Intronic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1174935969 20:54869073-54869095 CTGGGGTGCAGCAGGTAGGATGG - Intergenic
1175118961 20:56703644-56703666 CTGTGGAGGAGCTGGGAGGGTGG + Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175515379 20:59566779-59566801 CCGGGGTGCAGCAGGGAGGAGGG - Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1175924777 20:62466321-62466343 CTGGGGAGGAGCGGGCAGGATGG - Intronic
1176087489 20:63304608-63304630 CTGCGCAGCTGGAGGGAGGAAGG - Intronic
1176186406 20:63782321-63782343 CAGCAGAGAAGGAGGCAGGAGGG + Intronic
1176550624 21:8219306-8219328 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1176569554 21:8402347-8402369 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1176577466 21:8446576-8446598 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178438257 21:32578312-32578334 CAGTGCAGAAGCAGGGAGCACGG + Intronic
1178809402 21:35867621-35867643 TTGAGAAGAAGCAGGGAGGTGGG + Intronic
1178900203 21:36592435-36592457 ATGGAGAGAAGCAGGGAGTAGGG - Intergenic
1179397624 21:41056119-41056141 CAGCTCAGAAGCAGGGAGGCTGG + Intergenic
1179480963 21:41678401-41678423 CGATGGAGAAGCAGGGAGGCAGG - Intergenic
1179801784 21:43814649-43814671 CTGCGGAGAGGGAGGGAGCCAGG + Intergenic
1180013435 21:45066744-45066766 CAGCAGAGCAGCAGGGAGAAGGG + Intergenic
1180220265 21:46354205-46354227 CCGCGGAGCAGCAGTGAGGTCGG - Intronic
1180762258 22:18219801-18219823 CTGCGGGGAGGCGGGGAGGCGGG + Intergenic
1180773409 22:18404807-18404829 CTGCGGGGAGGCGGGGAGGCGGG - Intergenic
1180804760 22:18654356-18654378 CTGCGGGGAGGCGGGGAGGCGGG - Intergenic
1180805984 22:18715054-18715076 CTGCGGGGAGGCGGGGAGGCGGG + Intergenic
1180818224 22:18806482-18806504 GTGGGGAGAAGTGGGGAGGATGG + Intergenic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1181192505 22:21151740-21151762 CTGCGGGGAGGCGGGGAGGCGGG - Intergenic
1181204447 22:21240937-21240959 GTGGGGAGAAGTGGGGAGGATGG + Intergenic
1181216934 22:21340835-21340857 CTGCGGGGAGGCGGGGAGGCGGG + Intergenic
1181256253 22:21564755-21564777 CTGTGGAGAATTACGGAGGAAGG - Intronic
1181636970 22:24178964-24178986 CAGCTGAGAGGCTGGGAGGAGGG + Intergenic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1181978909 22:26752378-26752400 CTGCTGAGATGCAGGAAGGTGGG + Intergenic
1182042300 22:27247808-27247830 CTGCCTAGAAGCAAGGAGGCTGG + Intergenic
1182083184 22:27543521-27543543 GAGCAGAGAAACAGGGAGGAGGG - Intergenic
1182477027 22:30581936-30581958 CTTCGGAGCAGCAGGGACCAGGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183257375 22:36771165-36771187 CAGCCCAGAAGCAGGGAGGAGGG - Intronic
1183295844 22:37029190-37029212 CAGCAGGGGAGCAGGGAGGAGGG - Intronic
1183307500 22:37090400-37090422 ATGAGGAGAAGAAGGGATGAGGG + Intronic
1183325361 22:37188398-37188420 CTGCGGAGATAAAGGGAGGCAGG + Intronic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1183641425 22:39095246-39095268 AGGCTGAGAAGCAGGGAGGATGG - Intergenic
1183687468 22:39369477-39369499 CAGAGGACCAGCAGGGAGGAAGG - Intronic
1184186555 22:42868890-42868912 CTGCAGAGAAACAGGCAGAACGG - Intronic
1184617646 22:45648780-45648802 CTGCGGATGAGCAGGGCGGAAGG - Intergenic
1184730283 22:46367903-46367925 GTGCAGAGAGGGAGGGAGGAAGG - Intronic
1185132834 22:49049697-49049719 GTGCTGAGAAGGAGGGAGGGAGG + Intergenic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1203222478 22_KI270731v1_random:54478-54500 GTGGGGAGAAGTGGGGAGGATGG - Intergenic
1203235239 22_KI270731v1_random:145789-145811 CTGCGGGGAGGCGGGGAGGCGGG - Intergenic
1203255523 22_KI270733v1_random:135649-135671 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1203268354 22_KI270734v1_random:32336-32358 GTGGGGAGAAGTGGGGAGGATGG + Intergenic
950131644 3:10551296-10551318 CTGCAGTGAAGCAGGTAGTATGG + Intronic
950132737 3:10558440-10558462 CTTCTGAGAAGGTGGGAGGAGGG + Intronic
950478455 3:13228877-13228899 CTGAGGTGAAGCAGTGTGGAAGG - Intergenic
952258886 3:31720334-31720356 CTTGGGAGATACAGGGAGGAAGG + Intronic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
953546521 3:43867515-43867537 CTGCGGAGAAGCAAGGGTGGGGG + Intergenic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954305689 3:49724172-49724194 CCGCGGCGAAGCAGGGAACAAGG - Intergenic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954653365 3:52178693-52178715 CTGAGGAGCAGCAGGCAGAAGGG + Intergenic
955407812 3:58636421-58636443 CTGCAGAGGACCAGAGAGGATGG + Intronic
955421594 3:58743704-58743726 CTGCCTAGAGGAAGGGAGGATGG + Intronic
955798487 3:62662204-62662226 AAGCTGAGAAGCAGAGAGGAGGG - Intronic
956166003 3:66398704-66398726 CTGCGCAGCAGGAGGGGGGAGGG + Intronic
956168809 3:66416754-66416776 CAGAGGAGATTCAGGGAGGATGG - Intronic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
960915806 3:122693716-122693738 CTCCTGAGTAGCTGGGAGGACGG - Intronic
960993213 3:123325060-123325082 CTGCCAAGAGGGAGGGAGGAAGG + Intronic
961333503 3:126156628-126156650 CTGCTGAGAGGCAGGGTGGCAGG - Intronic
961685836 3:128630120-128630142 CTGGGCAGCAGCAGGAAGGATGG + Exonic
961830030 3:129618640-129618662 TTGAGGAGAGGAAGGGAGGAGGG - Intergenic
962769691 3:138600905-138600927 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962769701 3:138600930-138600952 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962832772 3:139158843-139158865 TTGGGCAGAGGCAGGGAGGAGGG + Intronic
963237499 3:142970271-142970293 GTGCGGAGAGGGAGGGAGGTTGG - Intronic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
965023095 3:163260610-163260632 GTGGGGGGAAGCAGGGAGGGAGG - Intergenic
967007750 3:185400239-185400261 GTGCGCAGACGCAGGGAGGCGGG - Intronic
968457677 4:707234-707256 CTGGGAAGAATCACGGAGGAGGG + Intronic
968604268 4:1524432-1524454 GTGATGAGAAGCCGGGAGGACGG - Intergenic
968604284 4:1524525-1524547 GTGATGAGAAGCCGGGAGGACGG - Intergenic
968940545 4:3635261-3635283 GTGCTGAGAAGCAGGGAGCGAGG + Intergenic
969227896 4:5811108-5811130 GTGCTGAGAGGCAGCGAGGACGG + Exonic
969230447 4:5826781-5826803 CTGCAGAGAAGGAGGGAGCCAGG - Intronic
969362669 4:6674476-6674498 GTGCGCCGAAGCAGAGAGGAAGG + Intergenic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
970360134 4:15300994-15301016 CTTCTGAGAAGCAGAGTGGAGGG - Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972691973 4:41407725-41407747 ATGATGAGAAGCAGGCAGGAAGG - Intronic
974020474 4:56688090-56688112 ATGAGGAGAAGAAGGAAGGAAGG + Intergenic
976612677 4:87046045-87046067 CTGGGAAGAAGCAGTGATGACGG - Intronic
976889647 4:90031263-90031285 CTCCGGAGAAGTAAGGAAGAAGG + Intergenic
976943751 4:90739009-90739031 CTGCTTAGAAGAAGAGAGGAAGG - Intronic
976988717 4:91336052-91336074 CTGCTGAGAAGAAAGGAGGAGGG + Intronic
978360039 4:107921719-107921741 CCACGGACCAGCAGGGAGGAGGG + Intergenic
979291611 4:118984632-118984654 CTGAGGTGAAGCTGGAAGGAAGG - Intronic
980967996 4:139542233-139542255 CTGGGGAGTAGAAGGCAGGAGGG + Intronic
981259355 4:142701280-142701302 CTGTGGAGAGGCTGGCAGGAGGG - Intronic
981525036 4:145700285-145700307 CTCCAGAAAAGCAGGGAGGGGGG - Intronic
982085351 4:151829955-151829977 CTGCAAAAAAGCAGCGAGGAAGG + Intergenic
983993986 4:174158954-174158976 CTATGGAAAAGCAGGGAGAAGGG + Intergenic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985280653 4:188282982-188283004 CTGCGGAGGAGAACGGAGAACGG - Intergenic
985548790 5:523044-523066 CTGCGGAGAAGGGAGGAGGCGGG + Intronic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986016437 5:3761521-3761543 CCACGGAGATGGAGGGAGGAGGG - Intergenic
989165378 5:38428678-38428700 CTGCAGAGAGGCAGTGTGGAGGG - Intronic
990449598 5:55922273-55922295 CTGGGGAGAAGCAAGGGGCAGGG + Intronic
990659366 5:57995889-57995911 CTGCTAAGAAGCACAGAGGAGGG + Intergenic
991261256 5:64670824-64670846 CTCAGGTGAAGCAGGGAGCATGG - Intergenic
993500378 5:88660399-88660421 CTGCGGGGAAGCTGGGTGGGGGG - Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
995114249 5:108461232-108461254 CTGGAGAAAAGCAGGTAGGAGGG - Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995512155 5:112921109-112921131 CTGCGGGGAGGAATGGAGGAAGG + Intronic
996088745 5:119329992-119330014 CATTGGTGAAGCAGGGAGGAAGG - Intronic
997195609 5:131977225-131977247 CTGCCAAGGAGCAGGCAGGAAGG - Intronic
997872455 5:137517374-137517396 TTCAGGAGAAGCAGGGATGATGG + Intronic
997872482 5:137517499-137517521 CTCAGGAGAAGCAGGGATGATGG + Intronic
998208373 5:140175434-140175456 CTGGGGAGGGGCAGGGAGGCAGG + Intronic
998352123 5:141508673-141508695 ACACGGAGAAGCAGGGAGAAGGG - Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998483136 5:142479584-142479606 CTGAGGAGAAGCAGGAATTAAGG + Intergenic
998490739 5:142544426-142544448 TTGTGGAGTAGCAGGGAGGCTGG + Intergenic
998855174 5:146387732-146387754 TTGAGGAGAAGAAGGAAGGAGGG - Intergenic
999268154 5:150280473-150280495 CAGCAAAGAAGAAGGGAGGAAGG - Intronic
1000172476 5:158716119-158716141 TTTCACAGAAGCAGGGAGGAGGG + Intronic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1001213404 5:169832419-169832441 GTGGGGAGAAGCAGAGATGATGG + Intronic
1001226111 5:169946002-169946024 ATGCAAGGAAGCAGGGAGGAGGG - Intronic
1001407909 5:171488873-171488895 CTCCTGGGAAGCAGTGAGGAGGG + Intergenic
1001465803 5:171965017-171965039 ATGCAGAGAAGTAGGCAGGAAGG + Intronic
1002052346 5:176578144-176578166 CTGCAGAGAGGCAGAGAGGTGGG - Intronic
1002058534 5:176612469-176612491 CAGTGGAGAAGCGGGGTGGAAGG + Intergenic
1002270226 5:178066962-178066984 TGGGAGAGAAGCAGGGAGGAAGG + Intergenic
1002594226 5:180311944-180311966 CTGCTGAGGACCAGGGAGGCAGG + Intronic
1002806641 6:582556-582578 CTCCGCAGACGCAGGCAGGATGG + Intronic
1003004312 6:2366970-2366992 CTGTGGAAAAGCAGGGGGCAGGG - Intergenic
1003147250 6:3518721-3518743 CATGGGAGGAGCAGGGAGGATGG + Intergenic
1003909791 6:10732881-10732903 TTGCAGAGAAGCAGGGACAAGGG - Intergenic
1003912859 6:10758474-10758496 TTGCAGAGAAGCAGGGATGAGGG - Intronic
1004163927 6:13239044-13239066 CTGTGGAGGAGCAGGGAGTGGGG + Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005968249 6:30742473-30742495 CTGCCGAGAAGCAGGGAGAGAGG - Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006420585 6:33931402-33931424 GTGGGGAGAAGCAGGGAAGGAGG + Intergenic
1006672829 6:35740279-35740301 CAGCAGGAAAGCAGGGAGGATGG - Intronic
1006881273 6:37342049-37342071 GTGGGGAGAAGTAGGGAGGTGGG - Intergenic
1007487868 6:42194828-42194850 CTGAGGAGCATCAGGGAGCAAGG + Exonic
1007652037 6:43428749-43428771 CTGCCGAGAAGATAGGAGGACGG + Intronic
1008551377 6:52635228-52635250 AAGCGGGGAAGCAGGAAGGAAGG - Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1012549450 6:100454011-100454033 CTGCTGAGAAGCTGACAGGACGG - Intronic
1013173533 6:107658438-107658460 CTGGGGAGAAGCAGAGATGGTGG - Exonic
1013348132 6:109282071-109282093 AAGAGGAGAAGCAGGGAGAAGGG - Intergenic
1013678383 6:112492885-112492907 CTGTGGAGAATCTGGGAGAAGGG + Intergenic
1014177924 6:118350296-118350318 CAGAGAAGAAGCAGGGAGCAGGG + Intergenic
1014793252 6:125699285-125699307 CTCCAGAGAGGAAGGGAGGAGGG + Intergenic
1015118518 6:129675891-129675913 TTGCGGACAAGAATGGAGGAGGG - Intronic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015440497 6:133241550-133241572 CGGGGGAGAAGCGGGGCGGAGGG - Exonic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1016428063 6:143955472-143955494 ATGTGGAGATGCAGTGAGGAGGG + Intronic
1016942087 6:149490857-149490879 CAGAGGAGACGCAGGGAAGAAGG + Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1018313757 6:162536535-162536557 CTACAGACAAGCAGGGAAGATGG - Intronic
1018362729 6:163087817-163087839 CAGAGGAGAGGCAGTGAGGATGG + Intronic
1018400269 6:163414436-163414458 CGCCGGGGAGGCAGGGAGGAGGG + Intronic
1018846437 6:167560087-167560109 CTGCAGAGATGCTGGGAGAAGGG - Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1019484890 7:1284916-1284938 CAGGGGACAAGCAGGGAGAAGGG + Intergenic
1019563151 7:1667740-1667762 CGGCGGTGAAGCTGGGAGGTTGG - Intergenic
1020073956 7:5245404-5245426 CTGCTGGCAAGCATGGAGGACGG + Intergenic
1022474684 7:30702089-30702111 CTGAGCAGAAGCAGGGAGCAAGG + Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1023301592 7:38778408-38778430 GGGCGGTGAAGCAGGGAGCAGGG + Intronic
1023368516 7:39489204-39489226 CTGCAGAGGAGCAGGGAAGGAGG - Intronic
1023601428 7:41885252-41885274 TCCTGGAGAAGCAGGGAGGAGGG + Intergenic
1024054336 7:45649991-45650013 CTGGGCAGAAGCAGGAAGGAAGG + Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024969300 7:55054000-55054022 CTACGGAGAGGGAGGGAGGGAGG - Intronic
1025235814 7:57234272-57234294 CTGGGGGGACGCAGGCAGGAGGG + Intergenic
1026597051 7:71742046-71742068 GTGCGGAAAAGAAGGAAGGAAGG - Intergenic
1027234022 7:76287222-76287244 CTGCGGAGAAAGAGGGAGGGGGG - Exonic
1027512907 7:79105578-79105600 CAGCTGAGAAGCAAGTAGGATGG - Intronic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1028514402 7:91660415-91660437 CAGAGTAGAAGCAGTGAGGAAGG + Intergenic
1029531363 7:101127399-101127421 CTGCAGGAGAGCAGGGAGGATGG + Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1031296504 7:120010440-120010462 CTGGGGAGAGGCAGGAGGGAAGG - Intergenic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032507530 7:132446929-132446951 GTGGGGAGAGGAAGGGAGGATGG - Intronic
1033129751 7:138735592-138735614 CTGCTGGGAAGCGGGGAGAAGGG + Intronic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033453679 7:141483398-141483420 CTGAGAAGAAGCAGAGAGAAAGG - Intergenic
1033586816 7:142780388-142780410 CTCAGGAGATGCAGGGAGGAAGG - Intergenic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034398620 7:150846735-150846757 CTGGGGAGATGCAGGGCGCAGGG - Intronic
1034433517 7:151052322-151052344 CTGAGGAGAAACAGGCAGGAGGG + Intronic
1034563204 7:151894724-151894746 GGGCAGAGGAGCAGGGAGGATGG - Intergenic
1034563251 7:151894876-151894898 GGGCGGAGGAGCGGGGAGGATGG - Intergenic
1034563322 7:151895114-151895136 GGGCGAACAAGCAGGGAGGACGG - Intergenic
1035090288 7:156304805-156304827 ATGCTAAGAACCAGGGAGGAAGG + Intergenic
1035221454 7:157408806-157408828 TTGCGGGGAAGCGAGGAGGATGG + Intronic
1035332623 7:158106217-158106239 CTGCGGGGAAGCTAGGTGGATGG - Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035412544 7:158656667-158656689 ACGCTGAGAAGCCGGGAGGAGGG - Exonic
1035415826 7:158684912-158684934 GTGCAGAGGAGCAGAGAGGATGG + Intronic
1035564584 8:632980-633002 ATGCCGAGACGCAGGGAGGGAGG + Intronic
1036748553 8:11428247-11428269 CTGTGGGGTAGCAGGAAGGAAGG + Intronic
1037034008 8:14143779-14143801 CTGCAGAGATGTAGGGAGGGTGG - Intronic
1037645567 8:20789793-20789815 CTGCGGGGATTCAGGAAGGAGGG - Intergenic
1037748276 8:21663340-21663362 CTGCAGAGGAGCTGGGAGCAGGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038266940 8:26045241-26045263 GTGGGGAGGAGCAGGGAGGGGGG - Exonic
1038311502 8:26449330-26449352 GTGCGGAGGAGGGGGGAGGACGG + Intronic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1040701321 8:50069698-50069720 CTGGGGAGAAGTCAGGAGGAAGG - Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1044294502 8:90511630-90511652 CTCCTGAGCAGCAGGTAGGAAGG + Intergenic
1044694755 8:94911680-94911702 CAGCTGAGAAGCAGGAAGGAAGG + Intronic
1044791301 8:95849772-95849794 CAGGGGAGAAGCAGGAATGAAGG + Intergenic
1045500172 8:102738697-102738719 CAGTGGAGAAGCAAGAAGGAGGG + Intergenic
1045737785 8:105317973-105317995 CTGCCAAGAAGCTGGGAGGGCGG + Intronic
1045796420 8:106050466-106050488 CTGCTGGGACCCAGGGAGGAGGG - Intergenic
1045855690 8:106762950-106762972 CTGGGGAGAAAAAGGGAGGGTGG - Intronic
1047258243 8:123233141-123233163 CTCCGGAGTAGCTGGGATGACGG + Intronic
1047329851 8:123876979-123877001 ATGCAGAGAAGCACAGAGGAGGG - Intronic
1047343479 8:124005033-124005055 CTGAGCAGATGCAGGTAGGAAGG - Intronic
1047521816 8:125600758-125600780 TTGGGGAGCAGAAGGGAGGAGGG + Intergenic
1048152501 8:131907842-131907864 GTGGGTAGAAGAAGGGAGGAAGG - Intronic
1048305727 8:133283246-133283268 CGGCGGAGAAGCAGGCATGCAGG + Intronic
1048364929 8:133730254-133730276 CTGCGGAGGAGGGTGGAGGAAGG + Intergenic
1049088273 8:140494462-140494484 CTGAGGAGCAGCCTGGAGGAAGG - Intergenic
1049126439 8:140793442-140793464 GTGCCTAGAATCAGGGAGGAAGG + Intronic
1049356711 8:142192749-142192771 AGGGGGAGGAGCAGGGAGGAGGG + Intergenic
1049356756 8:142192896-142192918 AGGGGGAGGAGCAGGGAGGAGGG + Intergenic
1049406731 8:142454962-142454984 ATGCAGGGAAGGAGGGAGGAGGG - Intronic
1049828605 8:144685764-144685786 CGGCGGAGCAGCAGAGAGGCCGG - Intergenic
1049944906 9:584916-584938 TTGAGGAGAAACTGGGAGGAAGG - Intronic
1049998697 9:1053289-1053311 CTGCTGTGAAGCAGTGAGGCCGG - Intronic
1050099186 9:2100086-2100108 CTGCAGGGATCCAGGGAGGAGGG + Intronic
1050747393 9:8892173-8892195 CTGAGGAAAAGCAGCGTGGATGG - Intronic
1052273595 9:26653365-26653387 CTGAGGAGCAGCATGAAGGACGG + Intergenic
1052903778 9:33817149-33817171 GAGCCGAGAAGCAGGGAGGGAGG - Intergenic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053534541 9:38912863-38912885 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053792570 9:41697169-41697191 CTTGGGAGAAGCAGGGACGAGGG + Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1054152605 9:61617651-61617673 CTTGGGAGAAGCAGGGATGAGGG - Intergenic
1054180983 9:61909190-61909212 CTTGGGAGAAGCAGGGATGAGGG + Intergenic
1054206760 9:62137283-62137305 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1054472382 9:65548799-65548821 CTTGGGAGAAGCAGGGACGAGGG - Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1054631592 9:67451064-67451086 GAGCAGAGAAGCTGGGAGGAAGG + Intergenic
1054656608 9:67671952-67671974 CTTGGGAGAAGCAGGGATGAGGG - Intergenic
1055791922 9:79931580-79931602 CTGGAGAGAGGCAGGGTGGAGGG + Intergenic
1055951464 9:81733542-81733564 GTGCCGAGAGGCAGAGAGGAGGG + Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057698894 9:97348821-97348843 CAGCTGAGTAGCAGGCAGGATGG - Intronic
1057895419 9:98904948-98904970 CTACAGAGAGGCAGAGAGGAGGG + Intergenic
1057909413 9:99005971-99005993 CTGCTGAGAGGCAGAGAGGACGG - Intronic
1057943257 9:99303299-99303321 CTGGGGAGGAGCAGGAAGGATGG + Intergenic
1058048902 9:100386937-100386959 CTTGGGGGAAACAGGGAGGAGGG + Intergenic
1058424463 9:104864389-104864411 CTTGGGAGAAACAGGAAGGAAGG + Intronic
1059429218 9:114240197-114240219 CTGAGGGGAAGCAGAGAGCAGGG - Intronic
1060529830 9:124341666-124341688 CTGTGGAGAGACAGGGAGGCAGG - Intronic
1060536134 9:124389596-124389618 CTGTGGAGAGACAGGGAGGCAGG + Intronic
1060658579 9:125389282-125389304 CTGAGGAGGAGCAGGTAGGGTGG - Intergenic
1060754932 9:126205869-126205891 TGTCTGAGAAGCAGGGAGGATGG - Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061482987 9:130906351-130906373 CCGGGGAGAGGCAGGCAGGAGGG - Intronic
1061953382 9:133948962-133948984 CTGCGGACAACCTGGGAGGAGGG + Intronic
1061954639 9:133955416-133955438 GTGGGGAGAAGCAGGGGGGTGGG - Intronic
1062332544 9:136051024-136051046 CAGCGGGGAAGGAGGGAGGGAGG + Intronic
1062607686 9:137355401-137355423 CTGCCCTGAGGCAGGGAGGAAGG + Intronic
1203471919 Un_GL000220v1:118784-118806 GTGCGGAGGAGCGAGGAGGAAGG - Intergenic
1185446535 X:260881-260903 CTCCGGAGTAGCTGGGATGACGG - Intergenic
1186461579 X:9752598-9752620 CTGCAGAGAACCAGAGAGGAGGG + Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187163817 X:16786808-16786830 CGGCGGGGAAGCCGGGAGGGAGG + Intronic
1188705685 X:33326768-33326790 CTGGAGAGAAGCAAGAAGGAAGG + Intronic
1189197654 X:39165746-39165768 GTGGGGAGGAGCAGTGAGGAGGG - Intergenic
1189310154 X:40013053-40013075 GGCCGGAGAAGCTGGGAGGAAGG - Intergenic
1189395842 X:40622069-40622091 CCGCGGAGAAGCTGCGAGGATGG - Intergenic
1189418153 X:40832734-40832756 ATGCGGAGGAGCATGGCGGAGGG - Intergenic
1189443409 X:41057954-41057976 CTGCGGAGTAGCTGGGATTACGG - Intergenic
1189752928 X:44241114-44241136 CTGGGGAGAAGCAGTGATAAAGG - Intronic
1190198082 X:48336732-48336754 CGGTGGAGCAGCATGGAGGAGGG + Intergenic
1190509660 X:51162594-51162616 CAGAGGAGGAGCAGGGAGGAAGG - Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1192204220 X:69085637-69085659 CTCCAAAGCAGCAGGGAGGAAGG + Intergenic
1192314597 X:70042088-70042110 CTGCTCAGAGGCAGGGAGGCTGG - Intronic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1194209015 X:91046386-91046408 GACAGGAGAAGCAGGGAGGATGG + Intergenic