ID: 901512549

View in Genome Browser
Species Human (GRCh38)
Location 1:9724683-9724705
Sequence GCCCTTGCCCTGATAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 87}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512549_901512562 16 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512562 1:9724722-9724744 GGGGCTGGTTGGATGCAGAGCGG 0: 1
1: 0
2: 3
3: 39
4: 377
901512549_901512554 -10 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512554 1:9724696-9724718 GGGCAAGGGCAGGTGTCCTTGGG 0: 1
1: 0
2: 0
3: 28
4: 286
901512549_901512556 -5 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512556 1:9724701-9724723 AGGGCAGGTGTCCTTGGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 570
901512549_901512559 1 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512559 1:9724707-9724729 GGTGTCCTTGGGGAAGGGGCTGG 0: 1
1: 0
2: 2
3: 66
4: 629
901512549_901512560 5 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512560 1:9724711-9724733 TCCTTGGGGAAGGGGCTGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 459
901512549_901512555 -9 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512555 1:9724697-9724719 GGCAAGGGCAGGTGTCCTTGGGG 0: 1
1: 0
2: 2
3: 43
4: 314
901512549_901512557 -4 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512557 1:9724702-9724724 GGGCAGGTGTCCTTGGGGAAGGG 0: 1
1: 0
2: 2
3: 43
4: 390
901512549_901512558 -3 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512558 1:9724703-9724725 GGCAGGTGTCCTTGGGGAAGGGG 0: 1
1: 0
2: 4
3: 65
4: 479
901512549_901512563 24 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512563 1:9724730-9724752 TTGGATGCAGAGCGGCCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512549 Original CRISPR GCCCTTGCCCTGATAATGGG TGG (reversed) Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901779946 1:11587307-11587329 TCCCCTGTCCTGATAAGGGGAGG - Intergenic
902291468 1:15438321-15438343 GCCCTTTCCCTGACCTTGGGTGG - Intergenic
910527611 1:88198697-88198719 GACCTTCCCCTGAGAATGAGAGG - Intergenic
919388791 1:196955179-196955201 GCCCCTGCCCTGAAGATGTGTGG - Intronic
919861682 1:201742872-201742894 GCCCCTGCCCTGAGCTTGGGAGG + Intronic
924825220 1:247531690-247531712 GAACTTGCCCTGCTCATGGGAGG + Exonic
1073248642 10:102108343-102108365 GCCCTTGCCCCGATTATGTTTGG - Intronic
1076733697 10:132449924-132449946 GGCCTTTCCCAGGTAATGGGAGG + Intergenic
1078895145 11:15591295-15591317 GCCCTTGCTCTGATAAGGGAGGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083488315 11:62997067-62997089 GCCCTTGCCATGGTTTTGGGAGG - Intronic
1084731296 11:71075411-71075433 GCGCTTGCCCAGATGGTGGGTGG - Intronic
1087022105 11:93613635-93613657 GCCCTTGCCCTACTAATCAGGGG - Intergenic
1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG + Exonic
1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG + Exonic
1097020940 12:56020619-56020641 GGCCTTGTCCTGATAGAGGGCGG + Intronic
1102930616 12:116859387-116859409 GCCCCTCCCCAGAAAATGGGGGG + Exonic
1105533483 13:21242349-21242371 CCTCTTGCCTTGAAAATGGGTGG + Intergenic
1108361949 13:49676215-49676237 CCCCTTGCCCTCATGATGAGTGG - Intronic
1109323948 13:60845389-60845411 GCCTTTGCTCTGATGTTGGGTGG + Intergenic
1122531651 14:102431997-102432019 GCCCTTGCCCAGCTCAGGGGTGG - Exonic
1124924850 15:34061050-34061072 CACCTTGACATGATAATGGGCGG - Intronic
1125159585 15:36627745-36627767 GCCCTGGCCCTGGTGATGGTTGG - Intronic
1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG + Intergenic
1131981998 15:98003366-98003388 GCCCTTGACCTTATCATGAGGGG - Intergenic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG + Intergenic
1138045188 16:53715157-53715179 GGCTTTGCCCTGAAAATGGTTGG + Intronic
1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG + Intronic
1145816456 17:27798410-27798432 GAGCTTGGCCTGAGAATGGGAGG - Intronic
1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG + Exonic
1151542832 17:74773532-74773554 CCCCTAGCCCTGGTACTGGGAGG - Intronic
1152040165 17:77897818-77897840 GCCCCTGCTCTGACAAAGGGAGG - Intergenic
1152366159 17:79857772-79857794 GACCTGGCCCTGAGAATGTGGGG + Intergenic
1157224267 18:45848675-45848697 GCCCTGGCCCTGCTAATCCGGGG + Exonic
1162316192 19:9939599-9939621 GCCATTGCCCTGATACAGAGGGG - Intergenic
1163153284 19:15427287-15427309 GCCCTGGCCAAGATGATGGGCGG - Exonic
925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG + Intergenic
928170395 2:28999498-28999520 GCCCTTGACCTGGAAGTGGGTGG - Intronic
928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG + Intronic
928898915 2:36296994-36297016 GCCCGTGCCCTCATCCTGGGGGG + Intergenic
934754828 2:96817543-96817565 GCCCTCTCCCTGAAAAGGGGTGG + Intronic
937866184 2:126753230-126753252 GCCCATGCACTGAGCATGGGTGG - Intergenic
942577137 2:177375590-177375612 GACAGTGCCCTGATTATGGGGGG + Intronic
945509133 2:210678960-210678982 GTCCTTGCCCTTACAGTGGGTGG - Exonic
948302093 2:236915084-236915106 GGCCTTGACCTGACCATGGGAGG + Intergenic
1170812625 20:19686391-19686413 CCACCTGCTCTGATAATGGGTGG - Intronic
1172697347 20:36831754-36831776 GCCCTTGTTCTGATACTGAGGGG - Intronic
1174036382 20:47671009-47671031 GCCTGTGCCCTGAAAATGTGTGG - Intronic
1175236282 20:57514494-57514516 GTACTGGCCCTGATACTGGGAGG - Intronic
1177642020 21:23855712-23855734 GCCCATGCCCTGATGATGACAGG - Intergenic
1180796630 22:18608961-18608983 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG + Exonic
1181253538 22:21548503-21548525 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1183304736 22:37076539-37076561 GCCCATGCCCTGGAGATGGGAGG - Intronic
1203285728 22_KI270734v1_random:153536-153558 GCCCTGGGCCTGATGAGGGGTGG - Intergenic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
960004633 3:112769445-112769467 TCCCTTGCTCTCAGAATGGGGGG + Intronic
966759970 3:183408939-183408961 CACCTTGCCATGATAATGGGAGG + Intronic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
975445000 4:74453252-74453274 GTGCTTGCACTGATAATGTGAGG + Intronic
978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG + Intergenic
978415823 4:108474838-108474860 GCCATCCCCCTGATAATGAGTGG + Intergenic
982131635 4:152233967-152233989 GCCCTTGACCTGGAAATGGCTGG + Intergenic
982548706 4:156768679-156768701 ATCCTTCCCCTGCTAATGGGTGG + Intronic
982582544 4:157197165-157197187 TCCCTTGCCTTGCTAATAGGAGG + Intergenic
990777025 5:59314358-59314380 GCTCTTGGCCTTATAATGGTAGG + Intronic
1000504158 5:162093161-162093183 GCATTTGCCATGATAAAGGGTGG + Intronic
1003388774 6:5693983-5694005 CCTCTTGCCTTGAAAATGGGTGG - Intronic
1015516084 6:134083814-134083836 TCCCTTGCCCTGATACTGATGGG - Intergenic
1016974579 6:149794721-149794743 GCCTTTGCCCTGATCCTGTGTGG + Intronic
1022958719 7:35404611-35404633 GCCCTTGACCTGTTCATGTGAGG - Intergenic
1027201062 7:76064223-76064245 TCCCATGCCCTGGTGATGGGAGG + Intronic
1033962120 7:146928100-146928122 GTCATTGCCCTGATTATGAGAGG + Intronic
1041138762 8:54790215-54790237 GCCCATGCTCTGATGTTGGGTGG - Intergenic
1048289209 8:133167283-133167305 GGCCTTGCCCAGATAATAGTTGG - Intergenic
1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG + Intergenic
1056404604 9:86261692-86261714 GCCCTTGCCCCGCTAAAGGTTGG + Intergenic
1057547982 9:96032198-96032220 GGCCTTTCCCTGATGAAGGGAGG - Intergenic
1057804227 9:98209182-98209204 GCCCTTCCCTAGATAAGGGGTGG + Intronic
1058567546 9:106302661-106302683 GCCCATGCCATGAAAATAGGAGG + Intergenic
1060758943 9:126232824-126232846 TCCCTTGCCCTGAACTTGGGAGG - Intergenic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1062376420 9:136263887-136263909 GCCCTGGCCCTCACACTGGGAGG + Intergenic
1062707749 9:137954579-137954601 GGCCATGCCCTGAGAATGAGAGG - Intronic
1188399941 X:29731811-29731833 GCCCTTGCTGTCTTAATGGGTGG - Intronic
1191892759 X:65961542-65961564 TCCCTTGTCCTGTTATTGGGTGG + Intergenic
1201477844 Y:14403295-14403317 GCCATCGCCCTGATGATAGGAGG - Intergenic