ID: 901512554

View in Genome Browser
Species Human (GRCh38)
Location 1:9724696-9724718
Sequence GGGCAAGGGCAGGTGTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512544_901512554 -2 Left 901512544 1:9724675-9724697 CCTTGTGTCCACCCATTATCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 901512554 1:9724696-9724718 GGGCAAGGGCAGGTGTCCTTGGG 0: 1
1: 0
2: 0
3: 28
4: 286
901512549_901512554 -10 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512554 1:9724696-9724718 GGGCAAGGGCAGGTGTCCTTGGG 0: 1
1: 0
2: 0
3: 28
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512554 Original CRISPR GGGCAAGGGCAGGTGTCCTT GGG Intronic
900228202 1:1542623-1542645 GTGCCAGGGCAGGTGTGCCTAGG - Intronic
900381465 1:2386099-2386121 CGGGAAGGGCAGATGTGCTTTGG + Intronic
901494442 1:9613220-9613242 GAGGAGGGGCAGGTGTCCTGAGG - Exonic
901512554 1:9724696-9724718 GGGCAAGGGCAGGTGTCCTTGGG + Intronic
902722200 1:18311356-18311378 TGGCCAGGGCAGATGTGCTTGGG - Intronic
902878160 1:19353277-19353299 GGGCAAGGGCATGTGAGCGTGGG + Intronic
903121086 1:21217564-21217586 GGACACAGGCAGGTGTCCTAGGG - Intronic
903607945 1:24588787-24588809 GGCCAAGGGCAGGAGTAGTTGGG + Intronic
905052171 1:35061011-35061033 AGGCCATGGCAGGTGTCCATTGG - Intronic
905339644 1:37269707-37269729 GGTAAAGTGCCGGTGTCCTTAGG + Intergenic
906059146 1:42936933-42936955 GGGCATTGGCAGATGTCCTATGG - Intronic
907727731 1:57035462-57035484 GGGAAAGGAGAGGTGGCCTTTGG + Intronic
911035932 1:93547716-93547738 GGGCATGGGAAGGTTTCCTAAGG + Intronic
913075645 1:115338541-115338563 GGGCACCGGCAGGGGTCGTTGGG + Intergenic
913224448 1:116686775-116686797 GGACATGGGCAGAGGTCCTTAGG + Intergenic
915629023 1:157137931-157137953 GAGGAAGGGCAGGGGTCCTGTGG - Intronic
915846986 1:159276908-159276930 GGACAAGAGCAGGATTCCTTTGG + Intergenic
915885113 1:159713718-159713740 GGGCAGGAGCAGGATTCCTTCGG - Exonic
916262056 1:162851892-162851914 GGGGAAGGGCATGTGTCCGATGG - Intronic
916420626 1:164634711-164634733 GGGCAAGGTCAGGACTCCCTCGG + Intronic
917178189 1:172262219-172262241 GGGCAGTGGCATTTGTCCTTGGG + Intronic
918708326 1:187696327-187696349 GGGCCAGGGCAGGTGTGTTGGGG + Intergenic
919865375 1:201778246-201778268 GGGCAAAGGAAGGTTTCTTTTGG + Intronic
920216902 1:204367400-204367422 TGGGAAGGGAAGGTGTCCGTGGG - Intronic
920626122 1:207601944-207601966 GGGAGAGGCCAGCTGTCCTTTGG - Intronic
920660899 1:207913339-207913361 GGGCAAGGGTGTGTGTGCTTGGG - Intergenic
920964990 1:210694110-210694132 GGGCAAAGACAGGAGTCCTGAGG - Intronic
922613416 1:226946221-226946243 GGGCATGGCGAGGTGACCTTAGG + Intronic
923304421 1:232675118-232675140 GAGCAATGGCAGGTGCTCTTGGG - Intergenic
1062819908 10:527006-527028 GGGTAAGGGCAGCCGTCCTGGGG + Intronic
1063226179 10:4017013-4017035 TGGGAAGGGCCGGTGTCCCTAGG + Intergenic
1063929127 10:11011417-11011439 GGGAGAGGGAAGGTGTCATTAGG + Intronic
1065271645 10:24039198-24039220 TGGCTAGGGCAGCTGTCTTTAGG - Intronic
1067172823 10:43922092-43922114 GGGCAAGGGCAGGGGTGCCCTGG + Intergenic
1067185172 10:44021196-44021218 GGGGAAGCCCAGGGGTCCTTAGG - Intergenic
1067270263 10:44785618-44785640 GGTCAAGGGCACGTGACCTTGGG - Intergenic
1070599234 10:77854170-77854192 GGGCAAAGGCAGCTGTCTGTGGG + Intronic
1070923271 10:80202314-80202336 GGGCAAGGCCAGCTGTGGTTTGG + Intronic
1072485359 10:95849479-95849501 GGGCCAAGCCAGGTGACCTTAGG - Intronic
1073147396 10:101289799-101289821 GGGCCAGGGCACATGTCCTTAGG - Intergenic
1074530981 10:114298612-114298634 AGGCCAAGGCAGGTGTCCCTTGG + Intronic
1075030763 10:119023342-119023364 GCGGAAGGGCAGATGTCCCTGGG - Intergenic
1075688710 10:124380988-124381010 AGGCAGGGGCAGGTGTGCTGGGG + Intergenic
1076234429 10:128852702-128852724 CAGGAAGGGCAGGTGACCTTAGG + Intergenic
1076675718 10:132146556-132146578 GGGCAGGGACAGGTGTCCTGAGG + Intronic
1076701126 10:132273334-132273356 GGGCAACTGCAGGTGTCTGTGGG + Intronic
1076755829 10:132571133-132571155 GGGCCAGGGAAGGTGTCCAAAGG - Intronic
1077172913 11:1176374-1176396 GCGCATGGGCAGGGGTCCTCTGG - Intronic
1077412951 11:2411860-2411882 GGGCCAGGCCAGGACTCCTTGGG + Intronic
1077460691 11:2707889-2707911 GGGACAGGGCAGGTGTGCCTTGG + Intronic
1078047661 11:7931608-7931630 GAGCAAAGGCAGGTGACCTAGGG + Intergenic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1079138160 11:17788206-17788228 GGGGAAAGGTAGGTGACCTTGGG + Exonic
1081098994 11:38978393-38978415 GGGCAAAAGCAGGTCTCTTTTGG - Intergenic
1081852677 11:46284745-46284767 GCTCAAGGGCAGGAGTCCTATGG + Intronic
1082002660 11:47401806-47401828 GGGTAAGGACAGCTGTCCTTTGG - Intergenic
1083673930 11:64315145-64315167 GGGCACGGGCAGCTGGCCTGGGG + Exonic
1084268398 11:68016606-68016628 AGGCAGGGGCAGGTGTCCTGAGG - Intronic
1085306280 11:75487801-75487823 GGGCAAGGCCAGGTCACTTTTGG - Intronic
1085505258 11:77055144-77055166 GGGCAAGGGGAGGTGTCTATAGG - Intergenic
1085694175 11:78689893-78689915 GGGGAGGGGCCGGTGGCCTTTGG + Intronic
1085772580 11:79338476-79338498 GGGCAAGGGCAGAGGTCACTTGG - Intronic
1085881846 11:80476566-80476588 GGGTAAGGGCTGAGGTCCTTTGG + Intergenic
1086134058 11:83429373-83429395 GGGCAAGGGCAGGTTTGCAGTGG + Intergenic
1086944523 11:92831876-92831898 GTGCCAGGGGAGGTGTCCTCAGG - Exonic
1087757710 11:102073024-102073046 GCCCAAGGACAGGTGTGCTTTGG - Intronic
1089134994 11:116241901-116241923 GGGCAAGGGTATGGGTCCTGGGG - Intergenic
1089630802 11:119783039-119783061 AGGCAGGGGCAGGTGGCCCTGGG + Intergenic
1091306881 11:134541976-134541998 GGGAAAGGGCAGGTTCCTTTGGG - Intergenic
1093632600 12:21427499-21427521 GATCAAGTGTAGGTGTCCTTAGG + Intergenic
1096577571 12:52563101-52563123 GGGCAAGGGAGGTTGTCCTTGGG - Intergenic
1096864839 12:54556428-54556450 GGGCAAGGGCAGGGGCACTAAGG - Intronic
1098973412 12:76878717-76878739 GGACAAGGGCAGGTGTGTTTGGG + Intronic
1100793457 12:98155481-98155503 AGGCAAAGGCAGGTGTGCTGGGG - Intergenic
1100809672 12:98325492-98325514 GGGCCAGGGCAGGTGTGTGTGGG + Intergenic
1101795079 12:107965625-107965647 GGATAAAGGCAGTTGTCCTTGGG - Intergenic
1105344425 13:19560376-19560398 GGGCACGGGCAGCTGGCCTGGGG - Intergenic
1105535608 13:21261198-21261220 GGGCACGGGCAGCTGGCCTGGGG + Intergenic
1105881443 13:24609603-24609625 GGGGATGGGCAGGTATTCTTTGG + Intergenic
1107049976 13:36036393-36036415 GGGCAAAGCCAGGAATCCTTTGG + Intronic
1112181251 13:97083347-97083369 CCGTGAGGGCAGGTGTCCTTGGG - Intergenic
1113162047 13:107392611-107392633 GGTGATGGGCAGGTGTCTTTAGG + Intronic
1113908275 13:113830379-113830401 GGCCCAGGGCAGGTGGCCTGAGG - Intronic
1114219694 14:20685047-20685069 GGGCAAGTGCAGGCCTCCTAGGG - Intronic
1114336004 14:21690562-21690584 ACGCAAGTGCAGGTGTCCTTTGG - Intergenic
1116965813 14:51013998-51014020 AGTCAAGGGCAGATGTCATTTGG - Intronic
1119857111 14:77908962-77908984 GGGCTGGGGCAGGATTCCTTGGG + Intronic
1121438236 14:93932771-93932793 GGGAGAGTGCAGGTTTCCTTTGG + Intergenic
1121580794 14:95028018-95028040 GGGACAGGGCAGGTGTCCTGGGG + Intergenic
1121819317 14:96953573-96953595 GGGCAAGAGCAGGACTCATTTGG - Intergenic
1122051962 14:99066702-99066724 GGGCACTGGCAGGTGGCCCTGGG - Intergenic
1122769459 14:104091556-104091578 GGCCAAGGGCTGGTGTCCCGGGG + Intronic
1122793284 14:104193417-104193439 GGGCAGGGGCAGGTGGCCCAGGG - Intergenic
1123014703 14:105368136-105368158 GTGCAGGGGCAGGTGACCTGGGG + Exonic
1123888684 15:24752603-24752625 GGGCAAGGCCAGCTGTCCCCTGG + Intergenic
1124121072 15:26888975-26888997 AGGCACGGGCAAGTGACCTTGGG - Intronic
1125482338 15:40089216-40089238 GGGGAGGGGCAGGTCTCCTGAGG + Exonic
1127319329 15:57827126-57827148 GGGTCAGAGCAGGTGTCATTTGG - Intergenic
1127827595 15:62718626-62718648 GGTCCTGGGCTGGTGTCCTTCGG + Intronic
1129219275 15:74122029-74122051 TGGCAAGGGCAGCTGTCTCTGGG - Intronic
1129254509 15:74326580-74326602 GAGAAATGTCAGGTGTCCTTGGG - Intronic
1129330317 15:74823765-74823787 GGGCAAAGGCAGGAGGGCTTGGG - Intronic
1129671677 15:77611123-77611145 GGACAGGGGGAGGGGTCCTTGGG - Intergenic
1130551275 15:84891262-84891284 GGGCAATGGGAGAGGTCCTTGGG + Intronic
1130985436 15:88841907-88841929 GGGGAGGGGAAGGTGGCCTTGGG - Intronic
1132153056 15:99475869-99475891 GGGCAAGGGAAGGGGACCTCCGG - Intergenic
1132677081 16:1125279-1125301 GGGCAAGGCCAGGTCTCCATGGG - Intergenic
1133732795 16:8590569-8590591 GTGGAAGGGCAGGCGGCCTTGGG + Intergenic
1134244562 16:12530431-12530453 GTGCAAGGGTAGGTGTGCATGGG - Intronic
1134747677 16:16600617-16600639 GAGCAAAGGCAAGTGTCCTGGGG - Intergenic
1134997792 16:18753045-18753067 GAGCAAAGGCAAGTGTCCTGGGG + Intergenic
1135293619 16:21261027-21261049 ACTCAAAGGCAGGTGTCCTTAGG - Intronic
1136749116 16:32616987-32617009 GGGCACTGGAAGGTGACCTTGGG - Intergenic
1137323655 16:47411522-47411544 GGTCAAGGGCAGGGGACCTCTGG - Intronic
1137565486 16:49530208-49530230 CAGCAAGGGCAGATGTCCTGTGG - Intronic
1137706456 16:50539092-50539114 GGGGAAGGGCAGGAGTCATAAGG - Intergenic
1139853832 16:69965589-69965611 GGGCGGGTGCAGGTGTCCCTGGG + Intergenic
1139882810 16:70188502-70188524 GGGCGGGTGCAGGTGTCCCTGGG + Intergenic
1140369700 16:74407017-74407039 GGGCGGGTGCAGGTGTCCCTGGG - Intergenic
1141040912 16:80671479-80671501 GGGCAGGGGCTGGTGTGCTTAGG - Intronic
1141261705 16:82460222-82460244 GGGCAAGGGCAGGTGGCAAGTGG - Intergenic
1142007292 16:87695545-87695567 AGGCAGGGGCAAGTGTCCTCTGG + Intronic
1142131816 16:88434650-88434672 GTGGAAGGGCAGGTGACCCTGGG - Exonic
1142283193 16:89160126-89160148 GGGCAAGGGCAGGTGGGGTGGGG + Intergenic
1203051249 16_KI270728v1_random:876201-876223 GGGCACTGGAAGGTGACCTTGGG - Intergenic
1142592463 17:1012345-1012367 GGGAAAGGGCACGTGTCCCCCGG - Intronic
1143321552 17:6071789-6071811 GAGCTAGGGGAGGTTTCCTTGGG + Intronic
1143408975 17:6697069-6697091 GGGCAAGGCCGTGTGTCCTGAGG + Intronic
1144428530 17:15169151-15169173 GGGCAAGGCCAGGGGTGCTATGG - Intergenic
1144515957 17:15917701-15917723 AGGCAGGGGCAGGAGCCCTTCGG - Intergenic
1144653003 17:17018845-17018867 GCTCAGGGGCAGGTGTCCTCAGG + Intergenic
1146690398 17:34870912-34870934 GGGGTGGGGCAGGTTTCCTTTGG + Intergenic
1146692215 17:34884282-34884304 GGGCAAGGGCTGGAGACCTGTGG - Intergenic
1146893732 17:36526112-36526134 GGGCAAGGGCAGGTGTAGAGAGG - Intronic
1147374901 17:40017561-40017583 GGGGCAGGGCAGGTGTCCCGAGG - Exonic
1147415728 17:40288143-40288165 GGGAAAGGGCAGGTGCCCTCGGG + Intronic
1148093311 17:45035547-45035569 GGGCAAGGTCAGGTGCTGTTAGG + Intronic
1153234348 18:2971415-2971437 GGGAGAGGGCAGGGGGCCTTGGG - Intronic
1155804188 18:30145301-30145323 TGGCCAGGGTAGGTGTCTTTTGG - Intergenic
1157317402 18:46603857-46603879 GGGCAAAGGAAGGTATCCATAGG - Intronic
1157792262 18:50543107-50543129 TGAGAAGGGCAGGTGTGCTTGGG - Intergenic
1159357036 18:67349549-67349571 GGGAAAGGGCGGGTTTCTTTGGG + Intergenic
1160692844 19:467735-467757 GGGCCCGGGCTGGTGTCCTGAGG + Exonic
1161614829 19:5264238-5264260 AGGCAATGGCAGGTGTCCAGAGG - Intronic
1162209073 19:9077414-9077436 CGGCCAGGGCAGGTGTCTTCCGG + Intergenic
1162386232 19:10362033-10362055 GGGCAAGGGCAGGGCCCCTGGGG - Intronic
1163322524 19:16582967-16582989 GGGCAAGGGCAGGTGGTCTGTGG - Intronic
1163683902 19:18699897-18699919 GGGCCAGGGCAGGTGTCCCCCGG + Intronic
1165092614 19:33394872-33394894 GGGCAGGTGCAGGGGTGCTTCGG - Intronic
1165423302 19:35732786-35732808 GGGCCAGGGCACGCCTCCTTCGG + Exonic
1166053493 19:40274933-40274955 AGGGCAGGGCAGGAGTCCTTAGG + Intronic
1166081454 19:40446230-40446252 GGCCTAGGGAAGGTGTCCCTGGG + Intergenic
1167074797 19:47241432-47241454 GGGCAAGGGCAGGGGTGCGGGGG + Intergenic
925672411 2:6325552-6325574 GGGCAAAGGGAAGTGTCCCTGGG + Intergenic
927031144 2:19121753-19121775 GGGCAAGGGTGGGAGGCCTTTGG - Intergenic
927883591 2:26705563-26705585 GGGCAAGGGCACTTGTGGTTGGG - Intronic
928227031 2:29458912-29458934 AGGCAAAAGCAGGTGTTCTTGGG - Intronic
930843554 2:55875855-55875877 GGGCAGAGGCAGCTGTCCTGAGG + Intronic
931134843 2:59386746-59386768 GGCCAAGGGAATGTGTCCTATGG + Intergenic
931778226 2:65557814-65557836 AGCCCATGGCAGGTGTCCTTGGG + Intergenic
932593920 2:73082689-73082711 GGGACAGGGCAGGTGCTCTTAGG + Intronic
933791595 2:85888175-85888197 AGGCAAGGGCAGGGCTCCTCGGG + Intronic
936075486 2:109398956-109398978 GGGCCAGGGCAGGCATCCCTGGG + Intronic
938766411 2:134463080-134463102 AGGGAAGGGCAGGAGCCCTTGGG - Intronic
938843322 2:135183433-135183455 TGGGAAGTGCAGGTGTCCTTGGG - Intronic
938915004 2:135929200-135929222 AGTCAAGGGGAGGTGTCCTCAGG - Intronic
939885740 2:147679783-147679805 GGGAAAGAGCAGATGTTCTTAGG + Intergenic
940737406 2:157468938-157468960 TGGCAAGGGAAGGTGTAATTTGG + Intronic
940763637 2:157765987-157766009 GGGCAATGGCTGGTTTCCCTTGG + Exonic
942715624 2:178888423-178888445 GGACAGGGGCATGTCTCCTTAGG - Intronic
944365691 2:198916589-198916611 GGCTAACGGCAGGTGTCATTAGG + Intergenic
944668052 2:201972993-201973015 GGTCAGTGGCAGGTGGCCTTGGG - Intergenic
944966804 2:204944385-204944407 GGGCAAGGAGATGTGCCCTTTGG + Intronic
947107042 2:226678503-226678525 AAGCAAGGTCAGGTGTCCCTGGG - Intergenic
948283058 2:236763116-236763138 GGACAATGCCAGGTGTCCTGGGG - Intergenic
948567748 2:238897392-238897414 GTAAAAAGGCAGGTGTCCTTGGG - Intronic
948655810 2:239476109-239476131 AGGCAGGGGCAGGTGTGCTGAGG + Intergenic
1168874249 20:1159784-1159806 GGACAAGGCCAGGTTTCCTAGGG - Intronic
1169354765 20:4897267-4897289 GGGCAGGTGCAGGTGTGCTGGGG - Intronic
1171989982 20:31688619-31688641 GGCCAAGGGTATGTGTACTTGGG - Intronic
1172039020 20:32030953-32030975 GGGAAAGGGAACGTGTCCTGGGG + Intronic
1172635117 20:36405111-36405133 GGGCAAGGGCAGGTTGCCAAAGG + Intronic
1173191548 20:40880657-40880679 TGGCAAGTGCTGGTGTCTTTTGG - Intergenic
1173221488 20:41136446-41136468 GGGAAAGGTCAGGTCGCCTTGGG + Intergenic
1173867007 20:46318693-46318715 TGGCAAGAGGAGGTGTCCGTAGG - Intergenic
1175148420 20:56913737-56913759 GTCCAAGAGCAGGTGGCCTTAGG - Intergenic
1175518406 20:59583796-59583818 GGGCAGGGGGAGTTGCCCTTTGG + Intronic
1175937385 20:62520017-62520039 GGGCAAGTGCACGTGTCCATTGG + Intergenic
1176045531 20:63090858-63090880 GGGAACGGGCAGGTGTCCTGGGG - Intergenic
1176270632 20:64234103-64234125 AGGCAAGGTAAGATGTCCTTAGG - Intronic
1176377115 21:6092194-6092216 AGGCAGGGGCAGGTGGGCTTGGG + Intergenic
1179062058 21:37988445-37988467 GGGCAAGGGCAGGGGTCACAAGG - Intronic
1179279145 21:39919151-39919173 GGGCAAGGGTTTGGGTCCTTAGG + Intronic
1179474249 21:41633230-41633252 GGGAAAGGGTAGGTGTAATTGGG + Intergenic
1179746360 21:43446050-43446072 AGGCAGGGGCAGGTGGGCTTGGG - Intergenic
1181576851 22:23800734-23800756 GGGCAAGGGCAAGGGTACGTAGG - Intronic
1181912357 22:26248888-26248910 GGGCATGGGCAGGTTCCCCTAGG - Intronic
1182238486 22:28895720-28895742 GGGCAAGGGCATCTAGCCTTTGG + Intronic
1182697644 22:32207341-32207363 GGGCAAGGGCAGGCCTGCTGTGG + Intergenic
1182800931 22:33031489-33031511 GGACAAAGGCAGCTCTCCTTTGG + Intronic
1183149255 22:36025171-36025193 GAGCAAGGGCAGGTAGTCTTAGG - Intronic
1183352971 22:37344028-37344050 GGGCATGGGCAGGTGGGCGTGGG - Intergenic
1183352976 22:37344042-37344064 GGGCATGGGCAGGTGGGCATGGG - Intergenic
1183353010 22:37344123-37344145 GGGCATGGGCAGGTGGGCATGGG - Intergenic
1183353015 22:37344137-37344159 GGGCATGGGCAGGTGGGCATGGG - Intergenic
1183353037 22:37344190-37344212 GGGCATGGGCAGGTGTGCATGGG - Intergenic
1184257120 22:43293670-43293692 GGACATGGGCAGCTGTCCCTGGG + Intronic
1184689202 22:46109862-46109884 GGGCGATGGCAGGTGGCCTCGGG - Intronic
1184791202 22:46701250-46701272 GGGCACGGGCAGCTGTGCCTGGG - Intronic
1184981533 22:48099274-48099296 GGGAGAGGGCAGGTGGCCTCAGG - Intergenic
950219432 3:11183290-11183312 GGTCAGGTGGAGGTGTCCTTTGG + Intronic
952561821 3:34603933-34603955 GGGCCAGGGCAAGTGCCTTTCGG - Intergenic
954241057 3:49293931-49293953 GGGCCAGGGCAGGTGCTATTGGG - Intronic
954627972 3:52033046-52033068 GGGCAAGAGCAAGTGGCCTTAGG + Intergenic
954903722 3:54042073-54042095 GGGCAAGGCCAGCTCTCCTGGGG + Intergenic
955051009 3:55411010-55411032 GGGCACGGGCAGGTGATCCTAGG - Intergenic
958996533 3:100912150-100912172 GGGTAAGAGCAGGTGTTCTTGGG - Intronic
960694260 3:120380564-120380586 GGGCAAGGGCTGGTGGATTTTGG + Intergenic
960902269 3:122564602-122564624 GTGAAAGGGCAGGTGAGCTTCGG + Exonic
961075624 3:123979334-123979356 GGGGAAGGGAAGATGTCCTCAGG - Intronic
961308061 3:125973174-125973196 GGGGAAGGGAAGATGTCCTCAGG + Intronic
961478001 3:127160630-127160652 GGGGAAGGGCTGCTGGCCTTGGG - Intergenic
967219334 3:187235811-187235833 GTGCAAGGCCTGGTGTCCTGGGG - Exonic
967253242 3:187564438-187564460 GGGTAAGGCCAGGAGTCCATGGG + Intergenic
967981666 3:195069654-195069676 GGGGAAGGACAGGGTTCCTTGGG - Exonic
968962840 4:3753877-3753899 GGTGAAGTGCAGGTGTCTTTGGG - Intergenic
969070121 4:4529597-4529619 GGGCATGCACAGGTGTCCTGTGG - Intronic
969099710 4:4759730-4759752 GGGGAAGGGCAGGGGTAGTTGGG + Intergenic
969867903 4:10087251-10087273 GAGCAAGAGCAGGTGGCCTTGGG - Intronic
970205788 4:13654463-13654485 CGGTAAGGGCAGGAGCCCTTCGG - Intergenic
971941596 4:33222911-33222933 GGGTAAAGGAAAGTGTCCTTAGG + Intergenic
972699867 4:41483497-41483519 GAGCAAGGGGAGGAGTTCTTTGG - Intronic
972934702 4:44119137-44119159 AGGCAAGGGCATGAGTCATTGGG - Intergenic
975189341 4:71441553-71441575 GGGCAAGGACAGGTTCCTTTAGG + Intronic
984624332 4:181988716-181988738 GAGCAAAGACAGGTGACCTTGGG - Intergenic
985706799 5:1406157-1406179 GGGGAAGGGCAGGTGGCCCGAGG + Intronic
989973801 5:50556800-50556822 AGGCAAGGAGAGGTGTCCTAAGG - Intergenic
992553920 5:77885111-77885133 TGCCAAGGTCAGGTGTCCTCAGG - Intergenic
995119085 5:108516925-108516947 GGGCCAGAGCAAGTGACCTTTGG + Intergenic
996393573 5:122989528-122989550 GGGCGGGGGCAGGTGTTATTGGG + Intronic
1000306738 5:160001631-160001653 TGGCAAGGGCAGGTGTCGGAAGG - Intergenic
1001233857 5:170013149-170013171 GGGAAAGGGCAGGTATTCTAGGG + Intronic
1002211887 5:177604315-177604337 GGACAAGGGCAGGAGACCTCGGG + Exonic
1002616195 5:180458028-180458050 GGACAGGGGCAAGTGGCCTTGGG + Intergenic
1003333372 6:5148025-5148047 GGGGGAGGGCAGGTGGCCTGGGG - Intronic
1003411165 6:5864046-5864068 GGGAAGAGGCAGGTGTCCATTGG + Intergenic
1006437580 6:34034193-34034215 GGGCAGGAGAAGGGGTCCTTTGG - Intronic
1006851738 6:37103390-37103412 AGCCCAGGGCATGTGTCCTTGGG - Intergenic
1009660587 6:66606138-66606160 GGGCAATGGCAGGGGTCACTGGG + Intergenic
1011574597 6:88782026-88782048 GGGCACGGGGAGGTGGTCTTTGG - Intronic
1012287193 6:97405111-97405133 GGGCAAGTGCAGGCTTTCTTTGG + Intergenic
1013975809 6:116077349-116077371 GGGGAAGGGCTGGTGTCTTAGGG - Intergenic
1014703372 6:124716462-124716484 GGGCAAGGGCATGTTTCCTAAGG - Intronic
1015223828 6:130833856-130833878 GGGAAAGTGCATGTGTCCTGGGG + Intronic
1015277928 6:131403776-131403798 GGACCAAGGCAGGTGTCCCTGGG - Intergenic
1017947931 6:159110944-159110966 GGGCAAGGGAAGGTGTGTTTTGG + Intergenic
1018936064 6:168274734-168274756 GGGAAGGGGCATGTGTCCCTGGG - Intergenic
1019139987 6:169936971-169936993 GTCCAACGGCTGGTGTCCTTAGG - Intergenic
1019745803 7:2699906-2699928 GGGCAGGGACATGTGTCCATGGG - Intronic
1021576426 7:22109707-22109729 GGGCCAGTGCAGGTTTCCTGGGG + Intergenic
1021768125 7:23969697-23969719 GGGGAAGGGCAGGGGGCCCTTGG + Intergenic
1022596151 7:31714954-31714976 GGGCAGGGGGTGCTGTCCTTTGG + Intergenic
1023183931 7:37513957-37513979 GAGTAAGGAGAGGTGTCCTTTGG - Intergenic
1023600709 7:41879280-41879302 GAGCAAGGGGAGGGGTCCTCAGG - Intergenic
1023899262 7:44462638-44462660 GGGCAGCGTTAGGTGTCCTTGGG + Intronic
1027175408 7:75899907-75899929 GGCCAAGGGCTGGTGACTTTGGG + Intronic
1030198155 7:106873808-106873830 GGGCAGGGGCAGGTTTTCTTAGG - Intronic
1032744425 7:134771509-134771531 GGGCTAGGGCAGCGGTGCTTGGG - Intronic
1032898835 7:136283170-136283192 GGTCAGAGGCATGTGTCCTTAGG - Intergenic
1033220560 7:139524147-139524169 GGGCCTGGGCAGGGGTCCCTGGG - Intronic
1033696347 7:143792024-143792046 GGGCAGGGGCAGGTGTCACAAGG - Intergenic
1037846495 8:22287285-22287307 GTGCTAAGGCAGGTGTCCTTTGG + Intronic
1040060571 8:43100059-43100081 GGCACAGGGCAGGAGTCCTTCGG + Intronic
1040330896 8:46385294-46385316 GGGATAGGAGAGGTGTCCTTGGG - Intergenic
1040332148 8:46391185-46391207 GGGATAGGAGAGGTGTCCTTGGG - Intergenic
1041595133 8:59641496-59641518 TGCCAAGAGCAGATGTCCTTGGG + Intergenic
1042187852 8:66154668-66154690 GAGCAAGGGCAAGTGGCCGTTGG - Intronic
1045051622 8:98332413-98332435 CAGCAAGTGCTGGTGTCCTTAGG - Intergenic
1047957751 8:129988233-129988255 CGGCCAGGGCAGGTGTCTTCCGG + Intronic
1049205520 8:141361787-141361809 GGGCAGGGGCAGGTGTGCTGCGG + Intronic
1049298156 8:141854842-141854864 GGGCTGGGGGAGGTGTCCTGGGG + Intergenic
1049381394 8:142318139-142318161 GTGCACGTGCAGGTGGCCTTGGG + Intronic
1050957808 9:11687213-11687235 GGGGTAGGGCAGCTGTCCTCAGG + Intergenic
1052046170 9:23796784-23796806 GGGCAAGGGCAATTGTTCTCAGG - Intronic
1052191580 9:25669742-25669764 GGACCAAGGCAGGCGTCCTTGGG - Intergenic
1052587461 9:30447944-30447966 AGGGAAGGGCAGATCTCCTTGGG - Intergenic
1052996942 9:34556076-34556098 GAGCTGAGGCAGGTGTCCTTAGG - Intronic
1055929887 9:81549440-81549462 GGGTAAGGGCAGATGTGCTCTGG - Intergenic
1060530302 9:124343803-124343825 GGGGAAGGGCAGGTTTTCTCCGG - Intronic
1060556862 9:124512453-124512475 GGGAAAGGCCAGGTGCCCCTGGG + Intergenic
1061082895 9:128382921-128382943 GGGCCTGGGCAGGGGGCCTTGGG - Intronic
1061254019 9:129443231-129443253 GGGCCAGGGAAGCTGTGCTTGGG + Intergenic
1061301897 9:129710259-129710281 GAGCCAGGGCAGGTGGCCTCAGG - Intronic
1061831626 9:133300051-133300073 GGGCTAGAGCAGCTGTCCTAAGG - Intergenic
1062001170 9:134216418-134216440 GGGGACTGGGAGGTGTCCTTGGG + Intergenic
1062095612 9:134701699-134701721 GGACAGGGGCAGCTGTCCTCTGG + Intronic
1062194363 9:135264771-135264793 GGGCTAGGGCTGGTTTCTTTCGG - Intergenic
1062218996 9:135404270-135404292 TGGCAAGGGCTGGTGGCCTCTGG + Intergenic
1062358770 9:136177719-136177741 GGGCCAGGGCTCGTGTGCTTAGG + Intergenic
1062468708 9:136692708-136692730 GGGCAGGGGCCTGTGTCCTGGGG + Intergenic
1185452105 X:288112-288134 ATGCAATGACAGGTGTCCTTAGG - Intronic
1187269237 X:17764976-17764998 GGGCTCAGGCAGGTGTCCCTAGG - Intergenic
1187474499 X:19599105-19599127 GTCCAGGGGTAGGTGTCCTTGGG - Intronic
1190178933 X:48175078-48175100 GGTTAAGGGCAGGGGTGCTTAGG - Intergenic
1192890049 X:75380759-75380781 CAGCAAGGGCAGGTGTAGTTGGG - Intronic
1193722561 X:85004078-85004100 GGGGAAAGGCAGGTGTCTTGAGG - Intronic
1195342271 X:103917952-103917974 GGGGAGGGGCAGGTGGCCTGTGG - Intergenic
1195461818 X:105135810-105135832 GTGCAAAGGCAGTTGTCTTTGGG - Intronic
1197727017 X:129783131-129783153 GGCCAAGGGCATGTATCCTGTGG - Intronic
1197767619 X:130069442-130069464 GGGCAAGGGCAGCTCTTCTTGGG - Exonic
1198827324 X:140713074-140713096 GGGCCAGGGGAGGGGTCCTGAGG + Intergenic
1198937212 X:141910990-141911012 GGGGAAGGGCAGATGTCTCTGGG - Intergenic
1198961841 X:142191875-142191897 GGGGAAGGGCAGATGTCTCTGGG + Intergenic
1199974203 X:152883022-152883044 GAGCAAGGGAAGATATCCTTTGG + Intergenic
1200141520 X:153905119-153905141 GGGCTGGGGCAGGTGTTCTGAGG - Exonic