ID: 901512556

View in Genome Browser
Species Human (GRCh38)
Location 1:9724701-9724723
Sequence AGGGCAGGTGTCCTTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 570}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512552_901512556 -9 Left 901512552 1:9724687-9724709 CCATTATCAGGGCAAGGGCAGGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 901512556 1:9724701-9724723 AGGGCAGGTGTCCTTGGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 570
901512544_901512556 3 Left 901512544 1:9724675-9724697 CCTTGTGTCCACCCATTATCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 901512556 1:9724701-9724723 AGGGCAGGTGTCCTTGGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 570
901512549_901512556 -5 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512556 1:9724701-9724723 AGGGCAGGTGTCCTTGGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 570
901512550_901512556 -8 Left 901512550 1:9724686-9724708 CCCATTATCAGGGCAAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 220
Right 901512556 1:9724701-9724723 AGGGCAGGTGTCCTTGGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512556 Original CRISPR AGGGCAGGTGTCCTTGGGGA AGG Intronic
900135443 1:1115483-1115505 AGGGAGGGGGTCCCTGGGGAGGG - Intronic
900300402 1:1974053-1974075 AGAGCAGGAGGCCCTGGGGAAGG - Exonic
900469615 1:2847287-2847309 AGGGCTGCTGGCCTTGGGGGAGG - Intergenic
900550282 1:3251169-3251191 AGGGCAGGGGTGGGTGGGGAAGG - Intronic
900601150 1:3503178-3503200 TGGGCGGGTGCCCCTGGGGATGG - Intronic
900619034 1:3578523-3578545 AGGGCAGGGGCCCTGGGGGGGGG + Intronic
900651052 1:3730240-3730262 AGGGCAGGTGTCTCTGTGGCTGG + Intronic
901129590 1:6953985-6954007 AGGGCTTGGGTCCTTGGGGAGGG + Intronic
901512556 1:9724701-9724723 AGGGCAGGTGTCCTTGGGGAAGG + Intronic
901644150 1:10707612-10707634 AGGGCAGGTGTCCTGGCTGATGG + Intronic
902371008 1:16006846-16006868 ACAGCAGGTGGCCCTGGGGAGGG - Exonic
902397131 1:16138504-16138526 AGGGCAGGGGTCCCTGGTGAGGG - Intronic
902449280 1:16486379-16486401 GGGGCAGGCGTCCTTGCAGAAGG - Intergenic
902839093 1:19064210-19064232 TGGGCAGGTGGCCTGGAGGATGG + Intergenic
902840422 1:19070645-19070667 AGGGCAGGGGTTGGTGGGGAAGG + Intergenic
904335713 1:29796522-29796544 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
904389364 1:30171641-30171663 AGGGCAGGGGTCCTAGGAAATGG - Intergenic
905012485 1:34756833-34756855 AGAGCAGGTTCCCCTGGGGAAGG + Intronic
905052167 1:35061006-35061028 ATGGCAGGTGTCCATTGGGGAGG - Intronic
905066809 1:35191992-35192014 AGGGGAGGTTTCCTTTCGGAAGG - Intronic
905105186 1:35559610-35559632 TGGGGAGGGGTCCTAGGGGAAGG + Intronic
905300320 1:36982386-36982408 AGGACACGAGTCCTTGGAGAAGG + Intronic
905353867 1:37367324-37367346 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
905879568 1:41454793-41454815 AGGGCATTTGTCCTGGAGGATGG + Intergenic
905890738 1:41516863-41516885 AGGGCTGGGGCCCGTGGGGAGGG - Intronic
906401908 1:45510597-45510619 AAGGCTGGTGGCCTTGGGTAGGG - Exonic
907089235 1:51709260-51709282 AGGGCACTTGTCCTTCTGGAGGG + Intronic
907481306 1:54747381-54747403 GTGGCAGGTGTCCTTGGACAGGG - Intergenic
907581390 1:55575619-55575641 GGGGCAGGTGTCCTGGGGAATGG + Intergenic
908322519 1:62991966-62991988 AGTGCAGGTGGCATTGGAGAGGG + Intergenic
908616443 1:65928177-65928199 AGGCCAGGTACCCTTGAGGAAGG - Intronic
909576706 1:77184393-77184415 AGGTCAGGTCCCCTTGAGGAAGG + Intronic
909696716 1:78475576-78475598 AGGGCTGGGGGCCTAGGGGAGGG + Intronic
911883365 1:103269002-103269024 AGCCCAGGTCTCCTTGAGGAAGG + Intergenic
912436714 1:109667422-109667444 GGGGCTGGTGGACTTGGGGAGGG - Intronic
912680142 1:111723795-111723817 ATGGCAGGTGTCCAGGGGGAAGG + Exonic
913090557 1:115473933-115473955 AAGGCAGGCTTCCTTGAGGAGGG + Intergenic
913974658 1:143445650-143445672 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
914069049 1:144271266-144271288 CAGGCAGGTGGCCTTGTGGATGG + Intergenic
914110106 1:144695088-144695110 CAGGCAGGTGGCCTTGTGGATGG - Intergenic
914978833 1:152394085-152394107 AGGGCATGTGTCACTGGAGAGGG - Intergenic
915298180 1:154936575-154936597 AGAGCAGGTGTCCGTGAGGCGGG - Exonic
915518974 1:156430430-156430452 AGGGAAGGGGGCCGTGGGGAAGG - Intronic
915657868 1:157376593-157376615 TGGGCATGTGTCCTCGGGGCAGG + Intergenic
915847240 1:159279284-159279306 AGGAGAGGTGACCTTGAGGATGG + Intergenic
917081175 1:171258301-171258323 AGGGTTGGTGGCCTTGAGGAAGG + Intronic
918088136 1:181262788-181262810 AGGGAAGGAGTCCTAGGGGAAGG + Intergenic
918410340 1:184252004-184252026 AGGGCAGGTGTGCCTGGGATAGG - Intergenic
919757148 1:201073363-201073385 AGTGCAGGAGTCCCTGGAGATGG + Intronic
919845149 1:201637670-201637692 TGAGCATGTGTCCTTCGGGATGG - Intronic
919938776 1:202272290-202272312 AGGCCAGGTGGGCTTGGGGGTGG - Intronic
920005755 1:202832657-202832679 TGGACAGGTGCCCTGGGGGAAGG + Intergenic
920251742 1:204626513-204626535 AGGGGAGGTGGCATTTGGGATGG - Intronic
920300584 1:204986283-204986305 AGGGCAGGTCACCTTGGCGATGG - Intronic
921065688 1:211620721-211620743 AGGGGAGGTGGCACTGGGGAAGG + Intergenic
922185464 1:223270441-223270463 ATGACAGGTGTCCTCAGGGAAGG - Intronic
922541368 1:226422779-226422801 AGGGCAGGTGTCCTTGGTCCAGG + Intergenic
923559126 1:235025158-235025180 AGGGCAGGAGGCCTGTGGGAAGG + Intergenic
924747763 1:246853275-246853297 ATGGCTGATGTCCTTGGTGATGG - Exonic
1063114795 10:3066486-3066508 AGCGCGCGTGTCCGTGGGGAGGG + Intronic
1063227968 10:4034010-4034032 AGAGCAGGTGCCCTTGTGCAGGG - Intergenic
1063922856 10:10949179-10949201 AGAGGAGGTGGCCTTGGAGACGG - Intergenic
1064168444 10:13006737-13006759 AAGCCAGGTGCCCTTGAGGAAGG - Intronic
1064634494 10:17350047-17350069 AGGGAAGGCTTCCTTGAGGAAGG + Intronic
1065518013 10:26544161-26544183 AGGGCAGGTGGCATTGTGGGAGG - Intronic
1065663878 10:28037595-28037617 AGGGAAGGTTTCCTGGAGGAAGG - Intergenic
1065754046 10:28914332-28914354 AGCGAAGGTCTCCTTGGGCAGGG + Intergenic
1065773805 10:29101279-29101301 GGGGCAGGTGTCCCTTGGGTGGG + Intergenic
1067089277 10:43258414-43258436 AGGGCAGGTGGCATGGGGCAGGG - Intronic
1067234343 10:44435705-44435727 AGGGAAGGTGCCCTGGAGGAGGG - Intergenic
1068173248 10:53422672-53422694 CCTGCAGGTGTCCTTGAGGAGGG - Intergenic
1069461631 10:68600260-68600282 AGGGCAGGTCTGCATGGGGGAGG - Intronic
1069628671 10:69883660-69883682 AGGGAAGGTTTCCTGGAGGAGGG + Intronic
1069638548 10:69940570-69940592 AGGACAGGTTTCACTGGGGAGGG - Intronic
1069978921 10:72238655-72238677 AGGGCAGGAGCCCATGAGGACGG - Intergenic
1071378188 10:85031966-85031988 AGGCCAGGTCTCCTTGAGAAAGG + Intergenic
1071573098 10:86708645-86708667 AGGGCAGGTGGGCCTGGGGAGGG + Intronic
1073117904 10:101102472-101102494 AGGCCAAGTGTCCTTGGAGTGGG - Intronic
1073328789 10:102657585-102657607 ACGGCAGGTGGCCCTGGAGATGG + Exonic
1073491751 10:103857010-103857032 GGAGCAGGAGTCCTGGGGGAAGG + Intergenic
1074946423 10:118285015-118285037 AGGGAAGGCTTCCTGGGGGAAGG + Intergenic
1075924072 10:126236253-126236275 AGGCCTGGTGCCCTGGGGGAAGG + Intronic
1075932903 10:126314288-126314310 AGACCAGGTGTCCCTGGTGAGGG + Intronic
1076526501 10:131115706-131115728 AGGGGAGGTGTCCCTAGGGGTGG + Intronic
1076618484 10:131771956-131771978 TGGGATGGTGGCCTTGGGGAAGG + Intergenic
1076799560 10:132814311-132814333 AGGGCCGGGGTCCCTGGGGAGGG + Intronic
1076840350 10:133042210-133042232 AAGGCTGGGGTCCGTGGGGATGG + Intergenic
1077160617 11:1110840-1110862 GGGTCAGGTGGCCCTGGGGAGGG + Intergenic
1077160653 11:1111020-1111042 GGGTCAGGTGGCCCTGGGGAGGG + Intergenic
1077283686 11:1756694-1756716 TGGTCAGGTGACCTTGGGAAGGG - Intronic
1077556620 11:3229065-3229087 AGGCCAGGTAACCATGGGGAGGG - Intronic
1079054178 11:17191194-17191216 AGGGCACCTGTCTTTGGGCAAGG - Intronic
1079126937 11:17723813-17723835 ACTGCAGGTGCCCATGGGGAGGG + Intergenic
1080986666 11:37475314-37475336 TCACCAGGTGTCCTTGGGGAAGG + Intergenic
1082999423 11:59278065-59278087 AGGCCAGGTCCTCTTGGGGAAGG + Intergenic
1083309094 11:61775414-61775436 AGGGGAGGGGCCCCTGGGGAGGG - Intronic
1083767492 11:64848843-64848865 AGGGCAGGTGTGTTGGGGCAGGG + Intergenic
1084268396 11:68016601-68016623 GGGGCAGGTGTCCTGAGGCAGGG - Intronic
1085122892 11:73978536-73978558 AGGGAAGGTGAGTTTGGGGATGG - Intronic
1085323811 11:75591591-75591613 AGGCCAGCTGTCCTTGGGCATGG + Intronic
1085534926 11:77212026-77212048 AGGGCAGGTGTCCAAGGCCATGG - Intronic
1086278430 11:85159055-85159077 ACTGGAGGTCTCCTTGGGGAAGG - Intronic
1088264955 11:107980073-107980095 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1088387555 11:109276102-109276124 CTTGCAGGGGTCCTTGGGGAGGG - Intergenic
1088737501 11:112739963-112739985 AGGGCAGCTGTCCTGGGAGTGGG - Intergenic
1088746285 11:112807671-112807693 AGGGCAGTTGAGCCTGGGGAGGG + Intergenic
1089130875 11:116211004-116211026 AGAGCAGGTGGACTTGGTGAAGG - Intergenic
1089213332 11:116820823-116820845 AGGGCAGGTGTCCACGAGGGTGG + Exonic
1089336888 11:117731371-117731393 TGGGCAGGAGTCTTTGTGGATGG - Intronic
1089710247 11:120309463-120309485 AGAGCAGTTGTCCATGGAGAAGG + Exonic
1089903409 11:122012133-122012155 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1090794446 11:130122809-130122831 AGGGGAGCTCCCCTTGGGGAGGG - Intronic
1091462092 12:651316-651338 AGCCCAGGTGACCTGGGGGAAGG + Intronic
1091600693 12:1916002-1916024 AGGGAAGGCTTCCCTGGGGAGGG + Intronic
1091651633 12:2314511-2314533 AGGGCAGTGGTTCCTGGGGAAGG - Intronic
1092114909 12:5993310-5993332 AGGGAAGCTGACCTTGGGGAGGG + Intronic
1092223143 12:6729145-6729167 AGGGCAGGTGGGCTAGGGCAGGG + Intronic
1093235051 12:16599809-16599831 AAGGCAGGTGTTCTTGGTTATGG - Intronic
1094058118 12:26286690-26286712 AGAGAAGGTATCCATGGGGAAGG - Intronic
1095844597 12:46731426-46731448 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
1096785843 12:54016917-54016939 AGGGCAGGTTTCCCTGGCAATGG - Intronic
1096876699 12:54635120-54635142 AGGGCAGGTGTGGTGGGGAAGGG - Intergenic
1097741886 12:63252951-63252973 AGGGGAAGTGACCTAGGGGATGG - Intergenic
1098749638 12:74278016-74278038 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1098807042 12:75033529-75033551 AGGCCAGGTACCCTTGAGGAAGG + Intergenic
1099400253 12:82194772-82194794 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1100241366 12:92713172-92713194 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
1100708767 12:97231002-97231024 AAGGCAGGTGGCCCAGGGGATGG + Intergenic
1100809675 12:98325497-98325519 AGGGCAGGTGTGTGTGGGTAGGG + Intergenic
1101012160 12:100461935-100461957 AGGCTAGGGGTTCTTGGGGAGGG + Intergenic
1101263922 12:103064630-103064652 AGGCCGGGTCCCCTTGGGGAAGG + Intergenic
1101741599 12:107504047-107504069 AGGCCAGGAGCCCTTGGGGAAGG - Intronic
1102509192 12:113402812-113402834 GGGGCAGGGATCCTTGGGGCAGG - Intronic
1102954445 12:117050520-117050542 AGGGCTGGTGTTCTGGGGGATGG + Intronic
1103035410 12:117652637-117652659 GCTGGAGGTGTCCTTGGGGAAGG - Intronic
1103155963 12:118685092-118685114 AGGGCAGCTGATGTTGGGGAGGG + Intergenic
1103865080 12:124045217-124045239 ACAGCAGGTGTCCTTGGGCCTGG + Intronic
1104295479 12:127508099-127508121 AGGCCAGGTGCCCGTGGGGAGGG - Intergenic
1104404842 12:128508708-128508730 AGGGCAGCTCTCCTTAAGGAGGG - Intronic
1104968922 12:132522376-132522398 AGGGGAGGGGACCTTGGGGGAGG + Intronic
1106290704 13:28358860-28358882 AGGAAGGGTGTACTTGGGGAAGG + Intronic
1107597205 13:41975148-41975170 AGGCCTGGTCACCTTGGGGAAGG - Intergenic
1110735260 13:78928754-78928776 AGGGCAGGGGGCCATGGGGAGGG - Intergenic
1111148395 13:84215505-84215527 AGGTCAGGTGTCCTGGGGGTTGG - Intergenic
1112639054 13:101252217-101252239 ATGGCAGTTGTGCTTGGTGATGG - Intronic
1113395991 13:109948370-109948392 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1113790974 13:113027955-113027977 AGGGCCTGTGTCCCAGGGGACGG + Intronic
1113812634 13:113151829-113151851 AGGGGAGGTGTCACTGGGGGAGG - Intergenic
1114305595 14:21420097-21420119 AGGGCAGGTGCCCTGAGTGAAGG - Intronic
1114635124 14:24182947-24182969 AGGGCAGGTGGGCTTCGGGAAGG - Intronic
1114696907 14:24634049-24634071 AGGGCAGGAGACCTGTGGGATGG + Intronic
1114758470 14:25285344-25285366 AGGCCAGGTCTCCTTGAGGAAGG - Intergenic
1115775728 14:36713021-36713043 AGGGCAGCTTTCCTGGGGGTGGG + Intronic
1116058714 14:39895531-39895553 CTGGCCGGTCTCCTTGGGGAAGG - Intergenic
1116348149 14:43822817-43822839 TGAGGAGGTGTCCATGGGGATGG + Intergenic
1117092216 14:52262640-52262662 GGGGCAGGTTGCCCTGGGGAAGG - Intergenic
1117479488 14:56128893-56128915 AGGGCAGGTTTTTGTGGGGAGGG + Intronic
1117596478 14:57331366-57331388 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
1117656854 14:57964223-57964245 AGTGAAGGGGTCCTGGGGGAAGG + Intronic
1118152865 14:63208633-63208655 AGGGGAGGTGGCATTGGAGATGG - Intronic
1118367450 14:65107999-65108021 TGGGGGGCTGTCCTTGGGGAGGG + Intergenic
1119182306 14:72613503-72613525 AGGGCAGGTGGCCTTGAGAGAGG - Intergenic
1119406449 14:74402469-74402491 AGGCCAGGGGTCCTGGGGGCTGG - Intergenic
1119483402 14:74973689-74973711 TGGGCAGGTGGGCTTGGGGTAGG + Intergenic
1120010952 14:79413611-79413633 AGTGCCTGTATCCTTGGGGAAGG - Intronic
1120190479 14:81435944-81435966 ACAACAGGTGTCCCTGGGGACGG - Intronic
1122296957 14:100711241-100711263 AGTGGAGGTGACCTTGGGGATGG - Intergenic
1122790086 14:104180624-104180646 AGGGAAGGTGTTCTGGGGGCCGG + Intronic
1122817754 14:104321897-104321919 AGGGCGAGTGGCCTCGGGGATGG + Intergenic
1122928848 14:104924055-104924077 AGGGCAGGGGTCCAGGGTGATGG - Intergenic
1123016342 14:105377357-105377379 AGGGCAGGTGTCTCTGTGGCTGG + Intronic
1123030903 14:105450588-105450610 AGGGGAGGTCCCCCTGGGGAGGG + Intronic
1123036203 14:105472960-105472982 AGGGCTGGGGACCTTGGGGCAGG + Exonic
1123573477 15:21640688-21640710 AGGGCTGATGTTCTTGGGAAAGG + Intergenic
1124103170 15:26713953-26713975 ATGGCAAGTGTGCCTGGGGAAGG - Intronic
1124348671 15:28939735-28939757 AGCCCAGATGTCCATGGGGAAGG - Intronic
1125505311 15:40264671-40264693 AGGGGAGCTGTGCTGGGGGAGGG + Intronic
1126600352 15:50422109-50422131 AGGGCAGGTGTCAAAGGTGAAGG + Intergenic
1127122928 15:55786727-55786749 AGGGCAGATGAGCATGGGGAAGG + Intergenic
1127126665 15:55818939-55818961 TGGCCAGGTGGCCCTGGGGAGGG - Intergenic
1127384920 15:58459748-58459770 CGTGCAGGCGTCCTTGGGGACGG - Intronic
1127812444 15:62576426-62576448 TTGGCAGGTGCCTTTGGGGAGGG - Intronic
1127814838 15:62598858-62598880 ATGGCAGGTGCCCTGGGCGATGG + Intronic
1128063201 15:64748151-64748173 TGGGCAGGGGTGCTTGGGGCTGG + Intronic
1128090774 15:64917297-64917319 AGACCAGCTGTCCTGGGGGAGGG + Intronic
1128184497 15:65633037-65633059 AGGGAAGGCTTCCTAGGGGAGGG + Intronic
1128568175 15:68714786-68714808 AGGGCAGGTGTGGATGGGAAAGG - Intronic
1129177125 15:73848129-73848151 AGGGCATTTGTCCTCTGGGATGG + Intergenic
1129247583 15:74289052-74289074 AGGACAGGGCTCCTGGGGGAGGG + Intronic
1129771475 15:78206023-78206045 AGCCCTGGTGTCCTTGGGGGTGG - Intronic
1129843460 15:78757527-78757549 AGGGCATGTGCCCTTGGGCCAGG + Intergenic
1130024853 15:80262195-80262217 AGGGCAGGTGGCCCTGAGGGAGG + Intergenic
1130931341 15:88430340-88430362 AGGGAAGGTTTTCTGGGGGAGGG - Intergenic
1130985434 15:88841902-88841924 GGGGAAGGTGGCCTTGGGAAGGG - Intronic
1131459751 15:92609780-92609802 AGCCCACGTGTCCTTGGGTATGG + Intergenic
1132089289 15:98934882-98934904 TGGGCAGGGGTCGTTTGGGATGG + Exonic
1132887492 16:2189068-2189090 AGGGCTGGTGCCGTTGGGGTCGG + Exonic
1133464536 16:6017977-6017999 AGGGCAGGTGGCATTGGACAAGG - Intergenic
1134244559 16:12530426-12530448 AGGGTAGGTGTGCATGGGGTGGG - Intronic
1134644874 16:15857890-15857912 AGGCGAGGAATCCTTGGGGAAGG - Intergenic
1134848515 16:17461275-17461297 AAGGGAGGTGTCCTCTGGGAAGG - Intronic
1134902429 16:17950619-17950641 AGGCCAGATGTCCGTGGGCAAGG - Intergenic
1135475891 16:22774551-22774573 GAGGCAGGTGGCCCTGGGGAGGG + Intergenic
1135545485 16:23363047-23363069 AGGGAAGGTTTCCTGGAGGAGGG - Intronic
1135964465 16:27024342-27024364 AGAGAGGGTGTCCATGGGGAAGG + Intergenic
1137476161 16:48811395-48811417 AGGGCAGTTCTCCTTGAGGTCGG - Intergenic
1137665601 16:50247195-50247217 TGGGCAGGTGCCCTTGTAGAAGG + Intronic
1137677370 16:50310348-50310370 AGGGCAGAGGTCCTTTGGGAGGG + Intronic
1137706453 16:50539087-50539109 AGGGCAGGAGTCATAAGGGAGGG - Intergenic
1138230113 16:55330514-55330536 ATGGCAGGGCACCTTGGGGAAGG + Exonic
1138265212 16:55655746-55655768 AGGCCTGGTGTCCTTGGGAGCGG + Intronic
1138293269 16:55866198-55866220 TGGGCAGGGGTCAGTGGGGAGGG + Intronic
1138328503 16:56193710-56193732 CAGGCAGGTTTGCTTGGGGAGGG + Intronic
1140127806 16:72132540-72132562 AGGGCAGGTGAGCTTGGGAGTGG + Intronic
1141446265 16:84060650-84060672 TGGGCAGGATGCCTTGGGGAGGG - Intronic
1141693322 16:85608351-85608373 GGGGCTGGTAGCCTTGGGGAGGG + Intergenic
1141912577 16:87070253-87070275 AGAGGAGGTCTCCTTTGGGAGGG + Intergenic
1141969249 16:87469358-87469380 TGGCCAGATGACCTTGGGGAAGG - Intronic
1142154535 16:88527140-88527162 AGGACAGGTGTCCGTGGCGGGGG + Intronic
1142291032 16:89193612-89193634 GGGGCAGGTGTGGGTGGGGAGGG + Intronic
1142795697 17:2304931-2304953 GAGGCAGGAGGCCTTGGGGAAGG - Intronic
1144081158 17:11765585-11765607 AGGGCATCTGTCTCTGGGGAGGG - Intronic
1144775359 17:17782367-17782389 AGGGGAGGTGGCGTTGGGGAGGG + Intronic
1144813294 17:18015846-18015868 AGGGCAGGTGTTGTGGGGAAAGG - Intronic
1144954409 17:19011836-19011858 AGGCCAGCTGGCCTGGGGGAAGG + Intronic
1145261858 17:21359288-21359310 AGGTCAGGCGCCCCTGGGGAAGG - Intergenic
1146485559 17:33239878-33239900 AGGGCAGGCTTCCTGGAGGAAGG - Intronic
1146634389 17:34493335-34493357 TGGGCAAGTGTCCTTGGAGGTGG - Intergenic
1147318638 17:39633030-39633052 AGGCCAGGGGTTCTGGGGGATGG - Intronic
1147328649 17:39683360-39683382 AGGGAAGGCTTCCCTGGGGAAGG - Intronic
1148216633 17:45837016-45837038 AGGGCACGTTTCGTTGGGGAGGG + Intergenic
1148645941 17:49219759-49219781 AGGGCAGGTGGCCGAGGGGGAGG - Intronic
1148674761 17:49438819-49438841 AGGGCAGGCTTCCTGGAGGATGG + Intronic
1148745615 17:49916340-49916362 AGGGCAGGCTTCCTGGAGGAGGG + Intergenic
1149237767 17:54612951-54612973 CAGGCCTGTGTCCTTGGGGATGG - Intergenic
1149684942 17:58529909-58529931 AGGTCAGGTGTCCTAGGGTAAGG - Intronic
1150007599 17:61479365-61479387 TGGGCAGGGGTCACTGGGGAAGG + Intronic
1150217568 17:63478951-63478973 AGGGCAGATGTCCCAGGGGCTGG + Intergenic
1150815574 17:68389707-68389729 AGGAGAGGTTTGCTTGGGGATGG - Intronic
1150965285 17:69960864-69960886 AAGGGATGTGTCCTTGGGCAAGG + Intergenic
1151509316 17:74548623-74548645 AGGTCAGGTCCCCTTGAGGAAGG + Intergenic
1151570968 17:74925113-74925135 AGGTAAGGGGTCCTGGGGGAGGG + Intronic
1152238997 17:79151981-79152003 GGGACAGGGGGCCTTGGGGATGG - Intronic
1152317291 17:79588640-79588662 AGGACAGGTCTCTTGGGGGAGGG - Intergenic
1152591861 17:81217515-81217537 AGGGCAGGTGGCCGAGAGGATGG + Intronic
1152916004 17:83036342-83036364 AAAGCAGCTGCCCTTGGGGAAGG + Intronic
1153649124 18:7223936-7223958 AGGGAAGGCTTCCTTGAGGAGGG + Intergenic
1154032095 18:10762829-10762851 AGGCCAAATGTGCTTGGGGATGG + Intronic
1154252944 18:12759084-12759106 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
1155381048 18:25223232-25223254 AGTGCAGATTTACTTGGGGAGGG + Intronic
1155641863 18:28027080-28027102 AGGGCAGTTCTCCATGGGGGTGG - Intronic
1155995964 18:32331928-32331950 AGGGCTGGTGACCCAGGGGACGG + Intronic
1156108246 18:33691766-33691788 AGGGGAGGTGTCATTTGGGCCGG + Intronic
1156361610 18:36388907-36388929 AGGGAAGGTGCCCTGGGGGCTGG + Intronic
1157500033 18:48183867-48183889 AGGGCAGGTCTCCCTGGGTCTGG - Intronic
1157571607 18:48716022-48716044 AGAGCAGTTGTCCTAGGGGTTGG + Intronic
1157840635 18:50955155-50955177 AGAGCAGTTGTATTTGGGGAAGG - Intergenic
1160151693 18:76400032-76400054 AGGGCTGCTGCCCTTGGGCAGGG - Intronic
1160527381 18:79545551-79545573 AGGGCAGGTGCCGTTGGCCAGGG + Intergenic
1160841310 19:1148071-1148093 AGGGAAGGAGGCCCTGGGGACGG - Intronic
1160927590 19:1554388-1554410 TGGGCAGATGTCCCTGAGGAAGG + Intergenic
1160972547 19:1775933-1775955 AGGGCTGAGGTCCCTGGGGAGGG - Exonic
1161299982 19:3537864-3537886 TGGGGAGGGGGCCTTGGGGAAGG + Intronic
1161426991 19:4209054-4209076 AGGGTTGGTGTCTTCGGGGAAGG + Intronic
1161486154 19:4536950-4536972 AGGGCTTGTGTCCTAGGAGAAGG - Exonic
1161645507 19:5451137-5451159 AGGGCAGGCTTCCTGGAGGAGGG - Intergenic
1162232685 19:9280893-9280915 AGGGAAGGAGTCCTGGAGGAAGG + Intergenic
1162480710 19:10925446-10925468 AGGGCAGGCCTCCCTGAGGAGGG - Intronic
1162523243 19:11194030-11194052 GGGCCAGGGGTCCCTGGGGATGG + Exonic
1163653526 19:18532426-18532448 AGGGGCGGTGTCCTGGAGGAGGG - Intronic
1163783194 19:19261232-19261254 GGGGAAGGTGTCTCTGGGGAGGG + Intronic
1164733036 19:30520264-30520286 AGGGCATGTGTTCTCGGGGTAGG + Intronic
1165113111 19:33513521-33513543 TGGGGAGGTGGCCCTGGGGATGG - Intronic
1165454487 19:35902774-35902796 AGGGCCTGGGTCCTTGGGGGCGG + Intronic
1165461636 19:35947268-35947290 AGGGCATGAGTCCTGGGGAAAGG + Intergenic
1165745100 19:38226103-38226125 AGGTCAGGACTACTTGGGGAGGG - Intronic
1165904862 19:39187611-39187633 AGGGCAGGGGTCCTGGAGGGTGG - Intergenic
1166130825 19:40744658-40744680 CGGGCTGGTGGCCTTGTGGATGG - Exonic
1166266698 19:41688803-41688825 AGCTCTGCTGTCCTTGGGGAAGG + Intronic
1166499933 19:43332871-43332893 AGCCCTGCTGTCCTTGGGGAAGG + Intergenic
1166747175 19:45146884-45146906 AGGGCAGGCGTCCTGGGTGGTGG + Exonic
1166990622 19:46690506-46690528 AGGGAAGGCTTCCTGGGGGAGGG - Intronic
1167077055 19:47256603-47256625 GGGACAGGTGACCTGGGGGAGGG + Exonic
1167517609 19:49932514-49932536 AGGTCAGGTGGGGTTGGGGAAGG - Exonic
1167645374 19:50702718-50702740 AGGACAGGGGTCCTTGGGTGGGG + Intronic
1167698067 19:51026467-51026489 GGGACAGGTGTCCTTGGGGAGGG + Intronic
1168333133 19:55580924-55580946 AGGCCAGGTTTCCGGGGGGAAGG - Intergenic
925343802 2:3155459-3155481 AGAACAGGTGTTCCTGGGGAAGG - Intergenic
925477161 2:4230201-4230223 AGAGCAGGGGTCCTGGAGGAAGG - Intergenic
925885835 2:8393060-8393082 AGGACAGGTGGTCCTGGGGAGGG - Intergenic
926909871 2:17842575-17842597 GGGGCTGATGTTCTTGGGGATGG + Intergenic
926945211 2:18180170-18180192 AAGACAGGTGCCCTTGGGCAGGG + Intronic
927240403 2:20915755-20915777 AGGGCAGGGGTCCCAGTGGAGGG - Intergenic
927926004 2:27014286-27014308 AGGGAAGGAGTCCTTGGGGTAGG - Intronic
928443311 2:31311655-31311677 CTGACAGGGGTCCTTGGGGAGGG - Intergenic
928572162 2:32620488-32620510 AGGGGAGAAGTCCTTGGGGAAGG + Intergenic
929051031 2:37837011-37837033 GGAGCAGCTGTCCCTGGGGATGG + Intergenic
929270036 2:39962257-39962279 AGGCCAGGTTCCCTTGAGGAAGG - Intergenic
930114604 2:47707856-47707878 AGGGAAGGTTTCCTGGGGGAGGG + Intronic
932344725 2:70988221-70988243 TGGGCAGGTGGCCATGGGGAGGG - Exonic
932467480 2:71933008-71933030 AGTGCAGATGACCTTGGGGCTGG + Intergenic
933912954 2:86960102-86960124 AGGGGAGATGACCATGGGGATGG + Intronic
934010041 2:87809788-87809810 AGGGGAGATGACCATGGGGATGG - Intronic
934179362 2:89606625-89606647 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
934289648 2:91680888-91680910 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
934602192 2:95666234-95666256 AAGGCAGGTGTCCTGGCTGAGGG + Intergenic
934846559 2:97664409-97664431 AGGGCCGGCCTCCTTGGAGAGGG - Intergenic
934972052 2:98771583-98771605 AGGGAAGCTGGCATTGGGGATGG + Intergenic
935090724 2:99892655-99892677 AGGGCAGGTGTTGCTGGGGAGGG - Intronic
936397926 2:112143151-112143173 AGAGCAGGTGGTCATGGGGAAGG + Intronic
936449819 2:112625702-112625724 TGGGCACGTGTCCATGGGGTGGG - Intergenic
937209981 2:120262248-120262270 AGTGCAGGTGACATTGGGGAGGG + Intronic
937866949 2:126759651-126759673 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
938082007 2:128375025-128375047 AGGGCAGCTGGCGCTGGGGAGGG + Intergenic
938247152 2:129786624-129786646 AAAGCAGGTGTCCCTGAGGATGG + Intergenic
938624254 2:133091296-133091318 AGGAAAGGTTTCCATGGGGAAGG - Intronic
938649468 2:133367287-133367309 AGCGGAGGTGACCTTGGGGTGGG + Intronic
938766409 2:134463075-134463097 AGGGCAGGAGCCCTTGGGGTAGG - Intronic
938827811 2:135023717-135023739 AGGGAATGTGTCCTTGGGTGGGG - Intronic
939075697 2:137600077-137600099 TGTGCAGGTGCCCCTGGGGAGGG - Intronic
939280990 2:140064609-140064631 AGGGGAACTCTCCTTGGGGAAGG + Intergenic
941118682 2:161503302-161503324 ATGGCTGATGTCCTTGGTGATGG - Intronic
941140011 2:161768421-161768443 ATGGTAGGTCTCTTTGGGGAAGG + Intronic
942738013 2:179138902-179138924 TGGACAGATGTCCTTGTGGAAGG - Intronic
943306125 2:186264817-186264839 AGGCCAGGTCTCCTTGAGGAAGG + Intergenic
943318049 2:186413136-186413158 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
943384229 2:187182354-187182376 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
944530974 2:200667667-200667689 AGGGCAGATGACTATGGGGAAGG + Intronic
944668049 2:201972988-201973010 GTGGCAGGTGGCCTTGGGGTGGG - Intergenic
945453019 2:210015412-210015434 ATGGCTGGTGTGCCTGGGGAAGG - Intronic
946132458 2:217617610-217617632 GAGGCAGGAGTCCTGGGGGAAGG - Intronic
946703995 2:222439270-222439292 AGGCCAGGTCCCCTTGAGGAAGG - Intronic
946902537 2:224385812-224385834 AGAGGAAGTGTCCATGGGGACGG - Intronic
947918801 2:233852251-233852273 CTGGCACGTGACCTTGGGGAGGG + Intronic
948469077 2:238165900-238165922 CGGGCAGGTGCCCTCGGGGAAGG - Intronic
948775240 2:240284578-240284600 AGGGGCTGTGTCTTTGGGGATGG - Intergenic
948834810 2:240620758-240620780 CGGGCAGGGGTCCTGGGGGGTGG - Intronic
948908490 2:240991335-240991357 GGGGCAGGCGGCCCTGGGGAAGG + Intronic
948988629 2:241540996-241541018 AGGACAGGTGTCCCTGTGGGAGG + Intergenic
1168941318 20:1713467-1713489 AGGGGAGGTGTCCCTGGGTAGGG - Intergenic
1169321354 20:4635559-4635581 AGGGAAGGCCTCCCTGGGGATGG - Intergenic
1170589704 20:17762540-17762562 AGGGCAGGTGTCTGAGGGGAGGG + Intergenic
1171093352 20:22306881-22306903 AGGGCACTTGTCTATGGGGATGG + Intergenic
1171255113 20:23684614-23684636 AGGGCAGGTGCCTGTGGGAAGGG - Intergenic
1171262461 20:23746540-23746562 AGGGCAGGTGCCTCTGGGGAAGG - Intergenic
1171271557 20:23822259-23822281 AGGGCAGGTGCCTCTGGGAAGGG - Intergenic
1171330254 20:24331147-24331169 AGGACAGGTCACCTTGAGGAAGG - Intergenic
1171391024 20:24801896-24801918 AGGCCAGGGGGCCTTGGAGAAGG + Intergenic
1172538526 20:35693050-35693072 GGGACTGGGGTCCTTGGGGAAGG + Intronic
1174102763 20:48139778-48139800 GGGGCAGGTGTCCAAGTGGAAGG + Intergenic
1175222539 20:57425673-57425695 AGTGCAGCTGTGCTGGGGGAGGG - Intergenic
1175294638 20:57900015-57900037 AGGGCTGGTGGCCTTGGTGGTGG - Intergenic
1175424667 20:58855717-58855739 TGGGCTGGGGTCATTGGGGAAGG + Intronic
1175691411 20:61068313-61068335 AGGCCATGTGTCCTTGGAAAGGG - Intergenic
1175900714 20:62358924-62358946 AGGGCCTGTGCCCCTGGGGATGG - Intronic
1176045529 20:63090853-63090875 CGGGCAGGTGTCCTGGGGAAGGG - Intergenic
1176219539 20:63963473-63963495 AGGGCAGGGCTCCGTGGCGATGG - Intronic
1176358484 21:5972959-5972981 AGCGCTGGTGTACTTGGTGACGG + Exonic
1176411912 21:6453776-6453798 AGGGCAGGAGGCCATGGGGCGGG - Intergenic
1176997953 21:15578741-15578763 AAGCCAGGTCTCCTTGAGGAAGG + Intergenic
1177257846 21:18689527-18689549 AGGCCAGGTTCCCTTGAGGAAGG + Intergenic
1178503567 21:33145379-33145401 ATGGCAGCTGCCCCTGGGGAGGG - Intergenic
1178671612 21:34595986-34596008 AGGGCAGGTGACCTCCAGGAAGG - Intronic
1178764012 21:35432345-35432367 ACTGGAGGTCTCCTTGGGGAAGG + Intronic
1179476777 21:41651585-41651607 AGGGATGGTGCCCATGGGGAGGG - Intergenic
1179508839 21:41859015-41859037 AGGGCAGGTGAGCTTGGACAAGG - Exonic
1179687406 21:43062098-43062120 AGGGCAGGAGGCCATGGGGCGGG - Intronic
1179765034 21:43565591-43565613 AGCGCTGGTGTACTTGGTGACGG - Intronic
1180591343 22:16939851-16939873 AGGCCGGGTCTCCTTGAGGAAGG - Intergenic
1181029273 22:20142128-20142150 AGGGGAGAGGTCCCTGGGGATGG - Intronic
1181507878 22:23373830-23373852 TGGGCAGATGTCAGTGGGGAGGG + Intergenic
1182108134 22:27703942-27703964 ATGACAGGTGTTCTTGGAGAAGG - Intergenic
1182326672 22:29518521-29518543 AGGTCAGTAGGCCTTGGGGAAGG + Intronic
1182619663 22:31611954-31611976 AGAGGAGGTGGCCCTGGGGAGGG - Intronic
1182705857 22:32279905-32279927 TGGGGAGGTGACCTGGGGGAGGG + Intergenic
1183055359 22:35301785-35301807 AGGGCAGGGGTCCTTTGAGAGGG - Intronic
1183086564 22:35490663-35490685 ACAGCAGGTGTGCTGGGGGATGG - Intergenic
1183184702 22:36285340-36285362 AGGGCCAGTGACCTTGGGGAGGG + Intronic
1183306608 22:37086255-37086277 AGGTCAGGGGTCCCTGGGGCAGG - Intronic
1183315362 22:37133993-37134015 AGGGCTGGTTTCCCTGAGGAAGG - Intronic
1183456423 22:37925650-37925672 GGGGCTGGTGTCCTGGAGGAGGG - Exonic
1183489935 22:38110860-38110882 AGGGTTGGGGTCCTTGAGGAGGG - Intergenic
1183946191 22:41327138-41327160 GGGGCAGGAGGCCTGGGGGAGGG + Intronic
1184021933 22:41826764-41826786 AGGGCATGTGGCCCTGGGTAGGG + Intergenic
1184038300 22:41928843-41928865 AGGGCAGGTGGCCCAGGGCAGGG + Intergenic
1184394189 22:44222975-44222997 TGGGGAGGTGACCTGGGGGAGGG + Intergenic
1184412668 22:44333778-44333800 TGGCCAGGTGGCCTTGGGCACGG + Intergenic
1184726763 22:46351686-46351708 AGGGCAGATGTGCTTGAGGAAGG + Intronic
1184799415 22:46750830-46750852 TGGGCAGCAGTCATTGGGGAGGG + Intergenic
1185051776 22:48557812-48557834 AGGGGAGCTGACCTCGGGGAGGG - Intronic
1185284939 22:49995929-49995951 TGGTCAGGTGTCCCTGGGGCTGG - Exonic
949105815 3:198193-198215 AGGGCAGGTGTGCGTCGGCAGGG + Intronic
949245674 3:1923425-1923447 AGGCCAGGTCCCCTTGAGGAGGG + Intergenic
949303024 3:2606335-2606357 AGGGCAGGGGTCGAGGGGGAGGG + Intronic
949525254 3:4896963-4896985 AGGGTAGTTGTCTTTAGGGAGGG - Intergenic
949708244 3:6843198-6843220 AGGGCAAGTGCCTTTGGGCACGG - Intronic
950099968 3:10350587-10350609 AGGGCAGGGGCCATGGGGGAGGG + Intronic
950407799 3:12815546-12815568 AGGGAAGGGGTCCCTGGGGTGGG + Intronic
950421339 3:12901366-12901388 AGGGCAGGTGGGCCTGGGGAGGG + Intronic
950525192 3:13519117-13519139 AGGTCTGGAGTCATTGGGGAGGG - Intergenic
951571268 3:24065578-24065600 AGGCCAGGTCTCCTTGAGAAAGG - Intergenic
953961010 3:47265677-47265699 AGGGTCTGTGTCTTTGGGGAGGG - Intronic
954614072 3:51960604-51960626 AGGGCAGGAGCCCTCGGAGATGG + Exonic
954852699 3:53617032-53617054 CAGGCAGGTGTGCTGGGGGAGGG - Intronic
955751669 3:62189996-62190018 AGGGAAGATGCCCTTGAGGAAGG - Intronic
956509442 3:69978872-69978894 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
957247737 3:77734813-77734835 AGGCCAGGTTCCCTTGAGGAAGG - Intergenic
957634236 3:82760648-82760670 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
958789039 3:98630071-98630093 AGGCCGGGTGCCCTTGAGGAAGG - Intergenic
959377542 3:105604323-105604345 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
961431638 3:126888137-126888159 AGGGAAGGCGACCTTGAGGAGGG + Intronic
961474854 3:127140245-127140267 AGGGCAGTTGGGCTTGTGGAAGG + Intergenic
961652540 3:128424108-128424130 GGGCCAGGTGTCTTTGGGAATGG - Intergenic
963366282 3:144338482-144338504 GGGGCAGGTGTCCTGCGGGAGGG - Intergenic
965226963 3:166002253-166002275 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
966209174 3:177435014-177435036 AGGGAAGGCCTCCTTGAGGAAGG - Intergenic
966680368 3:182635843-182635865 AGAGCAGCTGATCTTGGGGAAGG - Intergenic
967154179 3:186677502-186677524 GGGGATGGTGTCCATGGGGATGG - Exonic
967253244 3:187564443-187564465 AGGCCAGGAGTCCATGGGGAAGG + Intergenic
967831566 3:193924503-193924525 AGGCCGGGTCTCCTTGAGGAAGG + Intergenic
968150726 3:196335273-196335295 AGGGGAGGGGTGCATGGGGAGGG + Intronic
968150741 3:196335308-196335330 AGGGCAGGGGTGCTTGGGGAGGG + Intronic
968262298 3:197335204-197335226 AAGGAAGGTGTCCTGGGGGCCGG - Intergenic
968704589 4:2072039-2072061 AGAGCTGGTGACCTTGGGGAAGG + Exonic
968897212 4:3411666-3411688 GGGGCAGGGGTCCTTGGAGTGGG - Intronic
968980976 4:3849193-3849215 AGGGCTGGAGGCCATGGGGAGGG - Intergenic
969046956 4:4343355-4343377 AGGGCATGTGGCCTGGGAGAGGG - Intergenic
969613969 4:8241762-8241784 AGGGGAGGGGTACATGGGGAGGG - Intronic
969653089 4:8479030-8479052 AGGGCAGGCTTCCTGGAGGAGGG + Intronic
969867902 4:10087246-10087268 AGAGCAGGTGGCCTTGGGCCTGG - Intronic
969870385 4:10101014-10101036 AGGGCAGGCTTCCTGGAGGAAGG - Intronic
970089387 4:12387832-12387854 AGGCGAGGTCTCCTTGAGGAAGG - Intergenic
971372831 4:26032111-26032133 AGGGAAGGTTTCCCTGGAGAAGG + Intergenic
972390174 4:38606560-38606582 AGGGCAGGTGTCCGGGCGGAGGG - Intergenic
972568901 4:40293360-40293382 AGGGCAGGTGTCCTCTAGCAAGG - Intergenic
973888637 4:55347093-55347115 TTGGCAGGTGCCCCTGGGGAAGG + Intronic
974036290 4:56821354-56821376 ATGGCAGGTGTCCTTAGAGCTGG + Intronic
974091028 4:57311621-57311643 AGGGCAGGGGTCAAGGGGGATGG + Intergenic
974458968 4:62163754-62163776 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
975024280 4:69530137-69530159 GGGCCAGGTTTCCTTGAGGAAGG + Intergenic
975820497 4:78266263-78266285 TGAGGAGGTCTCCTTGGGGATGG - Intronic
975982826 4:80178760-80178782 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
976744585 4:88390686-88390708 TGGGCAGCTGGGCTTGGGGAAGG + Exonic
976894002 4:90085209-90085231 ATGGAAGCTGTCCTTGGAGAGGG + Intergenic
977845472 4:101761876-101761898 CTCGCAGGGGTCCTTGGGGAGGG - Intronic
977898646 4:102394067-102394089 AGGACAGGTGTGATTGGGAAAGG + Intronic
978407274 4:108394017-108394039 AGGGCAGGGATCATGGGGGAAGG - Intergenic
980406094 4:132355286-132355308 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
981462590 4:145030310-145030332 AGGCCAGGTCCCCTTGGGGAAGG + Intronic
982116669 4:152104021-152104043 TGGGTAAGTGACCTTGGGGAAGG - Intergenic
982851183 4:160318002-160318024 AGGCCAGGTCCCCTTGTGGAAGG - Intergenic
984454753 4:179951381-179951403 AGGGTAGCTGGCATTGGGGATGG - Intergenic
984475344 4:180227812-180227834 AGGGCAGGTATCGTGAGGGAGGG - Intergenic
985113242 4:186567360-186567382 AGAGCAGGTTCCCTGGGGGAGGG - Intergenic
985495411 5:201877-201899 AGGTCCAGTTTCCTTGGGGAGGG - Exonic
985657495 5:1139744-1139766 AGGCCCCGTGTCTTTGGGGAAGG + Intergenic
985774451 5:1833609-1833631 AGGACAGGTGTCCTTCTAGAAGG + Intergenic
985959611 5:3290870-3290892 AGAGCAGGTGGCCTTGTGGCTGG - Intergenic
986306895 5:6522889-6522911 AGGGCTGGGGTCCTTGTAGATGG - Intergenic
986821748 5:11474880-11474902 AGGGCAGGTGTACATAGGGCGGG - Intronic
986938515 5:12920157-12920179 ACTGGAGGTCTCCTTGGGGATGG + Intergenic
986998330 5:13632916-13632938 AGGGAATTTGTCCTTAGGGAAGG - Intergenic
987182923 5:15385849-15385871 AGGGCGGGGGTCCGTGGTGAGGG - Intergenic
988844152 5:35112539-35112561 AAGGCAGGTGGGCTAGGGGAGGG + Intronic
988897772 5:35696823-35696845 CGGGCAGGCCTCCTTGGGAAAGG + Intronic
989457843 5:41663187-41663209 GTGGGAGGTATCCTTGGGGAAGG + Intergenic
989623736 5:43410131-43410153 AGGACAGGTGGCCTTGGCAAGGG - Intronic
990141215 5:52706562-52706584 AGGGCAGGTGACCTGGGGGGTGG + Intergenic
991161941 5:63513279-63513301 AGGGCTGGGGGGCTTGGGGAGGG + Intergenic
993232096 5:85248959-85248981 AGGCCAGATCTCCTTGGGGAAGG + Intergenic
993319628 5:86457107-86457129 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
994071986 5:95612974-95612996 AGGTCAGCTGTCACTGGGGAGGG + Intergenic
994855641 5:105115129-105115151 AGGCCAGGTTCCCTTGTGGATGG - Intergenic
994984618 5:106917208-106917230 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
995445226 5:112235325-112235347 AGGGCAGGTTTCCCTGGGGCTGG + Intronic
996802033 5:127414944-127414966 AGGGAAGGTTTCTTTGAGGAAGG + Intronic
996970748 5:129364898-129364920 AGGGCATGTGTTTTGGGGGAAGG - Intergenic
998231411 5:140363579-140363601 AGGGTAGGTGACCTGGGGGAGGG + Intronic
998568701 5:143238326-143238348 AGGGAAGCTGTCCTTAGAGATGG + Intergenic
999361377 5:150989220-150989242 CTGGCAGGTGTCCTTGGGCCTGG + Intergenic
1000416768 5:160992435-160992457 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1001127161 5:169030059-169030081 AGGGCAGGTTTCCAAGGGGCTGG - Intronic
1001238650 5:170051070-170051092 AGAGAAGGTTTCCTTGAGGAAGG + Intronic
1002100415 5:176854912-176854934 AGGGCAGGCTTCCTGGAGGAGGG + Intronic
1002277661 5:178114098-178114120 GGGGCAGGCGTCCTTGGCGCCGG + Intronic
1002883166 6:1270866-1270888 AGGGCAGAATTCCTTGGGGAAGG + Intergenic
1003757531 6:9138346-9138368 AAGGTTGGTGTCCTTGGGCAGGG + Intergenic
1003860694 6:10319468-10319490 TGGGCAGTTTTCCGTGGGGATGG + Intergenic
1003860703 6:10319498-10319520 TGGGCAGTTTTCCGTGGGGATGG + Intergenic
1003860720 6:10319558-10319580 TGGGCGGTTTTCCTTGGGGATGG + Intergenic
1004720404 6:18264078-18264100 AGGGCAGGTGTCCCGCGGGAAGG - Intronic
1005028974 6:21491794-21491816 AGGGAAGGTGTCACTTGGGAGGG - Intergenic
1005475097 6:26199911-26199933 AGAGCTGGTGTACTTGGTGACGG - Exonic
1005569619 6:27132376-27132398 AGCGCTGGTGTACTTGGTGACGG + Exonic
1005571081 6:27146424-27146446 AGCGCTGGTGTACTTGGTGACGG + Exonic
1005923331 6:30418990-30419012 AGGGCAGGTATCATTGTTGAGGG + Intergenic
1006397747 6:33798088-33798110 ACAGCAGGTGTCCTAGGAGACGG - Intronic
1006467774 6:34206291-34206313 AGGGGAGATGACCATGGGGATGG + Intergenic
1006844064 6:37050583-37050605 AGGGCTGGTGTGAGTGGGGAGGG - Intergenic
1006854398 6:37123248-37123270 AGGCCAGGTGTCAAGGGGGAAGG + Intergenic
1007197356 6:40074159-40074181 CTTGCAGGGGTCCTTGGGGAAGG - Intergenic
1007211395 6:40195858-40195880 AGCACAGGGATCCTTGGGGAAGG - Intergenic
1007257975 6:40541830-40541852 TGGGCATGTGTCTATGGGGAGGG - Intronic
1007556098 6:42767820-42767842 AGGGGAGGTGTCCATAGGAAAGG + Intronic
1007694633 6:43724532-43724554 AGGGCAAATGCTCTTGGGGAAGG - Intergenic
1008487523 6:52052049-52052071 AAGGCAGGGGAACTTGGGGATGG - Intronic
1008489349 6:52069424-52069446 AGGGAAGGGGTACTTGGTGAAGG + Intronic
1008634108 6:53392431-53392453 AGGGGAGGGAACCTTGGGGATGG - Intergenic
1008781255 6:55108696-55108718 TTCACAGGTGTCCTTGGGGAGGG + Intronic
1009978789 6:70701684-70701706 AGAGAATGTGTGCTTGGGGAAGG - Intronic
1010580927 6:77595224-77595246 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic
1010637686 6:78281856-78281878 AGGGGAGGTATCCCTGGGTAGGG + Intergenic
1010637797 6:78282606-78282628 AGGGGAGGTATCCCTGGGTAGGG + Intergenic
1013108042 6:107042716-107042738 AGAGCAGGTGTCTGAGGGGAAGG + Intronic
1013584753 6:111568559-111568581 AGGGAGAGTGTCCCTGGGGAGGG + Intronic
1014631450 6:123795310-123795332 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1014829104 6:126080513-126080535 AGTCCAGGTCTCCTTGAGGAAGG + Intergenic
1014970059 6:127802728-127802750 AGGCCAGGACTCCTTGTGGAAGG + Intronic
1015347760 6:132179918-132179940 CTGTCAGGGGTCCTTGGGGAGGG + Intergenic
1015477234 6:133667534-133667556 AGGGCATGTGCCCTTGAGGTAGG + Intergenic
1015644287 6:135369018-135369040 CTTGCAGGAGTCCTTGGGGAGGG - Intronic
1017012051 6:150069540-150069562 AGGGCAGGTGTCGCTGGCGGAGG - Intergenic
1017034177 6:150252235-150252257 AGGGGAGGAGGCCTTGTGGATGG + Intergenic
1018531772 6:164772081-164772103 ATGGCAGGTGACCTGGGGGTAGG - Intergenic
1018569761 6:165196654-165196676 ACCGGAGGTCTCCTTGGGGAAGG - Intergenic
1018953059 6:168391519-168391541 AGGACAGGTGTGCTGGGGGATGG - Intergenic
1018953084 6:168391628-168391650 AGGACAGGTGTGCTGGGGGATGG - Intergenic
1018953133 6:168391817-168391839 AGGACAGGTGTGCTGGGGGATGG - Intergenic
1018953149 6:168391871-168391893 AGGACAGGTGTGCTGGGGGATGG - Intergenic
1018953165 6:168391925-168391947 ATGACAGGTGTGCTGGGGGATGG - Intergenic
1018953184 6:168392007-168392029 AGGACAGGTATGCTGGGGGATGG - Intergenic
1018953199 6:168392061-168392083 AGGACAGGTATGCTGGGGGATGG - Intergenic
1018953220 6:168392141-168392163 AGTACAGGTGTGCTGGGGGATGG - Intergenic
1018953228 6:168392168-168392190 AGGACAGGTGTGCTGGGGGATGG - Intergenic
1018953249 6:168392248-168392270 AGGACAGGTGTGCTGGGGGATGG - Intergenic
1018953270 6:168392331-168392353 GGGACAGGTGTGCTGGGGGATGG - Intergenic
1018953295 6:168392413-168392435 AGGACGGGTGTGCTGGGGGATGG - Intergenic
1018953305 6:168392440-168392462 AGGACGGGTGTGCTGGGGGATGG - Intergenic
1018953315 6:168392467-168392489 AGGACGGGTGTGCTGGGGGATGG - Intergenic
1018953325 6:168392494-168392516 AGGACGGGTGTGCTGGGGGATGG - Intergenic
1018953334 6:168392521-168392543 AGGACGGGTGTGCTGGGGGATGG - Intergenic
1018953343 6:168392548-168392570 AGGACGGGTGTGCTGGGGGATGG - Intergenic
1019029563 6:168998745-168998767 AGGGGAGGTGTTCTTATGGATGG + Intergenic
1019040586 6:169100967-169100989 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1019504234 7:1382807-1382829 GGGGCAGGTGTAATTGGGGTGGG + Intergenic
1019511948 7:1422089-1422111 AGGGCAGGTGTCCCCGGGCTCGG + Intergenic
1019590667 7:1829139-1829161 AGGGCAGGAGTCCTGGAGGCAGG + Intronic
1019643567 7:2117247-2117269 TGGGAAGGTGCCCTTGGGAATGG - Intronic
1021526470 7:21594134-21594156 AGGGAAAGTGTCCTTGGTAAAGG + Intronic
1022916904 7:34965917-34965939 AGGGCAGGTCTTCTTGAGAAGGG - Intronic
1022945422 7:35279277-35279299 AGGGAAAGAGTCCTAGGGGAAGG + Intergenic
1023999862 7:45183099-45183121 AGGGCAGGTGTGAGGGGGGATGG + Intronic
1024042073 7:45563649-45563671 AAGGCAGGTGTGCTGGGGGAGGG + Intergenic
1025606653 7:63044475-63044497 AGGGAAGGCTTCCTGGGGGAGGG - Intergenic
1025887309 7:65609337-65609359 GGGGAAGGTGACCTTGGGCAAGG - Intergenic
1027389794 7:77693466-77693488 GTGGCAGGTGAACTTGGGGATGG + Intergenic
1028216931 7:88145030-88145052 AGGGCAGGTATATTTGGGTATGG + Intronic
1031226988 7:119051837-119051859 AGGGAGGATGTCCTTGGTGAGGG - Intergenic
1031916294 7:127565945-127565967 AGGGAAGGTTTCCCTAGGGAAGG - Intergenic
1032419071 7:131763277-131763299 TGGGCAGATGTCCTTGCGGAAGG - Intergenic
1032482035 7:132254990-132255012 AGGGGGGGTGGCCTGGGGGAAGG + Intronic
1032931452 7:136677437-136677459 TGCACAGGGGTCCTTGGGGAGGG + Intergenic
1033882584 7:145903276-145903298 TGCGCATGTGTGCTTGGGGAGGG + Intergenic
1034671022 7:152858544-152858566 GGGGCAGGTGTCCTGGGGGCAGG + Intergenic
1034951850 7:155303409-155303431 GGGGCAGGTGGCCCTGGGCATGG + Intronic
1035044782 7:155956438-155956460 AGGATAGGTGCCCCTGGGGAGGG - Intergenic
1035426719 7:158783026-158783048 GAGGCACGTGTCCATGGGGAAGG - Intronic
1035685257 8:1519613-1519635 AGAGGTGGTGTCCATGGGGAAGG - Intronic
1036422675 8:8612957-8612979 ACTCCAGGTGTACTTGGGGAGGG + Intergenic
1036429923 8:8680767-8680789 AGGGAGAGTGTCCTTGTGGAGGG + Intergenic
1036777608 8:11624422-11624444 AGAGCAAGGATCCTTGGGGAAGG + Intergenic
1036794661 8:11746772-11746794 AGGGCAGGCGACCTTGGTGGAGG + Intronic
1037753544 8:21697422-21697444 GGGGCAGATGTCCCTTGGGATGG - Intronic
1037957290 8:23069413-23069435 GGGGCAGGTGCCCCTGGGAAGGG - Intergenic
1038195886 8:25367233-25367255 GGCGCAGCTGTTCTTGGGGATGG - Intronic
1038484081 8:27921448-27921470 ATGGCAAGTGCACTTGGGGATGG + Intronic
1039809577 8:41034348-41034370 AGGGCAGGGGGGCTAGGGGAAGG + Intergenic
1040362681 8:46682883-46682905 AGGGGAGGTATCCCTGGGTAGGG + Intergenic
1041466536 8:58163019-58163041 GGGGCAGGTGGCCTGGGAGATGG - Intronic
1041798994 8:61777675-61777697 TGGGCAGATGTCCTTGCAGAAGG + Intergenic
1042560551 8:70070150-70070172 AGGGAAGGGGTGCTTGGAGAGGG - Intronic
1042811853 8:72834468-72834490 AGAGAAGGAGTCCTTGGGAATGG - Intronic
1045334489 8:101186617-101186639 AGGCCAGGTGTCTGTGGGAAAGG - Intronic
1046918168 8:119699375-119699397 AGGGCCGCTGTCCCTGTGGAGGG - Intergenic
1047468566 8:125144236-125144258 AGGGCAGCTGTGGTTAGGGAAGG + Intronic
1047685954 8:127304887-127304909 AGGGCAGGTGTTCTTGGCAGTGG + Intergenic
1048502751 8:134993710-134993732 AGGGCAGGGGTGGTTGGGGTTGG + Intergenic
1049084034 8:140464112-140464134 AAGGCTGGTGTCCTTGCAGAAGG - Intergenic
1049275472 8:141718090-141718112 AGGGCGGGTGTGCTTGGGACGGG - Intergenic
1049343262 8:142125119-142125141 AAGGCAGATGACCTTGGGTAGGG - Intergenic
1049408637 8:142462721-142462743 AGGCCGGGTGGCCTGGGGGAGGG + Intronic
1049486949 8:142870429-142870451 GGGGAAGGTGTCCTTGAGGATGG - Intronic
1049735801 8:144203637-144203659 TGGTCAGTGGTCCTTGGGGAAGG + Intronic
1051490506 9:17658917-17658939 AGTGCAGGTGTCCCTGGAGAGGG + Intronic
1051840846 9:21396233-21396255 AGCGCGGGTCTCCTTGAGGAAGG + Intergenic
1052384530 9:27807957-27807979 CTGGCAGGTGTCCTTGGGCCTGG + Intergenic
1052772728 9:32704509-32704531 AGGGCAGCTGCCCTGGGAGAGGG + Intergenic
1054829652 9:69609362-69609384 TGGGCAGATGTCCTTGCAGAAGG - Intronic
1056246268 9:84698168-84698190 AAGGAAGGTGGCCTTGGGAAAGG - Intronic
1057139436 9:92717748-92717770 AGGACAGCTGGCCTTGTGGAAGG + Intronic
1057316718 9:93973939-93973961 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1057693537 9:97307882-97307904 AGGGCAGGACTCCCCGGGGAAGG - Intronic
1058973372 9:110103089-110103111 AGGGGAGGTTTCCATGAGGAAGG - Intronic
1058990294 9:110249403-110249425 AAGGCAGGTGTGCTAGGTGAAGG + Intronic
1059329902 9:113528343-113528365 AGGGCAGGTGTCCTGGAGGGAGG + Intronic
1059408341 9:114116318-114116340 TGGGCAGGTGTCCCAGGAGAGGG + Intergenic
1060425774 9:123504246-123504268 GGGGCAGGTGTCCCAGAGGAGGG - Intronic
1060431411 9:123554086-123554108 AAGACAAGTGGCCTTGGGGAGGG + Intronic
1060557707 9:124517590-124517612 AGGGCAGGTAACCTGGGGGTAGG + Exonic
1060780510 9:126408933-126408955 GGGACAGGTGTCCTTGGGGAGGG - Intronic
1060933575 9:127503581-127503603 AGGGCAGCTCTTCTCGGGGAAGG + Intergenic
1060999231 9:127893510-127893532 AGGGAAGGCTGCCTTGGGGAGGG - Intronic
1061048595 9:128180869-128180891 GGGGCAGCTGCCCTTGGGCAAGG - Intronic
1061371658 9:130200900-130200922 AGGGAAGGTGTCCCGGGAGATGG - Intronic
1061633968 9:131893977-131893999 TTGGCAGGTGACCTTGGGAAAGG - Exonic
1061752950 9:132793262-132793284 AAGGCAGGGGCCCTTGTGGATGG - Intronic
1061757332 9:132824286-132824308 GGGGAAGGTCTCCCTGGGGAAGG - Intronic
1061878080 9:133554741-133554763 AGGGAAGGGGGCCTTGGGGAAGG + Intronic
1061907837 9:133707963-133707985 AGGGCAGGGGTCCTGGGGGCGGG - Intronic
1062275552 9:135728674-135728696 CGGGCAGGGGTCCTGGGAGAGGG + Intronic
1062308143 9:135921177-135921199 AGCGCAGCTGCTCTTGGGGAAGG - Intergenic
1062364048 9:136200516-136200538 AGGGGAGGAGTCCCTGGGGCAGG + Intronic
1062378835 9:136277053-136277075 ATGGCAGGAGTCTGTGGGGAGGG + Intergenic
1062445191 9:136590740-136590762 CGGCCAGGTGCCCTTGAGGAAGG + Intergenic
1062624457 9:137436500-137436522 AGGTCAGCTGGCCCTGGGGAGGG - Exonic
1203787411 EBV:135690-135712 AAGGCAGGCGTCCTTGGGTGGGG - Intergenic
1185668647 X:1788126-1788148 ATTGCAGGTGGCCTGGGGGATGG + Intergenic
1186469980 X:9813570-9813592 AGGCCAGGTCCCCTTGAGGAAGG - Intronic
1187532885 X:20112604-20112626 AGGGCAGCCGCCCTTAGGGAGGG - Intronic
1188363709 X:29288297-29288319 TGGGCAGGTGGGCTGGGGGAGGG - Intronic
1189033841 X:37476290-37476312 AGGTTAGGTTTCCTTGAGGAAGG - Intronic
1191659015 X:63631471-63631493 AGGCCAGGTGCCCTTGAGGAAGG - Intergenic
1193203016 X:78714709-78714731 ATCACAGGGGTCCTTGGGGAGGG + Intergenic
1193446972 X:81617366-81617388 AAAGGAGGTCTCCTTGGGGAGGG - Intergenic
1194210079 X:91060876-91060898 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1195100459 X:101550609-101550631 AGGGCCTGTGGCCTGGGGGAAGG + Exonic
1195666922 X:107440195-107440217 TGGGAATGTGTCCTTAGGGAAGG - Intergenic
1198680860 X:139180762-139180784 AGTGCAGTTGTCCTTTGGGGAGG - Intronic
1199024173 X:142918227-142918249 AGGCCAGGTCCCCTTGAGGAAGG + Intergenic
1199586762 X:149423183-149423205 CTCACAGGTGTCCTTGGGGAGGG + Intergenic
1200080412 X:153573500-153573522 AGGGCAGGGCTCTTGGGGGAGGG - Intronic
1200088485 X:153623474-153623496 AGGGCCGGTGTCCTTGCAGAGGG - Intergenic
1201529829 Y:14979435-14979457 AGGCCAGGTCCCCTTGAGGAAGG - Intergenic