ID: 901512557

View in Genome Browser
Species Human (GRCh38)
Location 1:9724702-9724724
Sequence GGGCAGGTGTCCTTGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512549_901512557 -4 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512557 1:9724702-9724724 GGGCAGGTGTCCTTGGGGAAGGG 0: 1
1: 0
2: 2
3: 43
4: 390
901512552_901512557 -8 Left 901512552 1:9724687-9724709 CCATTATCAGGGCAAGGGCAGGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 901512557 1:9724702-9724724 GGGCAGGTGTCCTTGGGGAAGGG 0: 1
1: 0
2: 2
3: 43
4: 390
901512550_901512557 -7 Left 901512550 1:9724686-9724708 CCCATTATCAGGGCAAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 220
Right 901512557 1:9724702-9724724 GGGCAGGTGTCCTTGGGGAAGGG 0: 1
1: 0
2: 2
3: 43
4: 390
901512544_901512557 4 Left 901512544 1:9724675-9724697 CCTTGTGTCCACCCATTATCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 901512557 1:9724702-9724724 GGGCAGGTGTCCTTGGGGAAGGG 0: 1
1: 0
2: 2
3: 43
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512557 Original CRISPR GGGCAGGTGTCCTTGGGGAA GGG Intronic
900252468 1:1678318-1678340 GGGCAGGTGAGCTGGGGGAGAGG - Intronic
900381467 1:2386105-2386127 GGGCAGATGTGCTTTGGGACAGG + Intronic
900502660 1:3014113-3014135 GGACTGGTGTCCTTGGGAGAAGG + Intergenic
900550281 1:3251168-3251190 GGGCAGGGGTGGGTGGGGAAGGG - Intronic
900601149 1:3503177-3503199 GGGCGGGTGCCCCTGGGGATGGG - Intronic
900611160 1:3545183-3545205 GGGCTGGTGTCCCTGGGGCTAGG - Intronic
901136273 1:6998532-6998554 GGGCAGGTCTCCCTGGGGACAGG - Intronic
901159443 1:7163663-7163685 GAGATGGGGTCCTTGGGGAATGG + Intronic
901275433 1:7987337-7987359 GTGAAGGAGTCCTTGGGGGAGGG + Intergenic
901512557 1:9724702-9724724 GGGCAGGTGTCCTTGGGGAAGGG + Intronic
901644151 1:10707613-10707635 GGGCAGGTGTCCTGGCTGATGGG + Intronic
902433987 1:16385260-16385282 GGCCTGCTGTCCTTGGGGAGTGG + Intronic
902839094 1:19064211-19064233 GGGCAGGTGGCCTGGAGGATGGG + Intergenic
902840423 1:19070646-19070668 GGGCAGGGGTTGGTGGGGAAGGG + Intergenic
903392764 1:22976447-22976469 GGGGTGGTGTCCTGGGGGCAAGG - Intergenic
903798040 1:25945266-25945288 GGGCAGGTGAACCTGGGCAAGGG - Intergenic
904853533 1:33477975-33477997 GGGAAGGTCTCCTTTGGGAATGG - Intronic
905012486 1:34756834-34756856 GAGCAGGTTCCCCTGGGGAAGGG + Intronic
906145550 1:43558207-43558229 GAGCTGGTCTCCTTGGAGAATGG + Intronic
906658008 1:47562702-47562724 GTGCAGATGTCCTTTGTGAAAGG + Intergenic
907045974 1:51300291-51300313 GGGCAGGTGGGGCTGGGGAAGGG - Intronic
909975675 1:82043529-82043551 GGGCTGGTGTCCTTGTAAAAAGG - Intergenic
910588016 1:88900342-88900364 CTGGAGGTCTCCTTGGGGAAGGG - Intergenic
912680143 1:111723796-111723818 TGGCAGGTGTCCAGGGGGAAGGG + Exonic
913974659 1:143445651-143445673 AGGCAGGTGGCCTTGTGGACGGG + Intergenic
914069050 1:144271267-144271289 AGGCAGGTGGCCTTGTGGATGGG + Intergenic
914110105 1:144695087-144695109 AGGCAGGTGGCCTTGTGGATGGG - Intergenic
915322274 1:155062399-155062421 GGGCGAGTGACCTGGGGGAAAGG + Intronic
915518973 1:156430429-156430451 GGGAAGGGGGCCGTGGGGAAGGG - Intronic
915657869 1:157376594-157376616 GGGCATGTGTCCTCGGGGCAGGG + Intergenic
915671188 1:157490379-157490401 GGACACGTGTCCTCGGGGCAGGG - Intergenic
915717197 1:157955741-157955763 GGAAAAGTGTCCTAGGGGAAAGG + Intergenic
916285118 1:163098114-163098136 CCGGAGGTCTCCTTGGGGAAGGG - Intergenic
918088137 1:181262789-181262811 GGGAAGGAGTCCTAGGGGAAGGG + Intergenic
918464765 1:184810027-184810049 GAGGAGGTGGCATTGGGGAAGGG + Intronic
919845148 1:201637669-201637691 GAGCATGTGTCCTTCGGGATGGG - Intronic
920922970 1:210313323-210313345 GGGCATGTGTCTGTGGGGCAGGG + Intergenic
921065689 1:211620722-211620744 GGGGAGGTGGCACTGGGGAAGGG + Intergenic
921331736 1:214045395-214045417 GGCCAGGTGCCTTTGGGGAGAGG - Intergenic
922541369 1:226422780-226422802 GGGCAGGTGTCCTTGGTCCAGGG + Intergenic
922866897 1:228868164-228868186 GGCCAAGTTTCCTTGGGGGATGG + Intergenic
923316155 1:232782008-232782030 GGGATGGTGGCCTTTGGGAATGG + Intergenic
923559127 1:235025159-235025181 GGGCAGGAGGCCTGTGGGAAGGG + Intergenic
1063421014 10:5912518-5912540 GGGCCAGTCTCCCTGGGGAAGGG - Intronic
1064512602 10:16111563-16111585 GGGCTGGTGTGCCTTGGGAAAGG + Intergenic
1064634495 10:17350048-17350070 GGGAAGGCTTCCTTGAGGAAGGG + Intronic
1065315424 10:24459159-24459181 GTCCAGGTGCCCTGGGGGAATGG - Intronic
1065518012 10:26544160-26544182 GGGCAGGTGGCATTGTGGGAGGG - Intronic
1066307269 10:34157719-34157741 GGGCATGTGTCATTGGGAATAGG - Intronic
1067270262 10:44785612-44785634 GGGCACGTGACCTTGGGCTAAGG - Intergenic
1067448936 10:46369356-46369378 GGGGAGGTCTCCTGGGGGCAGGG + Intronic
1067588433 10:47491409-47491431 GGGGAGGTCTCCTGGGGGCAGGG - Intronic
1067635559 10:47999500-47999522 GGGGAGGTCTCCTGGGGGCAGGG - Intergenic
1067877970 10:50020903-50020925 GGGGAGGTCTCCTGGGGGCAGGG + Intergenic
1069461630 10:68600259-68600281 GGGCAGGTCTGCATGGGGGAGGG - Intronic
1070132117 10:73663507-73663529 GGGGAGGTCTCCTGGGGGCAGGG - Intronic
1070280412 10:75044166-75044188 GTGCAGGTGGCCTAGGGGACCGG - Intronic
1071278473 10:84077663-84077685 GGACAGGTGTCCATGGATAAAGG - Intergenic
1071573099 10:86708646-86708668 GGGCAGGTGGGCCTGGGGAGGGG + Intronic
1071609566 10:87020568-87020590 GGGGAGGTCTCCTGGGGGCAGGG + Intronic
1072394649 10:95026386-95026408 GGACAGGGGACCTGGGGGAAGGG - Intergenic
1073242358 10:102066793-102066815 GGGCAGGTGGCCCTGGAGGATGG - Exonic
1074106614 10:110393796-110393818 GGGCAGGTGTCCGTGTGTGAGGG - Intergenic
1074160319 10:110831324-110831346 AGCCTGGTGTGCTTGGGGAATGG - Intronic
1074476918 10:113781777-113781799 GGGAAGGAGTTGTTGGGGAAGGG - Intronic
1074709603 10:116166540-116166562 GGGAAGGTGTTGTTGGGAAAAGG - Intronic
1074946424 10:118285016-118285038 GGGAAGGCTTCCTGGGGGAAGGG + Intergenic
1075201505 10:120408529-120408551 GGGCTGGTGCCCATGGGGAGTGG - Intergenic
1075548787 10:123376835-123376857 GGGCTGGTGGCATTGGGGGAAGG - Intergenic
1076132025 10:128019825-128019847 GGGCAGGGGTCCTCTGGGAGAGG - Intronic
1076191530 10:128486827-128486849 GGGTAGTGGTCCTTGGAGAAGGG - Intergenic
1076738138 10:132467857-132467879 GGGCAGGTGGCCTTGGTGGACGG - Intergenic
1076744794 10:132507451-132507473 AGGCAGGTGTTTTGGGGGAAGGG - Intergenic
1076799561 10:132814312-132814334 GGGCCGGGGTCCCTGGGGAGGGG + Intronic
1077283685 11:1756693-1756715 GGTCAGGTGACCTTGGGAAGGGG - Intronic
1079117062 11:17646647-17646669 GGGAAGGTTGCCTTGGGGTAAGG - Intronic
1080867691 11:36210121-36210143 GGGCATGAGTTATTGGGGAATGG - Intronic
1082128408 11:48457618-48457640 GGACAGAGATCCTTGGGGAATGG + Intergenic
1082809226 11:57468551-57468573 GGGCAGGGGACCCTGGGGGAAGG - Intronic
1083482963 11:62961473-62961495 GGGGAGGTGGCTTTTGGGAAAGG + Intronic
1083627642 11:64079675-64079697 GAGGAGGTGTGGTTGGGGAAAGG + Intronic
1083859251 11:65411292-65411314 CGGCAGCTGTCCTTGGGCCAGGG + Exonic
1084122412 11:67077443-67077465 GGGGAGGTGTCCTGGGGATAAGG - Intergenic
1084268395 11:68016600-68016622 GGGCAGGTGTCCTGAGGCAGGGG - Intronic
1084328629 11:68416526-68416548 AGGCAGGTGCCCTGTGGGAAGGG + Exonic
1087484893 11:98748436-98748458 GGACAGATCACCTTGGGGAAGGG + Intergenic
1089786498 11:120911071-120911093 GGGCAGCTGTCATTGATGAAGGG + Intronic
1091271452 11:134314409-134314431 AGGAAGGTGTCCTTGGGAGAAGG - Exonic
1091462093 12:651317-651339 GCCCAGGTGACCTGGGGGAAGGG + Intronic
1091651632 12:2314510-2314532 GGGCAGTGGTTCCTGGGGAAGGG - Intronic
1091835103 12:3580108-3580130 GGGCAGGTGGTCTTTTGGAATGG - Intronic
1092017057 12:5168304-5168326 GGGCAGGCTTCCTGGAGGAATGG + Intergenic
1092114910 12:5993311-5993333 GGGAAGCTGACCTTGGGGAGGGG + Intronic
1092296362 12:7202271-7202293 GGGCAGGTGTCCCTGGAGTCCGG + Exonic
1098751510 12:74298305-74298327 GGGCAGATGTTGTTGGGGCAGGG - Intergenic
1101441792 12:104709352-104709374 TGGCAGGTGGCTTTGGGGACAGG + Intronic
1101741598 12:107504046-107504068 GGCCAGGAGCCCTTGGGGAAGGG - Intronic
1101966852 12:109287679-109287701 GGGCAGGAGTTTTGGGGGAACGG + Intronic
1101978841 12:109387808-109387830 GGGCAGGTGTGCGTTGGGAGAGG - Intronic
1102752790 12:115310351-115310373 GGGCAGGTGGATTTTGGGAAGGG - Intergenic
1102902409 12:116648562-116648584 GGCAAGGTGGCCTTGGTGAATGG - Intergenic
1102954446 12:117050521-117050543 GGGCTGGTGTTCTGGGGGATGGG + Intronic
1103559767 12:121787407-121787429 AGGCAGCTGACCTTGGGGACTGG - Intronic
1104273366 12:127302895-127302917 GGGCTTGGGTCCTGGGGGAAAGG - Intergenic
1104464678 12:128980655-128980677 GGGCTAGTCTCCTGGGGGAAGGG - Intronic
1104476905 12:129078253-129078275 GGGCAGGAGCCCTGGAGGAAAGG - Intronic
1104928255 12:132324901-132324923 GGGCTGGAGGGCTTGGGGAAGGG - Intronic
1104968923 12:132522377-132522399 GGGGAGGGGACCTTGGGGGAGGG + Intronic
1106802933 13:33274934-33274956 GGGCAGGAGTGCTGGAGGAAAGG - Intronic
1109264095 13:60176799-60176821 GGGTTGGTGTCCTTATGGAAGGG - Intergenic
1111148394 13:84215504-84215526 GGTCAGGTGTCCTGGGGGTTGGG - Intergenic
1112290614 13:98142438-98142460 GGGACAGTGCCCTTGGGGAATGG - Intergenic
1112731665 13:102369569-102369591 GAGCAGGTGGCCTTAGGGTAGGG - Intronic
1113034811 13:106037313-106037335 GGGCAGCTGTCCTTAGAGAAAGG - Intergenic
1113307105 13:109090550-109090572 GGGCAGGAGTGCATGGTGAAAGG + Intronic
1113464769 13:110505535-110505557 GGGGAAGTGTCCTGGGAGAAAGG + Intronic
1117066565 14:52017604-52017626 TGGGAGGTGCCTTTGGGGAATGG - Intronic
1117092215 14:52262639-52262661 GGGCAGGTTGCCCTGGGGAAGGG - Intergenic
1118367451 14:65108000-65108022 GGGGGGCTGTCCTTGGGGAGGGG + Intergenic
1118455959 14:65945986-65946008 GGGCAGGGGTCTGTGGGGCAGGG - Intergenic
1118930450 14:70235229-70235251 AGGGAGGAGTCCTTTGGGAAAGG + Intergenic
1119182305 14:72613502-72613524 GGGCAGGTGGCCTTGAGAGAGGG - Intergenic
1119729446 14:76941809-76941831 CCTCTGGTGTCCTTGGGGAAAGG - Intergenic
1121899040 14:97675164-97675186 GGGCAGAGCACCTTGGGGAAGGG + Intergenic
1122269492 14:100562177-100562199 GAGCAGGGGGCCTGGGGGAAAGG + Intronic
1122296956 14:100711240-100711262 GTGGAGGTGACCTTGGGGATGGG - Intergenic
1122933113 14:104943790-104943812 GGGCAGGTGTCCTTTGAGGCCGG + Exonic
1123018769 14:105387808-105387830 GGGCAGGTGGCCCTGGGAATTGG + Intronic
1123573478 15:21640689-21640711 GGGCTGATGTTCTTGGGAAAGGG + Intergenic
1127122929 15:55786728-55786750 GGGCAGATGAGCATGGGGAAGGG + Intergenic
1127384919 15:58459747-58459769 GTGCAGGCGTCCTTGGGGACGGG - Intronic
1128063202 15:64748152-64748174 GGGCAGGGGTGCTTGGGGCTGGG + Intronic
1128796424 15:70469875-70469897 GGGCAGGAGTCCTAGAGGCAGGG + Intergenic
1129178205 15:73855144-73855166 GGCCAGGTCTCCTTGGGGCCAGG - Intergenic
1129452524 15:75658994-75659016 GGGCATGGCTCCTTGGGGAGAGG - Exonic
1129882467 15:79016461-79016483 AGGCAGGAGGGCTTGGGGAAGGG + Intronic
1131083332 15:89555045-89555067 GGGCAGGTCTCCTGGGGACATGG - Intergenic
1132288995 15:100686235-100686257 AGGCAGATGTGCTTGGGCAACGG + Intergenic
1132304454 15:100801381-100801403 GGGCAGGTGTTCTGGGGGCCAGG + Intergenic
1132572448 16:649893-649915 GGGCAGCTCTCCTGGGGGCAGGG - Intronic
1132944953 16:2527601-2527623 GGGCAGGGGTCCTCGGTGAGTGG + Exonic
1133138851 16:3730192-3730214 GGCCAGGGGTTCTTGGGGCATGG - Intronic
1134644873 16:15857889-15857911 GGCGAGGAATCCTTGGGGAAGGG - Intergenic
1135417322 16:22278493-22278515 GAGCAGGCATCGTTGGGGAATGG + Intronic
1135475892 16:22774552-22774574 AGGCAGGTGGCCCTGGGGAGGGG + Intergenic
1136255270 16:29034720-29034742 GGAAGGGTCTCCTTGGGGAAAGG + Intergenic
1137385577 16:48039504-48039526 GGGAAGGTTTCCTTGGGCACAGG + Intergenic
1137665602 16:50247196-50247218 GGGCAGGTGCCCTTGTAGAAGGG + Intronic
1138293270 16:55866199-55866221 GGGCAGGGGTCAGTGGGGAGGGG + Intronic
1138328504 16:56193711-56193733 AGGCAGGTTTGCTTGGGGAGGGG + Intronic
1138344300 16:56310814-56310836 GGGCAGGTGTTCTTGGTGGGTGG + Intronic
1139366947 16:66439360-66439382 GGGCAGGTGTCCCTGGGCTCTGG - Intronic
1139559679 16:67734191-67734213 GGGCAGATGGGCATGGGGAAGGG - Intronic
1139853835 16:69965595-69965617 GTGCAGGTGTCCCTGGGGGCCGG + Intergenic
1139882813 16:70188508-70188530 GTGCAGGTGTCCCTGGGGGCCGG + Intergenic
1140369697 16:74407011-74407033 GTGCAGGTGTCCCTGGGGGCCGG - Intergenic
1141083724 16:81076830-81076852 GGGCAGGCGTCTTTGTGGCACGG - Intronic
1141348840 16:83274220-83274242 AGGAAGGTGGCCTTAGGGAAAGG + Intronic
1141386247 16:83624700-83624722 GGGCAGGTGATCTAGGGCAAGGG - Intronic
1141513327 16:84526554-84526576 ACGCTGGTGTCCTTGGGGCAGGG - Intronic
1141634200 16:85305059-85305081 TGGCATGTGCCCTAGGGGAATGG - Intergenic
1142291033 16:89193613-89193635 GGGCAGGTGTGGGTGGGGAGGGG + Intronic
1142376552 16:89709706-89709728 GGGCAGGCCTCCTGGGGGACTGG + Intronic
1142795696 17:2304930-2304952 AGGCAGGAGGCCTTGGGGAAGGG - Intronic
1142967881 17:3592286-3592308 GGGCAGGTGTCCTTTTGGAGTGG + Exonic
1143321553 17:6071795-6071817 GGGGAGGTTTCCTTGGGCTATGG + Intronic
1144656453 17:17040291-17040313 AGGGAGGTGGCCTTGAGGAATGG + Intergenic
1144813293 17:18015845-18015867 GGGCAGGTGTTGTGGGGAAAGGG - Intronic
1144954410 17:19011837-19011859 GGCCAGCTGGCCTGGGGGAAGGG + Intronic
1146003193 17:29143899-29143921 GGGCTGGTGCCCTTGGAGAGAGG - Intronic
1146850735 17:36219616-36219638 CTGGAGGTCTCCTTGGGGAAGGG - Intronic
1147324238 17:39662793-39662815 GGGCAGGCGGCCCTGGGGGAAGG - Exonic
1147328648 17:39683359-39683381 GGGAAGGCTTCCCTGGGGAAGGG - Intronic
1148291527 17:46455329-46455351 GGGCAGTGGTTCTTAGGGAAGGG + Intergenic
1148313715 17:46673031-46673053 GGGCAGTGGTTCTTAGGGAAGGG + Intronic
1148345003 17:46897374-46897396 GGGAAGGTGACCTTGGCTAATGG - Intergenic
1148894618 17:50832674-50832696 TGCCTGGTGTCCTTGGGGAAAGG + Intergenic
1149237766 17:54612950-54612972 AGGCCTGTGTCCTTGGGGATGGG - Intergenic
1149684941 17:58529908-58529930 GGTCAGGTGTCCTAGGGTAAGGG - Intronic
1149991123 17:61384157-61384179 TGGCAGGTGGGCTTGGGGGATGG - Intronic
1150007600 17:61479366-61479388 GGGCAGGGGTCACTGGGGAAGGG + Intronic
1151705157 17:75763498-75763520 GGGCAGGTGTCCTGGCGGGAAGG + Intronic
1151978977 17:77498081-77498103 AGGCAGGTGGCCTGGGGCAAAGG - Intronic
1152238996 17:79151980-79152002 GGACAGGGGGCCTTGGGGATGGG - Intronic
1152255239 17:79235290-79235312 GGCCTGGTCTCCTCGGGGAAGGG - Intronic
1152301073 17:79495548-79495570 GGGCAGGGGTACTGGGGGCAGGG + Intronic
1152585231 17:81186290-81186312 GGACAGGGGTGCCTGGGGAAGGG - Intergenic
1152916005 17:83036343-83036365 AAGCAGCTGCCCTTGGGGAAGGG + Intronic
1153170962 18:2315105-2315127 CAGCAGGTGTCCCTGGGGAGTGG - Intergenic
1153697952 18:7663572-7663594 GGGCAGGGTTCCGTGGGGGAAGG + Intronic
1153758927 18:8311507-8311529 AGGCATGTGACCTTGGGGAAAGG + Intronic
1156514661 18:37669764-37669786 GCGCAGGTGGCCCAGGGGAAGGG + Intergenic
1156573498 18:38285152-38285174 GGTTAGGTGTCCTTGAGGACCGG + Intergenic
1160382589 18:78472140-78472162 GGGCAGGTGACATTGGGGGCTGG - Intergenic
1160513009 18:79463074-79463096 GGGGATGGGTCCTTGGGGGAAGG - Intronic
1160987207 19:1844586-1844608 GGGCAGGAGTCCTGGGGTAGAGG - Intronic
1161299983 19:3537865-3537887 GGGGAGGGGGCCTTGGGGAAGGG + Intronic
1162013384 19:7830886-7830908 AGGCTGGTCTCCTTGGGGAGAGG - Intronic
1162030040 19:7913361-7913383 GGGAAGGTGGTCTTGGGGCATGG + Exonic
1162350451 19:10145749-10145771 GAGGAGGTGTCCTTGGGCAGAGG + Intronic
1162523244 19:11194031-11194053 GGCCAGGGGTCCCTGGGGATGGG + Exonic
1163017165 19:14463655-14463677 CGGAAGGTGACCTGGGGGAAGGG - Exonic
1163559982 19:18013360-18013382 GAGAAGGCGTCCTTGCGGAAAGG + Exonic
1163783195 19:19261233-19261255 GGGAAGGTGTCTCTGGGGAGGGG + Intronic
1164513788 19:28917598-28917620 GAGCCCGTGACCTTGGGGAAGGG - Intergenic
1164733037 19:30520265-30520287 GGGCATGTGTTCTCGGGGTAGGG + Intronic
1164754850 19:30681813-30681835 GCGGAGATGTCATTGGGGAAGGG - Intronic
1165113110 19:33513520-33513542 GGGGAGGTGGCCCTGGGGATGGG - Intronic
1165343304 19:35227536-35227558 GGGCAGGTGGACTGGGGGAGAGG + Intronic
1165461637 19:35947269-35947291 GGGCATGAGTCCTGGGGAAAGGG + Intergenic
1166295767 19:41888572-41888594 GGGCAGGTGTTCAGGGAGAATGG - Intronic
1166297352 19:41895574-41895596 GGGGAGGTGTTGCTGGGGAATGG - Intronic
1167077056 19:47256604-47256626 GGACAGGTGACCTGGGGGAGGGG + Exonic
1167299622 19:48671266-48671288 GGGCAGGGGGCCCTGGGGAGCGG + Intronic
1167606924 19:50486193-50486215 GGGCAGGTGTGTTTGTGGGATGG + Exonic
1167815539 19:51877404-51877426 TGGCACGTGTGCTTGGGGAATGG + Intronic
1168009819 19:53521212-53521234 GGGCAGGGTTCCGCGGGGAATGG + Exonic
1168145180 19:54416373-54416395 AAGCCGGTGTCCCTGGGGAAGGG + Intronic
925343801 2:3155458-3155480 GAACAGGTGTTCCTGGGGAAGGG - Intergenic
925859788 2:8163270-8163292 GGGAGGGAGTCCTTGTGGAAAGG - Intergenic
926327153 2:11795278-11795300 GGGTGGGCGTCATTGGGGAATGG + Intronic
927092593 2:19723338-19723360 GGGCAGCTGTCATGGGGGAGAGG + Intergenic
928305280 2:30164844-30164866 GGGCTGGGATCCTGGGGGAAGGG - Intergenic
928443310 2:31311654-31311676 TGACAGGGGTCCTTGGGGAGGGG - Intergenic
931277522 2:60756633-60756655 GGGGAGGTGCCCTTGCGGACCGG - Intronic
931774305 2:65527062-65527084 GGGCAAGTTTCCTTGAGAAAAGG - Intergenic
932344724 2:70988220-70988242 GGGCAGGTGGCCATGGGGAGGGG - Exonic
932687302 2:73882897-73882919 GGGAAGTAGCCCTTGGGGAACGG + Intergenic
933749937 2:85596744-85596766 GGGCAAGTGTCCTTCAGGAGTGG + Intronic
934179363 2:89606626-89606648 AGGCAGGTGGCCTTGTGGACGGG + Intergenic
934289649 2:91680889-91680911 AGGCAGGTGGCCTTGTGGACGGG + Intergenic
934614748 2:95764087-95764109 AGGCAGGTGTCTTTGGGAGAAGG + Intergenic
935557103 2:104521648-104521670 GGACAGGTGGAATTGGGGAATGG - Intergenic
936449818 2:112625701-112625723 GGGCACGTGTCCATGGGGTGGGG - Intergenic
936834103 2:116686019-116686041 TGGCTGGTGTCCTTAGGAAAAGG + Intergenic
937226838 2:120375143-120375165 GGGCAGGTGTCTTATGTGAACGG - Intergenic
937375735 2:121334665-121334687 GAGCAGGTGTCCAGGGGAAATGG + Intergenic
937797000 2:126035659-126035681 GGGCAGGTTTCACAGGGGAATGG - Intergenic
937812686 2:126216646-126216668 GGAGTGGTGTCCTTGAGGAATGG - Intergenic
937931538 2:127208858-127208880 GGGCCTGAGCCCTTGGGGAAGGG + Intronic
938224487 2:129604208-129604230 GTGCAGGTGTCCCTGGGCATAGG - Intergenic
939075696 2:137600076-137600098 GTGCAGGTGCCCCTGGGGAGGGG - Intronic
943697774 2:190954802-190954824 GCTCACCTGTCCTTGGGGAAAGG - Exonic
944365693 2:198916595-198916617 CGGCAGGTGTCATTAGGGACAGG + Intergenic
946516909 2:220422367-220422389 GGGCAGGTGTGGGTGGGTAAGGG + Intergenic
947746497 2:232510645-232510667 GGGCAGGCTTCCTGGGGGAGAGG - Intergenic
947747519 2:232516596-232516618 CTGCAGTTGTCCTTTGGGAAAGG - Intergenic
948469076 2:238165899-238165921 GGGCAGGTGCCCTCGGGGAAGGG - Intronic
948863320 2:240763360-240763382 GGACAGGTGGCCTTGAGGGATGG + Intronic
948889541 2:240900281-240900303 GGGCAGGTGTCCCGGGGAGAAGG + Intergenic
1169001177 20:2169031-2169053 GGGCAGCTGACCTTGGGGCTCGG + Intronic
1169203888 20:3729618-3729640 GGGCAGGAGTCCGGGGGCAAGGG + Intergenic
1170589705 20:17762541-17762563 GGGCAGGTGTCTGAGGGGAGGGG + Intergenic
1171259973 20:23723759-23723781 GGGCAGGTGGCTGTGGGCAAAGG - Intergenic
1171262460 20:23746539-23746561 GGGCAGGTGCCTCTGGGGAAGGG - Intergenic
1172783640 20:37451794-37451816 AGGAAGCTGCCCTTGGGGAACGG - Intergenic
1172856646 20:38009449-38009471 GGGCATGGGTCTTTGGAGAATGG - Intronic
1173270010 20:41525268-41525290 GGGCAGTTTGCCCTGGGGAAGGG - Intronic
1174102764 20:48139779-48139801 GGGCAGGTGTCCAAGTGGAAGGG + Intergenic
1174157369 20:48524556-48524578 GGGCAGCTGGACCTGGGGAAGGG + Intergenic
1176649414 21:9531231-9531253 GGCCAGGTGTACTTGGCCAAGGG + Intergenic
1178282254 21:31293614-31293636 GGACAGGTGGCCTTGTGGGATGG - Intronic
1178671611 21:34595985-34596007 GGGCAGGTGACCTCCAGGAAGGG - Intronic
1179598661 21:42461007-42461029 GGGCAGGTGCCCTAGGGGGATGG - Intergenic
1180090454 21:45531267-45531289 GGGAAGGTATCCATGGGGCAGGG + Intronic
1180244023 21:46534365-46534387 GGGCAGGTGCCCGAGGGTAATGG - Intronic
1181507879 22:23373831-23373853 GGGCAGATGTCAGTGGGGAGGGG + Intergenic
1181647778 22:24243124-24243146 GGGCATGTGGCCTTTGGGAGTGG - Intronic
1182314519 22:29436052-29436074 GGGCAGGGGAGCTTGGGGAGAGG + Intergenic
1182326673 22:29518522-29518544 GGTCAGTAGGCCTTGGGGAAGGG + Intronic
1182350499 22:29696620-29696642 GGGCTGGTTTCCTTGGGGCAAGG - Exonic
1182695439 22:32195999-32196021 GGGCAGGGGAGCTTGGGGAGAGG - Intronic
1182705858 22:32279906-32279928 GGGGAGGTGACCTGGGGGAGGGG + Intergenic
1182800970 22:33031690-33031712 GGACAGGGGTGCTGGGGGAATGG - Intronic
1183184873 22:36286040-36286062 GGGGAGGTGGGCCTGGGGAAGGG - Intronic
1183216956 22:36486951-36486973 GGGCTGGCGACCTGGGGGAAAGG - Intergenic
1183276110 22:36899281-36899303 TGGCTGGTGTCCTTGTAGAAAGG - Intergenic
1183306607 22:37086254-37086276 GGTCAGGGGTCCCTGGGGCAGGG - Intronic
1183315361 22:37133992-37134014 GGGCTGGTTTCCCTGAGGAAGGG - Intronic
1183343782 22:37295922-37295944 AGGCAAGGGTCCTTGGGGAGTGG + Intronic
1183416781 22:37687120-37687142 GGTCAGGTGTCCTGGGGACATGG + Intronic
1183456422 22:37925649-37925671 GGGCTGGTGTCCTGGAGGAGGGG - Exonic
1184296443 22:43528162-43528184 AGGCAGCAGTCCTTGGGTAATGG + Intergenic
1184394190 22:44222976-44222998 GGGGAGGTGACCTGGGGGAGGGG + Intergenic
1184935263 22:47716332-47716354 AGGCAGGTGTGCTGGTGGAACGG + Intergenic
1184995560 22:48205013-48205035 AGGCTGGTGTTCTTGGAGAAAGG - Intergenic
1185004521 22:48267935-48267957 GGCCACGTGTCCTTGGGGACAGG - Intergenic
1185288137 22:50011348-50011370 GGCCAGGTGATCCTGGGGAATGG - Intronic
1185298212 22:50064608-50064630 GGGCAGCCGTCCTGGGGGGATGG + Intronic
950411029 3:12837355-12837377 GGGCATTTGTCCTTAAGGAATGG - Intronic
950416599 3:12872540-12872562 AGGCAGGTGTCCTGGGGGTCTGG + Intergenic
950421340 3:12901367-12901389 GGGCAGGTGGGCCTGGGGAGGGG + Intronic
950756166 3:15174626-15174648 GGGGAGGCTTCCTAGGGGAAAGG - Intergenic
950921814 3:16702574-16702596 GGCCAGGTGGGTTTGGGGAATGG - Intergenic
953634255 3:44648924-44648946 AGGCTGGTGTCCCCGGGGAAAGG - Intronic
954131781 3:48564700-48564722 GGGGAGGAGTCCTTGGGCCAGGG - Intronic
959906824 3:111719744-111719766 GGGCAGGTGTTGATGAGGAAGGG + Intronic
960954998 3:123025952-123025974 GGACAGATGACCTTGAGGAAGGG - Intronic
961474855 3:127140246-127140268 GGGCAGTTGGGCTTGTGGAAGGG + Intergenic
961786086 3:129347741-129347763 AGGCAGGTGTCCTGGGGGTCAGG + Intergenic
962700122 3:137989569-137989591 GGGCTGATGGCTTTGGGGAAAGG - Intergenic
964331493 3:155608206-155608228 TAACAGGGGTCCTTGGGGAAGGG + Intronic
965780987 3:172285746-172285768 ATGAAGGTGTCATTGGGGAATGG - Intronic
965882158 3:173398447-173398469 GGGCAGGAGTCGGTGGAGAACGG - Exonic
966209173 3:177435013-177435035 GGGAAGGCCTCCTTGAGGAAGGG - Intergenic
966502017 3:180653266-180653288 GGGCAGATGTCTTTGTAGAAGGG - Intronic
966880156 3:184345479-184345501 GGGCAGGGGCCCTTGAGGGACGG - Intronic
968150742 3:196335309-196335331 GGGCAGGGGTGCTTGGGGAGGGG + Intronic
968831795 4:2935977-2935999 GGAAAGGTTTCCTTTGGGAAAGG - Intergenic
969044984 4:4330200-4330222 TGACAGGTGTCCTTGTGAAAAGG + Intergenic
969479120 4:7437797-7437819 GGGCAGGTGTGTCTGGGCAAAGG - Intronic
969817048 4:9694644-9694666 GAGCATGTGTCCCTGGGGACAGG - Intergenic
970580125 4:17467499-17467521 GGGCAGGTGTACCGGGGGTATGG - Intronic
971372832 4:26032112-26032134 GGGAAGGTTTCCCTGGAGAAGGG + Intergenic
972390173 4:38606559-38606581 GGGCAGGTGTCCGGGCGGAGGGG - Intergenic
972633024 4:40857817-40857839 GGGGAGGGGTGGTTGGGGAAGGG + Intronic
974265709 4:59583845-59583867 GGACAGAGCTCCTTGGGGAAGGG - Intergenic
975820496 4:78266262-78266284 GAGGAGGTCTCCTTGGGGATGGG - Intronic
977753024 4:100632353-100632375 TGGCTGGTAACCTTGGGGAATGG + Intronic
978340903 4:107720374-107720396 GGGCAGAGGTCTGTGGGGAAGGG + Exonic
978407273 4:108394016-108394038 GGGCAGGGATCATGGGGGAAGGG - Intergenic
981040864 4:140220228-140220250 AAGCAGCTGTCTTTGGGGAACGG + Intergenic
982116668 4:152104020-152104042 GGGTAAGTGACCTTGGGGAAGGG - Intergenic
982198038 4:152935974-152935996 AGCCAGGTGTCCTCGGGGAACGG - Intergenic
985668219 5:1192824-1192846 GGGGAGATGTCGTGGGGGAAAGG + Intergenic
985720688 5:1487091-1487113 GGGCAGGTGTTCCTCGGGAGTGG - Intronic
985890197 5:2709174-2709196 GGGCTGGTGTCCCTGGGCAGTGG - Intergenic
986083381 5:4417349-4417371 GTTTATGTGTCCTTGGGGAAGGG + Intergenic
986214857 5:5710155-5710177 GGGCAGGTGGGCTTTGAGAAGGG + Intergenic
986469297 5:8058505-8058527 GGGCAGGTGAGGTGGGGGAAAGG - Intergenic
986998329 5:13632915-13632937 GGGAATTTGTCCTTAGGGAAGGG - Intergenic
987287470 5:16471511-16471533 GGGCAGGTGTGTGTGTGGAAAGG - Intergenic
988897773 5:35696824-35696846 GGGCAGGCCTCCTTGGGAAAGGG + Intronic
995445227 5:112235326-112235348 GGGCAGGTTTCCCTGGGGCTGGG + Intronic
996802034 5:127414945-127414967 GGGAAGGTTTCTTTGAGGAAGGG + Intronic
997206042 5:132050785-132050807 CGACAGGTCTCCTTGGGGAAAGG + Intergenic
998041513 5:138953591-138953613 GGGCCAGAGTCCCTGGGGAAGGG + Intronic
998231412 5:140363580-140363602 GGGTAGGTGACCTGGGGGAGGGG + Intronic
999727094 5:154446246-154446268 GGCCCGGAGTCCTTGGGGAGCGG + Exonic
1001435267 5:171694982-171695004 GGGCTGAGGTCCTTGGGGCAGGG - Intergenic
1002104652 5:176874167-176874189 GGGCAGGAGTGCTGGGGGCACGG - Intronic
1004720403 6:18264077-18264099 GGGCAGGTGTCCCGCGGGAAGGG - Intronic
1006854399 6:37123249-37123271 GGCCAGGTGTCAAGGGGGAAGGG + Intergenic
1007257974 6:40541829-40541851 GGGCATGTGTCTATGGGGAGGGG - Intronic
1008489350 6:52069425-52069447 GGGAAGGGGTACTTGGTGAAGGG + Intronic
1009029242 6:58036681-58036703 GTGCAGGTGTCTGTGGGGGAAGG + Intergenic
1009204781 6:60788077-60788099 GTGCAGGTGTCTGTGGGGGAAGG + Intergenic
1009241495 6:61191748-61191770 GGGCATGTCCACTTGGGGAATGG - Intergenic
1009978788 6:70701683-70701705 GAGAATGTGTGCTTGGGGAAGGG - Intronic
1010391899 6:75347221-75347243 TGGCAAGTGTCCTTGGGGGAAGG + Intronic
1013600022 6:111695027-111695049 GTGCAGGGGTGATTGGGGAATGG - Intronic
1014631451 6:123795311-123795333 GGCCAGGTCCCCTTGAGGAAGGG + Intergenic
1018953058 6:168391518-168391540 GGACAGGTGTGCTGGGGGATGGG - Intergenic
1018953083 6:168391627-168391649 GGACAGGTGTGCTGGGGGATGGG - Intergenic
1018953132 6:168391816-168391838 GGACAGGTGTGCTGGGGGATGGG - Intergenic
1018953148 6:168391870-168391892 GGACAGGTGTGCTGGGGGATGGG - Intergenic
1018953227 6:168392167-168392189 GGACAGGTGTGCTGGGGGATGGG - Intergenic
1018953248 6:168392247-168392269 GGACAGGTGTGCTGGGGGATGGG - Intergenic
1018953269 6:168392330-168392352 GGACAGGTGTGCTGGGGGATGGG - Intergenic
1019131887 6:169883016-169883038 GGGAAGGTGCCTTTGTGGAAAGG - Intergenic
1019574980 7:1733284-1733306 CGACAGGTGGCCTTGGGGAGTGG + Intronic
1019643566 7:2117246-2117268 GGGAAGGTGCCCTTGGGAATGGG - Intronic
1019785224 7:2972535-2972557 GGGCAGGGGTTGTAGGGGAAAGG + Intronic
1020132915 7:5569748-5569770 TGGCAGGAGACCTTAGGGAAGGG + Intergenic
1021436626 7:20624872-20624894 GGCCAAGTGTCCTTTGGCAAAGG - Intronic
1022523150 7:31020645-31020667 GGGCAGGTGTCCTGGAGGAGAGG + Intergenic
1023100319 7:36711444-36711466 GGGCCTGTGACTTTGGGGAAAGG - Intronic
1023868099 7:44248418-44248440 GTGGAGCTGTCCCTGGGGAAGGG - Intronic
1024118580 7:46215294-46215316 GGGCTGGTGTCCTGCAGGAAAGG - Intergenic
1026827843 7:73595398-73595420 AGGGAGGAGTCCTTGGGTAAGGG - Intronic
1027246246 7:76369542-76369564 GGAGAGGTGACCTTGGGGAATGG - Intergenic
1027389795 7:77693467-77693489 TGGCAGGTGAACTTGGGGATGGG + Intergenic
1029643491 7:101836468-101836490 GGGCAGGTGGGGTTGGGGGAAGG - Intronic
1030173203 7:106625527-106625549 GGGCGGGTGTTCTTGGGAACAGG + Intergenic
1033790303 7:144785111-144785133 GGGAAGCTGTCCCAGGGGAATGG + Intronic
1033882585 7:145903277-145903299 GCGCATGTGTGCTTGGGGAGGGG + Intergenic
1034089771 7:148352903-148352925 GGCCAGGGGACTTTGGGGAAAGG - Intronic
1034315447 7:150126897-150126919 AGGCAGGAGTTCTTAGGGAAAGG - Intergenic
1034429503 7:151034081-151034103 GGGCAGGGTTCCGTGGGGACTGG + Intronic
1034589370 7:152127034-152127056 CGGCAGGGGTCCCTGGGGGAGGG + Intergenic
1034791443 7:153973897-153973919 AGGCAGGAGTTCTTAGGGAAAGG + Intronic
1035325756 7:158064840-158064862 TGTCGGGTGTCCCTGGGGAAAGG + Intronic
1035406773 7:158604023-158604045 GGGCAGGTGTCATTGGGCAGTGG - Intergenic
1035577540 8:717366-717388 GGGCAGGTATGCTTGAGGCAAGG - Intronic
1037957289 8:23069412-23069434 GGGCAGGTGCCCCTGGGAAGGGG - Intergenic
1038195885 8:25367232-25367254 GCGCAGCTGTTCTTGGGGATGGG - Intronic
1040916330 8:52569253-52569275 CTGGAGGTCTCCTTGGGGAAGGG + Intergenic
1041152099 8:54945225-54945247 GGGCAGGGATTCCTGGGGAAAGG - Intergenic
1045210777 8:100097138-100097160 TAGCAGGTGTCTCTGGGGAATGG + Intronic
1045405953 8:101867056-101867078 GGCCTGGTGTGCTTGAGGAACGG - Intronic
1047058789 8:121198317-121198339 TGGGCTGTGTCCTTGGGGAAGGG + Intergenic
1047775563 8:128067586-128067608 GGGGAGGCTTCCTGGGGGAAAGG + Intergenic
1049183897 8:141238685-141238707 GAGCAGGTCTCTGTGGGGAATGG - Intronic
1049362658 8:142219682-142219704 GAGCAGAGGTCCTGGGGGAATGG + Intronic
1049522869 8:143103296-143103318 GGGCAGGGGGACTAGGGGAATGG + Intergenic
1049545766 8:143229806-143229828 GAGCAGGTGACCCCGGGGAATGG - Intergenic
1049735802 8:144203638-144203660 GGTCAGTGGTCCTTGGGGAAGGG + Intronic
1049762287 8:144336925-144336947 GGGCGGGGGTCCTGGGGGGAGGG + Intergenic
1051840847 9:21396234-21396256 GCGCGGGTCTCCTTGAGGAAGGG + Intergenic
1052300476 9:26947387-26947409 GGTCAGGCGTCCTGGTGGAAGGG - Exonic
1053282463 9:36829823-36829845 GGGCAGGTGTCACTGGGGTTAGG + Intergenic
1057139437 9:92717749-92717771 GGACAGCTGGCCTTGTGGAAGGG + Intronic
1058973371 9:110103088-110103110 GGGGAGGTTTCCATGAGGAAGGG - Intronic
1058990295 9:110249404-110249426 AGGCAGGTGTGCTAGGTGAAGGG + Intronic
1059069774 9:111123275-111123297 CGGCAGGTCACCTTGGGAAATGG + Intergenic
1059329903 9:113528344-113528366 GGGCAGGTGTCCTGGAGGGAGGG + Intronic
1059530419 9:115030369-115030391 TGGGAGCAGTCCTTGGGGAAGGG + Exonic
1060425773 9:123504245-123504267 GGGCAGGTGTCCCAGAGGAGGGG - Intronic
1060780509 9:126408932-126408954 GGACAGGTGTCCTTGGGGAGGGG - Intronic
1060828352 9:126699109-126699131 GGCCAGGTCTCCTGGGGGATAGG - Exonic
1061048594 9:128180868-128180890 GGGCAGCTGCCCTTGGGCAAGGG - Intronic
1061431705 9:130535543-130535565 GGGCAGGGGTCCTGGGAGGAGGG - Intergenic
1061878081 9:133554742-133554764 GGGAAGGGGGCCTTGGGGAAGGG + Intronic
1061907836 9:133707962-133707984 GGGCAGGGGTCCTGGGGGCGGGG - Intronic
1062158248 9:135065999-135066021 GAGTAGGTGGCTTTGGGGAAAGG - Intergenic
1062275553 9:135728675-135728697 GGGCAGGGGTCCTGGGAGAGGGG + Intronic
1203627155 Un_KI270750v1:34779-34801 GGCCAGGTGTACTTGGCCAAGGG + Intergenic
1187474497 X:19599099-19599121 GGGTAGGTGTCCTTGGGACTTGG - Intronic
1189277510 X:39797485-39797507 GGGCAGCTTTCCTCTGGGAAGGG + Intergenic
1190723668 X:53172147-53172169 TGGCAGGTGCCCTGGGGAAAGGG + Intergenic
1191902073 X:66051907-66051929 GGGAGGGAGTACTTGGGGAAGGG - Intergenic
1192138945 X:68631161-68631183 GGGGAGCTGTGCTTGAGGAAAGG - Intergenic
1192146844 X:68688132-68688154 GGGGAGCTGTGCTTGAGGAAAGG + Intronic
1192890046 X:75380753-75380775 GGGCAGGTGTAGTTGGGGGAAGG - Intronic
1192928388 X:75780043-75780065 GGGCAGCAATCCTTGGGGCAGGG + Intergenic
1193488519 X:82117701-82117723 GGGCAGGAGTGCATGGAGAAAGG - Intergenic
1193707256 X:84836853-84836875 GGACAGGTGTCTATGGGGAAAGG + Intergenic
1195142905 X:101981280-101981302 AGGAATGTGTGCTTGGGGAATGG + Intergenic
1198369325 X:135974522-135974544 GGGCTGGGGGCGTTGGGGAAAGG + Intergenic
1198680859 X:139180761-139180783 GTGCAGTTGTCCTTTGGGGAGGG - Intronic
1199337457 X:146636329-146636351 GGGCTGGGGTGCTGGGGGAATGG + Intergenic
1200088484 X:153623473-153623495 GGGCCGGTGTCCTTGCAGAGGGG - Intergenic
1200091775 X:153639349-153639371 GGGCAGGGCTCCTTTGGGAGCGG + Intergenic
1200119755 X:153784682-153784704 GGGCAGGAGTCCGTGGGGGCAGG + Intronic
1202070978 Y:20991245-20991267 GGGCAGTTAGCCTTGGTGAAGGG - Intergenic
1202115720 Y:21467725-21467747 CGGCGGGTGTCCTGGGGAAAGGG - Intergenic