ID: 901512558

View in Genome Browser
Species Human (GRCh38)
Location 1:9724703-9724725
Sequence GGCAGGTGTCCTTGGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 479}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512549_901512558 -3 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512558 1:9724703-9724725 GGCAGGTGTCCTTGGGGAAGGGG 0: 1
1: 0
2: 4
3: 65
4: 479
901512544_901512558 5 Left 901512544 1:9724675-9724697 CCTTGTGTCCACCCATTATCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 901512558 1:9724703-9724725 GGCAGGTGTCCTTGGGGAAGGGG 0: 1
1: 0
2: 4
3: 65
4: 479
901512550_901512558 -6 Left 901512550 1:9724686-9724708 CCCATTATCAGGGCAAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 220
Right 901512558 1:9724703-9724725 GGCAGGTGTCCTTGGGGAAGGGG 0: 1
1: 0
2: 4
3: 65
4: 479
901512552_901512558 -7 Left 901512552 1:9724687-9724709 CCATTATCAGGGCAAGGGCAGGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 901512558 1:9724703-9724725 GGCAGGTGTCCTTGGGGAAGGGG 0: 1
1: 0
2: 4
3: 65
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512558 Original CRISPR GGCAGGTGTCCTTGGGGAAG GGG Intronic
900408831 1:2503908-2503930 GGCGGGTGTCTGTGGGGAGGTGG - Exonic
900474639 1:2870372-2870394 GGCAGGCTTCCTGGAGGAAGAGG - Intergenic
900507837 1:3038628-3038650 AGCAGGTGAACTTGGGGCAGTGG - Intergenic
900550280 1:3251167-3251189 GGCAGGGGTGGGTGGGGAAGGGG - Intronic
901005754 1:6170825-6170847 AGCAGGTGTCGGTGGGGCAGTGG + Intronic
901018809 1:6245784-6245806 GCCAGGGGTCCCTGGGAAAGGGG - Intergenic
901091503 1:6644727-6644749 GGCAGCTGTCATTTGAGAAGAGG + Intronic
901275434 1:7987338-7987360 TGAAGGAGTCCTTGGGGGAGGGG + Intergenic
901512558 1:9724703-9724725 GGCAGGTGTCCTTGGGGAAGGGG + Intronic
902223940 1:14984654-14984676 GCCAGGTCTCCTTGGACAAGTGG + Intronic
902225681 1:14995091-14995113 GGCAGCTGCCCTGGAGGAAGAGG + Intronic
902512309 1:16973056-16973078 GGGAGGGGTGCTTGGGGAGGCGG + Intergenic
902930891 1:19730732-19730754 GGCAGCTTTTCCTGGGGAAGGGG + Intronic
903121082 1:21217557-21217579 GGCAGGTGTCCTAGGGCTGGGGG - Intronic
903852210 1:26314826-26314848 GGAAAGTTTCCCTGGGGAAGGGG + Intronic
904011167 1:27391460-27391482 GGCAGATGGCGTTGGGGAAGAGG + Intergenic
904090494 1:27941687-27941709 AGGAGGTGACCTTGGGGCAGAGG + Intronic
904279409 1:29408414-29408436 GTCAGATGTCCTTGGGTAACAGG + Intergenic
905012487 1:34756835-34756857 AGCAGGTTCCCCTGGGGAAGGGG + Intronic
905171906 1:36114675-36114697 GGGAGGTGTGGGTGGGGAAGAGG - Intronic
905343555 1:37295753-37295775 GCCAGGTGACCCTAGGGAAGGGG + Intergenic
905868653 1:41390594-41390616 AGGAGGTGTCCTTGGGGATGTGG + Intergenic
905883844 1:41481276-41481298 GGCAGGTGGGGATGGGGAAGGGG - Intronic
905938166 1:41841165-41841187 GGCAGGTGTGCTGGGGGCACTGG - Intronic
906288790 1:44605881-44605903 GGCCGGTGCCCGTGGGGCAGAGG - Intronic
906414141 1:45606512-45606534 GGAAGGTGTGCATGTGGAAGAGG + Exonic
907635404 1:56129778-56129800 GGCAGGTGTGTTTGGGGAGTTGG - Intergenic
907754140 1:57293561-57293583 GCCAGGTGGCCTTGAGCAAGTGG - Intronic
908599135 1:65719849-65719871 GATAGGTGTCCTTGTGGCAGGGG + Intergenic
908715040 1:67060907-67060929 GGCATGTGTTCTTGTGTAAGCGG + Intergenic
909545530 1:76842314-76842336 GGTAGGTGTCCCTGAAGAAGTGG - Intergenic
909595740 1:77404363-77404385 GCCACGTTTCCTTGGGGGAGTGG + Intronic
910010268 1:82452836-82452858 GGTAGGTGTGCTGGGGAAAGAGG - Intergenic
912671987 1:111637983-111638005 GGTGGCTGTCCTTGGGGAAATGG - Intronic
913435339 1:118841709-118841731 GGCTGGTGTGCATGAGGAAGGGG - Intergenic
913469930 1:119177434-119177456 GGCACTGGTCCCTGGGGAAGAGG - Intergenic
913532550 1:119743067-119743089 GGCTGGTGTCCTTGAGGCTGGGG + Intronic
913974660 1:143445652-143445674 GGCAGGTGGCCTTGTGGACGGGG + Intergenic
914069051 1:144271268-144271290 GGCAGGTGGCCTTGTGGATGGGG + Intergenic
914110104 1:144695086-144695108 GGCAGGTGGCCTTGTGGATGGGG - Intergenic
914438744 1:147682414-147682436 TGCTGGTGTCCTTGGGTGAGTGG - Intergenic
915094526 1:153451738-153451760 GGAAGGTGTCCGTGGTGGAGTGG + Intergenic
915457100 1:156048294-156048316 AGCAGAGGTCCTTGTGGAAGTGG - Intronic
915518972 1:156430428-156430450 GGAAGGGGGCCGTGGGGAAGGGG - Intronic
917701586 1:177587226-177587248 GGCAGGTGTCCACGGGGACACGG - Intergenic
918088138 1:181262790-181262812 GGAAGGAGTCCTAGGGGAAGGGG + Intergenic
918139962 1:181711815-181711837 GACAGCTGTCATGGGGGAAGTGG + Intronic
918464766 1:184810028-184810050 AGGAGGTGGCATTGGGGAAGGGG + Intronic
920087046 1:203425046-203425068 GCCAGGTGTGTTTGGGGAATTGG + Intergenic
920254742 1:204646888-204646910 GCCAAGTGTCCTTGAGCAAGTGG - Intronic
921065690 1:211620723-211620745 GGGAGGTGGCACTGGGGAAGGGG + Intergenic
921599165 1:217089090-217089112 AGCAGGGGTCGTTGGGGGAGAGG - Intronic
922558728 1:226551554-226551576 GCCAGGAGGCCTTGGAGAAGTGG - Intronic
923559128 1:235025160-235025182 GGCAGGAGGCCTGTGGGAAGGGG + Intergenic
1063141808 10:3262518-3262540 GGCAGATGTCCTGGCAGAAGTGG + Intergenic
1063425865 10:5949583-5949605 GGAAGAAGTCCTTGGGGAACAGG + Intronic
1064960928 10:20964272-20964294 GGCAGGAATTCTTGGGAAAGGGG + Intronic
1067762017 10:49055547-49055569 GGCAGCTGACCTTGGGGAGAAGG - Intronic
1069461629 10:68600258-68600280 GGCAGGTCTGCATGGGGGAGGGG - Intronic
1069922161 10:71822299-71822321 ACCAGGTGTCCTTGGAGATGTGG - Intronic
1070512410 10:77173617-77173639 GCCAGGTGTCCTTAGGAGAGTGG - Intronic
1071256786 10:83878587-83878609 GGCTGCAGTCCTTGGGGCAGTGG - Intergenic
1071455718 10:85850058-85850080 AGCAGCTGTCCTTGGGCAGGAGG - Intronic
1072394648 10:95026385-95026407 GACAGGGGACCTGGGGGAAGGGG - Intergenic
1073799597 10:107026697-107026719 AGCAAGTGTCATGGGGGAAGCGG + Intronic
1074106613 10:110393795-110393817 GGCAGGTGTCCGTGTGTGAGGGG - Intergenic
1074476917 10:113781776-113781798 GGAAGGAGTTGTTGGGGAAGGGG - Intronic
1074774552 10:116757438-116757460 GTCAGGTGACCTTGGGAGAGGGG - Intergenic
1075341458 10:121649724-121649746 GGCTGGTGTCCCTAAGGAAGAGG - Intergenic
1075451962 10:122557696-122557718 GGCAGGTGGCCCTAGGGGAGGGG + Intergenic
1076738137 10:132467856-132467878 GGCAGGTGGCCTTGGTGGACGGG - Intergenic
1077065650 11:640002-640024 CGCAGGGGTCCTGGGGGAGGCGG - Exonic
1077172911 11:1176367-1176389 GGCAGGGGTCCTCTGGGACGTGG - Intronic
1077333784 11:1994536-1994558 GGCAGGTGGCCTTGGGGCAGAGG - Intergenic
1077477632 11:2797867-2797889 GGCAGGTGCCCAAAGGGAAGAGG - Intronic
1077890178 11:6412886-6412908 GGGAGCTGTCCTTGCGGAACAGG - Intronic
1078047662 11:7931615-7931637 GGCAGGTGACCTAGGGCTAGAGG + Intergenic
1078107346 11:8366544-8366566 GCCAAGTGACCTTGGGCAAGTGG + Intergenic
1081515742 11:43827067-43827089 AGCAGGTTTCTTTGGGGTAGAGG + Intronic
1081580133 11:44346421-44346443 GTCAGGAGTCCTTGAGGCAGGGG + Intergenic
1081980040 11:47260590-47260612 TGTAGGTGTCCATGGGGCAGTGG - Exonic
1083326658 11:61876391-61876413 GGCCGATCTCCTTGGGGATGTGG + Exonic
1083596588 11:63920665-63920687 GGGAGGTGACCCTGGGGAAATGG + Intergenic
1083673932 11:64315152-64315174 GGCAGCTGGCCTGGGGGAACTGG + Exonic
1083675062 11:64320649-64320671 GGCAGGTGTGTCTGAGGAAGGGG - Exonic
1083859252 11:65411293-65411315 GGCAGCTGTCCTTGGGCCAGGGG + Exonic
1083955123 11:65978689-65978711 GGTGGGTGCCCTTGGGGATGTGG + Exonic
1084215171 11:67643147-67643169 GGCATGTGCCCATGTGGAAGTGG + Intronic
1084424298 11:69076358-69076380 GGCAGGTGGCCTTTGGGCACTGG + Intronic
1084464609 11:69314867-69314889 GGAAGGGGGCCTTGGGGAGGAGG - Intronic
1084556494 11:69879165-69879187 GGGAGGGGGCCTGGGGGAAGAGG + Intergenic
1084887539 11:72220995-72221017 GACAGGTGTCCTGGATGAAGTGG - Exonic
1084945170 11:72634392-72634414 CTCAGGTGTCCCAGGGGAAGTGG + Intronic
1084954245 11:72683088-72683110 GCCAGGTGTGGTTGGGGTAGAGG - Intergenic
1085515397 11:77108525-77108547 GGCTGGTGTCCGTGGTGATGGGG + Intronic
1086051820 11:82601241-82601263 GACAGCTGTCTTTGAGGAAGCGG - Intergenic
1087484894 11:98748437-98748459 GACAGATCACCTTGGGGAAGGGG + Intergenic
1087777706 11:102271739-102271761 GGCTGGGGTCATTGGGGAAATGG - Intergenic
1088817935 11:113434076-113434098 GGAAGGCTTCCTTGGAGAAGGGG - Intronic
1089462582 11:118661719-118661741 AGTAGGAGTCCCTGGGGAAGGGG + Exonic
1089681342 11:120120606-120120628 GGGTGGTCTCCTTGGTGAAGCGG + Exonic
1089692782 11:120197304-120197326 GGCTTGTGTCCCTGGGGAAATGG - Intergenic
1089833301 11:121348061-121348083 AGCAGCTGGCCTTGGGAAAGGGG - Intergenic
1090433736 11:126668507-126668529 GGGAGCTGCCCCTGGGGAAGAGG + Intronic
1090645644 11:128764903-128764925 GGCGGGTGTCCTTAGGGAGAAGG - Intronic
1091082472 11:132683809-132683831 GGCAAGGGACCTTGGGAAAGTGG + Intronic
1091271451 11:134314408-134314430 GGAAGGTGTCCTTGGGAGAAGGG - Exonic
1202816765 11_KI270721v1_random:49718-49740 GGCAGGTGGCCTTGGGGCAGAGG - Intergenic
1091462095 12:651318-651340 CCCAGGTGACCTGGGGGAAGGGG + Intronic
1091766417 12:3122985-3123007 GTCAGGGGTCCCTGGGGGAGAGG + Intronic
1092019499 12:5189149-5189171 GGAAGGCCTCCTTGAGGAAGTGG + Intergenic
1092181733 12:6451173-6451195 GGCGGGTGCGCTTGGGGGAGGGG - Intronic
1093435676 12:19130937-19130959 GGAGGGAGTCCGTGGGGAAGCGG + Intronic
1096195435 12:49646444-49646466 TGCATGTGTCCTTAGGGAAGTGG - Intronic
1096771048 12:53936294-53936316 GGCTGGTCTTCTTGAGGAAGAGG + Intergenic
1097057356 12:56258075-56258097 AGCCGGTGTCCTTGGGGACCTGG - Intronic
1097782531 12:63724530-63724552 GGTAGGTGTGGGTGGGGAAGTGG + Intergenic
1098751509 12:74298304-74298326 GGCAGATGTTGTTGGGGCAGGGG - Intergenic
1100708769 12:97231004-97231026 GGCAGGTGGCCCAGGGGATGGGG + Intergenic
1101639793 12:106579650-106579672 GGCAGGCCTCCTGGAGGAAGTGG - Intronic
1101966717 12:109287138-109287160 GCCACGTGGCCTTGGGGAAGTGG - Intronic
1102520188 12:113472930-113472952 GGCAGGTGTGCGTGAGGAGGGGG + Intergenic
1102752789 12:115310350-115310372 GGCAGGTGGATTTTGGGAAGGGG - Intergenic
1102954447 12:117050522-117050544 GGCTGGTGTTCTGGGGGATGGGG + Intronic
1103305080 12:119957664-119957686 TGCAGGAGTCATTGGGGAAGTGG + Intergenic
1104109277 12:125689985-125690007 GGGATGGGTCCTTAGGGAAGTGG - Intergenic
1104926688 12:132317478-132317500 CGCAGGTCTCCTTGGTGAGGTGG - Intronic
1104928254 12:132324900-132324922 GGCTGGAGGGCTTGGGGAAGGGG - Intronic
1104968924 12:132522378-132522400 GGGAGGGGACCTTGGGGGAGGGG + Intronic
1105285247 13:18998231-18998253 CTCAGGTGTCCTTGAGGGAGTGG - Intergenic
1105344423 13:19560369-19560391 GGCAGCTGGCCTGGGGGAACTGG - Intergenic
1105473422 13:20711736-20711758 AGCAGATGACATTGGGGAAGAGG + Intronic
1105530347 13:21213378-21213400 GGCAGGTGTCGGTGAGGATGTGG + Intergenic
1105535610 13:21261205-21261227 GGCAGCTGGCCTGGGGGAACTGG + Intergenic
1105849767 13:24323335-24323357 GGTAGGTGTCCTAGGGGCCGAGG + Intergenic
1106798928 13:33235882-33235904 AGCAGGTGTGCTTGGGCAGGTGG + Intronic
1106910915 13:34462912-34462934 GGCAGGCGACCTTTGGGGAGTGG + Intergenic
1108446992 13:50519479-50519501 GGCAGATGTGGTTGGGGAGGGGG - Intronic
1110466922 13:75813024-75813046 GCCACATGTCCTTGGGAAAGCGG - Intronic
1112639052 13:101252215-101252237 GGCAGTTGTGCTTGGTGATGGGG - Intronic
1113034810 13:106037312-106037334 GGCAGCTGTCCTTAGAGAAAGGG - Intergenic
1113074517 13:106454755-106454777 GACAGCTGTCCCTGAGGAAGAGG - Intergenic
1113162050 13:107392618-107392640 GGCAGGTGTCTTTAGGGGTGAGG + Intronic
1113711252 13:112466847-112466869 GGCTGGTGTCCTGGGGGAGGAGG - Intergenic
1113738411 13:112694156-112694178 GCCATGTGGCCTTGGGCAAGTGG + Intronic
1114031790 14:18585435-18585457 GACTGGTGTTCTTGGGGAACTGG + Intergenic
1114076562 14:19164464-19164486 GACTGGTGTTCTTGGGGAACTGG + Intergenic
1114085602 14:19235104-19235126 GACTGGTGTTCTTGGGGAACTGG - Intergenic
1115096999 14:29649265-29649287 GGCAGGTAGCCTTGGTAAAGGGG + Intronic
1115596149 14:34911169-34911191 GGCAGGTATTCTTGGGGCAAAGG + Intergenic
1117045870 14:51812879-51812901 AGCAGTTGTCATTGGGGAACAGG - Intergenic
1117441281 14:55761900-55761922 GGAAGGTCTCCATGGGGAGGTGG - Intergenic
1118121956 14:62855611-62855633 GGCAGAGGTCCTGGAGGAAGAGG + Intronic
1118367436 14:65107963-65107985 GGGAGCTGTCCTTGGGGAAGAGG + Intergenic
1118367452 14:65108001-65108023 GGGGGCTGTCCTTGGGGAGGGGG + Intergenic
1119729445 14:76941808-76941830 CTCTGGTGTCCTTGGGGAAAGGG - Intergenic
1121731761 14:96192434-96192456 GCCATGGGTCCTTGGGCAAGAGG - Intergenic
1121884303 14:97528948-97528970 GTCAGATGTCCCTGGGGTAGTGG + Intergenic
1121899041 14:97675165-97675187 GGCAGAGCACCTTGGGGAAGGGG + Intergenic
1122028791 14:98897620-98897642 GGCTTGTGACCTTGGGCAAGGGG - Intergenic
1122149770 14:99718585-99718607 GGAGGGTGTCCCTGGGGAGGTGG + Intronic
1122298349 14:100718013-100718035 GGCAGGTGGGTTTGGGGAAATGG - Intergenic
1122357687 14:101133329-101133351 GGGAGGTGAACTTGGGGCAGAGG + Intergenic
1122602696 14:102929472-102929494 GGCAGGCGGCCTGGGGGCAGCGG - Exonic
1123023575 14:105413200-105413222 GGCAGGTGTCCTTAAGGGTGTGG + Exonic
1123037553 14:105477668-105477690 GGCAGGTGTGTGGGGGGAAGCGG + Intronic
1124661864 15:31556275-31556297 CGCAGGAGGCCTTGAGGAAGTGG - Intronic
1125207600 15:37172040-37172062 GGTTAGTGTCCTTGGGGAAGAGG + Intergenic
1125782647 15:42283870-42283892 GCCAGTTGTCCTTGGGGAACAGG + Intronic
1127122930 15:55786729-55786751 GGCAGATGAGCATGGGGAAGGGG + Intergenic
1128063203 15:64748153-64748175 GGCAGGGGTGCTTGGGGCTGGGG + Intronic
1128155572 15:65389622-65389644 GGAAGGTTTCCTGGAGGAAGGGG - Intronic
1128514161 15:68331836-68331858 GTCAGGCTTCCCTGGGGAAGCGG - Intronic
1129168068 15:73790487-73790509 GGCATGTGCACATGGGGAAGTGG + Intergenic
1129450994 15:75651368-75651390 TGGACGTGTCCTTGGGGAGGTGG - Intronic
1129681805 15:77662373-77662395 GGCTGGAGCCCTTGGGGATGAGG + Intronic
1129882468 15:79016462-79016484 GGCAGGAGGGCTTGGGGAAGGGG + Intronic
1131432642 15:92399066-92399088 GGCAGGTGACCTTGTGTAACAGG - Intronic
1132075529 15:98816784-98816806 GGCAGCTTTCTTTGGGGAGGTGG + Intronic
1132633857 16:933410-933432 GGCCTGTGTCCTTGCGGTAGAGG - Intronic
1132677266 16:1125950-1125972 GGCAGGTGCCCTGGGGCAACAGG - Intergenic
1133041723 16:3064587-3064609 GACTGGTGTCCTTTGGAAAGGGG + Intergenic
1133110921 16:3548005-3548027 GCCAGCTGGCCTTAGGGAAGAGG + Intronic
1133271538 16:4613064-4613086 GGTAGGTGTCCGGTGGGAAGCGG - Intronic
1133701646 16:8314843-8314865 GACAGGTGTCCTTACAGAAGAGG - Intergenic
1133841675 16:9415794-9415816 TGCAGGTGGCGTGGGGGAAGAGG + Intergenic
1134233264 16:12445896-12445918 GCTTAGTGTCCTTGGGGAAGTGG - Intronic
1135475893 16:22774553-22774575 GGCAGGTGGCCCTGGGGAGGGGG + Intergenic
1135776338 16:25259914-25259936 GTCAGGTGTCCTTAATGAAGGGG + Intergenic
1138100238 16:54246480-54246502 AGCAGGTGGCATTGGAGAAGTGG + Intronic
1138293271 16:55866200-55866222 GGCAGGGGTCAGTGGGGAGGGGG + Intronic
1138328505 16:56193712-56193734 GGCAGGTTTGCTTGGGGAGGGGG + Intronic
1138389600 16:56660710-56660732 CGCAGGTGCCCTTTGTGAAGAGG + Intronic
1139130758 16:64141505-64141527 GAGAGGGGTCCTTTGGGAAGTGG + Intergenic
1139222569 16:65199152-65199174 GGCATGAGTCCTGGGGGAGGAGG + Intergenic
1139653192 16:68372801-68372823 GGCAGGTGACCCTGGGTCAGAGG + Intronic
1139836064 16:69839495-69839517 GCCTGGTATCCTTGGGGACGGGG + Intronic
1140334797 16:74095153-74095175 GGAAGGTGTCTTTGAGGAAGTGG - Intergenic
1140612526 16:76618498-76618520 GGAAGGTGGCCTTCGGGCAGAGG + Intronic
1140895302 16:79319477-79319499 AACAGTTGTGCTTGGGGAAGGGG - Intergenic
1140928935 16:79609349-79609371 GGCAGTTGGGGTTGGGGAAGAGG + Intergenic
1141449609 16:84089178-84089200 GGAAGGTGTACATGGGGAAGTGG + Intronic
1141634199 16:85305058-85305080 GGCATGTGCCCTAGGGGAATGGG - Intergenic
1141652115 16:85398241-85398263 TTCAGGCGTCTTTGGGGAAGTGG + Intergenic
1142157196 16:88537993-88538015 GACAGGTGGGCTTGGGGGAGGGG - Intergenic
1142494652 17:299892-299914 GGCAGGTGTCCCGGGGGAGAAGG + Intronic
1142554442 17:763780-763802 GGTAGGTTTCCTAGGTGAAGAGG + Intronic
1142610855 17:1108740-1108762 GACCGGTGTCCTCGGGGCAGTGG - Intronic
1142967882 17:3592287-3592309 GGCAGGTGTCCTTTTGGAGTGGG + Exonic
1143275028 17:5703965-5703987 GGCAGATGTGCATGGAGAAGGGG - Intergenic
1143311752 17:5997744-5997766 GCCTGCTGCCCTTGGGGAAGGGG - Intronic
1143401278 17:6645451-6645473 AGCAGGTTTCCTTGGAGAAAAGG + Intronic
1143404635 17:6669101-6669123 GGCAAGTCTCCTTGGGGAGGTGG - Intergenic
1143950939 17:10631727-10631749 GGCTGGTGTTCTAGGGCAAGAGG + Exonic
1144337624 17:14285876-14285898 GTCAGATGTCCTTTGAGAAGGGG + Intergenic
1144656454 17:17040292-17040314 GGGAGGTGGCCTTGAGGAATGGG + Intergenic
1144954411 17:19011838-19011860 GCCAGCTGGCCTGGGGGAAGGGG + Intronic
1146727308 17:35166765-35166787 GGCAAGTTCCCCTGGGGAAGAGG - Intronic
1147328647 17:39683358-39683380 GGAAGGCTTCCCTGGGGAAGGGG - Intronic
1147555946 17:41479206-41479228 AGCAGGTGTGCATAGGGAAGAGG - Intronic
1147792919 17:43024758-43024780 GGCAGGGGGTCTTGGGGAAATGG - Intronic
1147910210 17:43851546-43851568 GACAGATGGACTTGGGGAAGTGG + Intronic
1148740775 17:49891076-49891098 GGCAGGCTTCCTGGAGGAAGAGG - Intergenic
1148785142 17:50142565-50142587 AGCAGGTGTCCTTTGGGATCTGG - Intronic
1148894619 17:50832675-50832697 GCCTGGTGTCCTTGGGGAAAGGG + Intergenic
1149519730 17:57309727-57309749 GGAAGGAGTCGTTGGGGAAGAGG + Intronic
1149651799 17:58280442-58280464 GGCAGCTGTCCTGGGGGAGGTGG - Exonic
1149684940 17:58529907-58529929 GTCAGGTGTCCTAGGGTAAGGGG - Intronic
1149996857 17:61410215-61410237 GGCAGCTGTCCTTGCAGGAGTGG - Intergenic
1151221351 17:72615374-72615396 GTCAGGTGTACCAGGGGAAGGGG + Intergenic
1151334678 17:73432944-73432966 GGCAGATGGCCTTAGGGAGGTGG + Intronic
1151705158 17:75763499-75763521 GGCAGGTGTCCTGGCGGGAAGGG + Intronic
1151978976 17:77498080-77498102 GGCAGGTGGCCTGGGGCAAAGGG - Intronic
1152040192 17:77897984-77898006 GGCATCTGTCCTTTGTGAAGGGG - Intergenic
1152119778 17:78411368-78411390 GGCAGGCGTCCTTTCTGAAGAGG + Intronic
1152238995 17:79151979-79152001 GACAGGGGGCCTTGGGGATGGGG - Intronic
1152255238 17:79235289-79235311 GCCTGGTCTCCTCGGGGAAGGGG - Intronic
1152524393 17:80879331-80879353 GGCAGGTGGCGTTGGGCAGGAGG - Intronic
1152585230 17:81186289-81186311 GACAGGGGTGCCTGGGGAAGGGG - Intergenic
1152916006 17:83036344-83036366 AGCAGCTGCCCTTGGGGAAGGGG + Intronic
1153118756 18:1693980-1694002 ATCAGGTCTCCTTGGAGAAGTGG - Intergenic
1153816977 18:8799093-8799115 GGCAGGTGGCCACGGGGATGCGG + Intronic
1154977369 18:21473026-21473048 GGCAGGTGTCCTTGTAGACTTGG + Exonic
1155447714 18:25929429-25929451 GGGAGGTGTCCTTTCGGAAGTGG - Intergenic
1155595874 18:27486478-27486500 GGCTGGTGTCCTTCTAGAAGTGG - Intergenic
1156514662 18:37669765-37669787 CGCAGGTGGCCCAGGGGAAGGGG + Intergenic
1156600453 18:38599472-38599494 GGCAGATGTCTTTGGGGATTTGG - Intergenic
1157288243 18:46392270-46392292 TCCAGGTGTCTTTGGGCAAGAGG - Intronic
1157776472 18:50400561-50400583 TGCACGAGTCCTTGAGGAAGGGG - Intergenic
1157776712 18:50401980-50402002 TGCAGGGGTCTCTGGGGAAGGGG - Intergenic
1157972704 18:52288654-52288676 GGCTGGTGTCTTTGGGGAGAAGG - Intergenic
1160861042 19:1237371-1237393 GGCAGGAGGCCGAGGGGAAGAGG + Intronic
1161406102 19:4092046-4092068 GGCGGGTGCCCTTGGGGAAGAGG + Intronic
1161666511 19:5580262-5580284 GGCAGGGGGCCTTGGCCAAGTGG + Intergenic
1162654268 19:12117009-12117031 GGCAGGTGTCCTTCAGGGGGTGG - Intronic
1162782488 19:13013494-13013516 GGGAGGTGACCCTGGGGCAGCGG + Intronic
1162957427 19:14107111-14107133 GGCAGCTGTGCTGGGGGCAGGGG + Intronic
1162966895 19:14160399-14160421 GGCAGATGGCGATGGGGAAGTGG - Intronic
1163100519 19:15093285-15093307 GGGAGGCTTCCTTGAGGAAGTGG - Intergenic
1163604170 19:18265102-18265124 GGCACGTGTCCGTGGGGCTGTGG + Exonic
1163617809 19:18340236-18340258 GGCGAGTGACCTCGGGGAAGTGG + Intergenic
1163715566 19:18870396-18870418 GGCAGGGGTCCTGGGGGGCGTGG + Exonic
1164541869 19:29127533-29127555 GGGAGGTGTCTGTGGGGCAGAGG - Intergenic
1164733038 19:30520266-30520288 GGCATGTGTTCTCGGGGTAGGGG + Intronic
1164754849 19:30681812-30681834 CGGAGATGTCATTGGGGAAGGGG - Intronic
1165113109 19:33513519-33513541 GGGAGGTGGCCCTGGGGATGGGG - Intronic
1165461638 19:35947270-35947292 GGCATGAGTCCTGGGGAAAGGGG + Intergenic
1166269191 19:41703612-41703634 GGCAGCTGACTTTGGGGAGGGGG - Intronic
1166698847 19:44870243-44870265 GGGAGGTGGCCATGGGGAAGTGG + Intronic
1167077057 19:47256605-47256627 GACAGGTGACCTGGGGGAGGGGG + Exonic
1167196916 19:48035706-48035728 GGAAGGTGTACTTGAGGAAGAGG + Intronic
1167493164 19:49803220-49803242 GGAGGGAGACCTTGGGGAAGGGG + Intronic
1167570625 19:50286499-50286521 GGCAGCTGTACTTCGGGCAGTGG + Exonic
1167909654 19:52691089-52691111 GGAAGGTGGCCTTGCGGGAGGGG - Intergenic
1168094164 19:54105173-54105195 GCCAGGAGTCCTGGGGGATGGGG - Intronic
1168145181 19:54416374-54416396 AGCCGGTGTCCCTGGGGAAGGGG + Intronic
1168423063 19:56217722-56217744 CGCTGCAGTCCTTGGGGAAGCGG + Intergenic
1168519387 19:57036461-57036483 GGCTGGTGTCCTTATAGAAGAGG + Intergenic
1168525519 19:57085574-57085596 GCCAGGGCTCCTTGGAGAAGTGG - Intergenic
925343800 2:3155457-3155479 AACAGGTGTTCCTGGGGAAGGGG - Intergenic
926339365 2:11892222-11892244 GGCAGGTGACCTGGAGGGAGAGG - Intergenic
926688621 2:15717542-15717564 GGCAGGTTTCCTGGAGGAAAAGG + Intronic
926945213 2:18180172-18180194 GACAGGTGCCCTTGGGCAGGGGG + Intronic
927195010 2:20540910-20540932 GGCAGGCTTCCTGGAGGAAGGGG + Intergenic
927606848 2:24492649-24492671 GGCAGGTGTCCTTGTGCAGAAGG + Intronic
928025668 2:27736649-27736671 CACAGGTGCCCTTGGGGAAGAGG - Intergenic
929044090 2:37773795-37773817 GGCAGATTTCCTTAGGAAAGTGG - Intergenic
932479674 2:72031660-72031682 GGAAGGCTTCCTGGGGGAAGAGG + Intergenic
933941719 2:87250679-87250701 GACAGGTGTCCTGGAGGAGGAGG + Intergenic
934100877 2:88651888-88651910 GGCAGGTCTACTTAGGTAAGAGG + Intergenic
934179364 2:89606627-89606649 GGCAGGTGGCCTTGTGGACGGGG + Intergenic
934289650 2:91680890-91680912 GGCAGGTGGCCTTGTGGACGGGG + Intergenic
934614749 2:95764088-95764110 GGCAGGTGTCTTTGGGAGAAGGG + Intergenic
934696763 2:96405753-96405775 GGCAGGTTTCCTTTTGTAAGAGG + Intergenic
934719183 2:96561420-96561442 GGCAAGTCTCCTTGGGGAGGTGG + Intergenic
936338506 2:111610890-111610912 GACAGGTGTCCTGGAGGAGGAGG - Intergenic
936834104 2:116686020-116686042 GGCTGGTGTCCTTAGGAAAAGGG + Intergenic
936983194 2:118283391-118283413 GGCAGGACACCCTGGGGAAGAGG + Intergenic
937931539 2:127208859-127208881 GGCCTGAGCCCTTGGGGAAGGGG + Intronic
940200369 2:151143598-151143620 GGCAGATGTCCTGGGGAAACTGG - Intergenic
940213677 2:151282524-151282546 GACATATGACCTTGGGGAAGTGG + Intronic
942152674 2:173092788-173092810 TGTAGGTATCCTTGGGGAGGGGG - Intronic
943341829 2:186691569-186691591 GGCAGGAGCCATTGGGGGAGGGG - Intergenic
943448088 2:188015010-188015032 GGCTGGTGTCCTTTAAGAAGAGG - Intergenic
944369955 2:198971134-198971156 GTAATGTGTCTTTGGGGAAGAGG + Intergenic
945130426 2:206565661-206565683 GGCAGGGGTCCCTGTGAAAGAGG - Intronic
946373842 2:219296666-219296688 GGCAGGTGACCACGGGGAAATGG + Intronic
947263784 2:228253735-228253757 GCCAGGTGTCCTTATGGTAGAGG + Intergenic
947747518 2:232516595-232516617 TGCAGTTGTCCTTTGGGAAAGGG - Intergenic
948349028 2:237323052-237323074 GGCAGGGATCCCTTGGGAAGTGG + Intergenic
948430581 2:237915998-237916020 TGCAGGTGTCCTTAGAGAAGAGG + Intergenic
948567745 2:238897385-238897407 GGCAGGTGTCCTTGGGGGTCAGG - Intronic
948898874 2:240946047-240946069 GGCATGTGACCTAGGGGAGGTGG - Intronic
949028784 2:241778518-241778540 GCCAGGTATCTTTGGGGAGGAGG + Intronic
1169195027 20:3678318-3678340 GGCAGGCTTCCTGGGGGCAGGGG + Intronic
1169203889 20:3729619-3729641 GGCAGGAGTCCGGGGGCAAGGGG + Intergenic
1169940015 20:10926747-10926769 AGCAGCTGTCCATGGGGATGAGG + Intergenic
1170879886 20:20287593-20287615 ATCAGCTGTCCTTGGGCAAGAGG - Intronic
1170931112 20:20770128-20770150 GGCAGGGGTCCTTGTGGATGTGG + Intergenic
1171008487 20:21491840-21491862 GGCAAGTGTCCTAAGGGAGGTGG - Intergenic
1171372050 20:24668558-24668580 GGCAGGGGTACCTGGGGAGGCGG - Intergenic
1172281477 20:33710922-33710944 GGAGGGTCTCCTTGGGGAGGTGG - Intronic
1172448170 20:35003812-35003834 GGGAGGTGGGCGTGGGGAAGAGG - Intronic
1172783639 20:37451793-37451815 GGAAGCTGCCCTTGGGGAACGGG - Intergenic
1173270009 20:41525267-41525289 GGCAGTTTGCCCTGGGGAAGGGG - Intronic
1174157370 20:48524557-48524579 GGCAGCTGGACCTGGGGAAGGGG + Intergenic
1174335963 20:49861004-49861026 GGCAGGTGTGCCTGAGGGAGTGG + Intronic
1174447837 20:50602361-50602383 GGCAGGAGACCTGGGGGCAGGGG + Exonic
1175017384 20:55806646-55806668 GGCAGGTGGCCTTGGGCATGAGG - Intergenic
1175583914 20:60122263-60122285 GGCAGGTTTCCTTCTGAAAGGGG + Intergenic
1175732897 20:61366103-61366125 GGTAAGTGTCCTGTGGGAAGAGG + Intronic
1175785927 20:61711831-61711853 GGAAGGTGTCTCTGAGGAAGTGG + Intronic
1176154389 20:63610928-63610950 GGCAGGTGTCCTGGCAGATGAGG + Intronic
1178893856 21:36542865-36542887 AGCAGTAGTCCTTGGGGCAGAGG - Intronic
1179962908 21:44780713-44780735 GGCAGTTGTCCTTTGTGAGGAGG - Intronic
1180043054 21:45290116-45290138 GGCAGGTTGCCGTGGGTAAGAGG + Intergenic
1180090455 21:45531268-45531290 GGAAGGTATCCATGGGGCAGGGG + Intronic
1180292371 22:10858089-10858111 GACTGGTGTTCTTGGGGAACTGG + Intergenic
1180455904 22:15512492-15512514 GACTGGTGTTCTTGGGGAACTGG + Intergenic
1180495177 22:15887511-15887533 GACTGGTGTTCTTGGGGAACTGG + Intergenic
1181570031 22:23763451-23763473 GGCGGGGGTCGTCGGGGAAGCGG + Intronic
1182727410 22:32459207-32459229 GGAAGGTGACCTTGTGGATGTGG + Intronic
1183099219 22:35573678-35573700 GCCAGGTGTCCTCGGGAAACTGG + Intergenic
1183229653 22:36573827-36573849 GACAGGTCTCCCTGAGGAAGTGG + Intronic
1183306606 22:37086253-37086275 GTCAGGGGTCCCTGGGGCAGGGG - Intronic
1183353035 22:37344183-37344205 GGCAGGTGTGCATGGGCAGGTGG - Intergenic
1183369818 22:37426153-37426175 GGGAGGAGTCCAGGGGGAAGGGG + Intronic
1183456421 22:37925648-37925670 GGCTGGTGTCCTGGAGGAGGGGG - Exonic
1183588558 22:38767172-38767194 GGAAGGTGTCCCTGGGGCTGTGG - Intronic
1183736893 22:39649343-39649365 GTCAGGGGTGCCTGGGGAAGCGG - Intronic
1184127260 22:42496386-42496408 GACAGGTGTCCTTAGGAAAAAGG - Intergenic
1184134365 22:42538007-42538029 GACAGGTGTCCTTAGGAAAAAGG - Intergenic
1184285031 22:43465681-43465703 GGAAGGTGTCTTGGAGGAAGTGG + Intronic
1184296444 22:43528163-43528185 GGCAGCAGTCCTTGGGTAATGGG + Intergenic
1184854815 22:47140833-47140855 GGCAGGTTTTTTTGGGGTAGGGG - Intronic
1184935264 22:47716333-47716355 GGCAGGTGTGCTGGTGGAACGGG + Intergenic
1184995559 22:48205012-48205034 GGCTGGTGTTCTTGGAGAAAGGG - Intergenic
1185029021 22:48431985-48432007 GGGAGGTGTCCTATAGGAAGAGG + Intergenic
1185273138 22:49937728-49937750 GGCAGCAGTGCTTGGGGCAGAGG - Intergenic
1203296210 22_KI270736v1_random:45189-45211 GGCAGATTTCCTTAGGAAAGTGG - Intergenic
949867042 3:8554960-8554982 GGAAGGAGTGGTTGGGGAAGGGG - Intronic
950148167 3:10666505-10666527 GGCAGGCGTCCTGGAAGAAGAGG - Intronic
950416600 3:12872541-12872563 GGCAGGTGTCCTGGGGGTCTGGG + Intergenic
950421341 3:12901368-12901390 GGCAGGTGGGCCTGGGGAGGGGG + Intronic
950447842 3:13048420-13048442 GGCAGGTGGCATTGGAGAAGAGG - Intronic
950664150 3:14484794-14484816 GGCAGATGGCCCTGGCGAAGGGG + Intronic
952143214 3:30502263-30502285 GGGAAGTGTCCTTGGGCAACAGG - Intergenic
952708267 3:36402017-36402039 GGCATGTGACCATGGGCAAGCGG - Intronic
952712683 3:36447241-36447263 GGGAGCTGTCCTTGGCCAAGAGG - Intronic
953038249 3:39232100-39232122 GTAAGATGTCCTTGAGGAAGAGG + Intergenic
953144796 3:40265061-40265083 GGCAAGTATCCTTGAGCAAGTGG - Intergenic
953200108 3:40770939-40770961 GGCACGTGCCCTTGGGGTGGTGG - Intergenic
953879425 3:46683928-46683950 GGCAGGTGTCATGGGGGTAAAGG + Intronic
953927650 3:46990547-46990569 GGGAGGCCTCCTTGGGGATGGGG - Intronic
954106113 3:48410624-48410646 GGCTGGTGTCCCTGTGGAGGAGG - Intronic
954112254 3:48440614-48440636 GGAAGGGGCCCTTGGGTAAGTGG + Exonic
957883807 3:86256544-86256566 GGGAGGAGTAGTTGGGGAAGAGG + Intergenic
959906825 3:111719745-111719767 GGCAGGTGTTGATGAGGAAGGGG + Intronic
960954997 3:123025951-123025973 GACAGATGACCTTGAGGAAGGGG - Intronic
961786087 3:129347742-129347764 GGCAGGTGTCCTGGGGGTCAGGG + Intergenic
963049224 3:141127445-141127467 GGCAGGTTTCCTCGGGGAGGTGG - Intronic
964674497 3:159262580-159262602 GGCAGGAGCCCCTGGGGAAGAGG + Exonic
965106252 3:164358922-164358944 GGCAGTTGGCCTTGTGGAACTGG + Intergenic
966760165 3:183410790-183410812 GGTAGAAGTCCTTGGGGAAGAGG - Intronic
967175079 3:186855410-186855432 GCCAGGTGGCCTTGAGGAACAGG - Exonic
967917454 3:194589330-194589352 GGTAGGCTTCCTGGGGGAAGAGG - Intronic
968970905 4:3793283-3793305 CCCAGCTGTCCTTGGGAAAGAGG - Intergenic
969052251 4:4381325-4381347 GGCACTTGACCTTGGGGGAGTGG - Intronic
969098463 4:4751679-4751701 TGCAGGAGTCCTAAGGGAAGAGG - Intergenic
970052362 4:11929009-11929031 GGCAGGTGTTCTTGCTGAAGTGG + Intergenic
970448393 4:16142820-16142842 GCCAGGTGTGGTTGGGGAAACGG + Intergenic
971418197 4:26452732-26452754 GGCAGCTTTCCCTGGGGAACAGG + Intergenic
972794603 4:42402783-42402805 GGCAGGTGTCCTGTCTGAAGAGG - Intergenic
974265708 4:59583844-59583866 GACAGAGCTCCTTGGGGAAGGGG - Intergenic
975451242 4:74529545-74529567 AGCAGGTTTTCTTGTGGAAGAGG - Intergenic
975731082 4:77337775-77337797 CTCAGCTGTCCTTGGGCAAGGGG + Intronic
975736450 4:77385904-77385926 TACAGCTGGCCTTGGGGAAGAGG - Intronic
977076324 4:92455491-92455513 GGGAGAGGTCCTTGAGGAAGTGG + Intronic
978407272 4:108394015-108394037 GGCAGGGATCATGGGGGAAGGGG - Intergenic
980797195 4:137699972-137699994 GACTGGTGTCCTTGAAGAAGAGG + Intergenic
981040865 4:140220229-140220251 AGCAGCTGTCTTTGGGGAACGGG + Intergenic
981128358 4:141132430-141132452 TGCAGTTGCCCTTGGGGATGAGG + Exonic
981373167 4:143983789-143983811 GCAAGTTGTCCTTTGGGAAGGGG + Intergenic
982116667 4:152104019-152104041 GGTAAGTGACCTTGGGGAAGGGG - Intergenic
982198037 4:152935973-152935995 GCCAGGTGTCCTCGGGGAACGGG - Intergenic
984550517 4:181153705-181153727 GAGAGGTGTCCTTGGAGGAGTGG - Intergenic
984587908 4:181583885-181583907 GGAAGGTGTCCTGGAGGAAATGG - Intergenic
985538861 5:478635-478657 GGCTGGTGTGGTTGGGGGAGAGG + Intronic
985703088 5:1385538-1385560 GGCTGGTGTTCTTGGAGAGGAGG + Intergenic
986326766 5:6681517-6681539 GACTGGTGTCCTTCAGGAAGAGG - Intergenic
986776224 5:11016546-11016568 GGCCGGTGACCTGGGGGATGGGG + Intronic
987589253 5:19902418-19902440 GCCAGCTGCCCTTGTGGAAGTGG + Intronic
990341865 5:54831400-54831422 GGCAGGTGTACATGTGGGAGAGG + Intergenic
991632228 5:68667670-68667692 GGAAGGCTTCCTTGAGGAAGTGG + Intergenic
992743091 5:79793551-79793573 GGCAGGTGCCCTAGGACAAGGGG + Exonic
994726819 5:103445882-103445904 AGGAGATGTCCTTGGGGAACTGG + Intergenic
997208866 5:132066218-132066240 GGCAGATGCCCTGGGGGAGGAGG + Intergenic
997298662 5:132786050-132786072 GGCAGAAGCCTTTGGGGAAGTGG + Intronic
999114556 5:149151258-149151280 GACGGGTGTCCCTGTGGAAGGGG - Intronic
1002493805 5:179598534-179598556 GGCAGGTGACCCTGGAGGAGAGG + Intronic
1002849444 6:980448-980470 TGCTGGTGACCTTGGGGAACAGG - Intergenic
1003163400 6:3655367-3655389 GGCAGCTGTCCCTGGAGAAGTGG + Intergenic
1003390961 6:5712413-5712435 GGCAAGTGTCCATGAGGGAGTGG + Intronic
1003401150 6:5792184-5792206 GGCAGGTGTCGGTGAGGATGTGG - Intergenic
1004005030 6:11630495-11630517 GGCAGACGTCACTGGGGAAGAGG - Intergenic
1006326297 6:33356483-33356505 GGCAGGTGACCATGGTGAGGAGG - Intergenic
1006854400 6:37123250-37123272 GCCAGGTGTCAAGGGGGAAGGGG + Intergenic
1007257358 6:40538331-40538353 GGCAGGGGGCCCTGGAGAAGGGG - Intronic
1007257973 6:40541828-40541850 GGCATGTGTCTATGGGGAGGGGG - Intronic
1007375813 6:41456023-41456045 GGCAAGTGTCCTGGGGCAAGTGG - Intergenic
1007482059 6:42156776-42156798 GTCAGGCGACCTTGGGCAAGTGG - Intronic
1007758332 6:44115750-44115772 GCAGGGTGTGCTTGGGGAAGTGG - Intronic
1008489351 6:52069426-52069448 GGAAGGGGTACTTGGTGAAGGGG + Intronic
1009996762 6:70904498-70904520 AACAGGTCTCCTTGGAGAAGAGG + Intronic
1010462816 6:76132630-76132652 GGCAGGTGGCCTTTGGGAGATGG - Intergenic
1011658860 6:89576892-89576914 GGCAGCTGGCCTTGGGGATCAGG - Intronic
1012405580 6:98893451-98893473 GACTGGTGTCCTTAAGGAAGAGG - Intronic
1013409159 6:109868913-109868935 GGGAGGATGCCTTGGGGAAGGGG - Intergenic
1016675982 6:146768812-146768834 GGCAGGTGTTGGTGGGGATGTGG + Intronic
1016686642 6:146889611-146889633 GGCAGGAGTCCTTGTGGAGGTGG + Intergenic
1017049931 6:150380914-150380936 GGCATGAGTCTTTGGGGGAGAGG - Intronic
1017678938 6:156844004-156844026 GGCATGTGTTCTTGGGGAGTAGG + Intronic
1017749752 6:157480137-157480159 GGGAGAGGTCCCTGGGGAAGGGG + Intronic
1018953057 6:168391517-168391539 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953082 6:168391626-168391648 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953131 6:168391815-168391837 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953140 6:168391842-168391864 GACAGGTGTGCTGGGGGATGAGG - Intergenic
1018953147 6:168391869-168391891 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953156 6:168391896-168391918 GACAGGTGTGCTGGGGGATGAGG - Intergenic
1018953163 6:168391923-168391945 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953171 6:168391950-168391972 GACAGGTGTGCTGGGGGATGAGG - Intergenic
1018953191 6:168392032-168392054 GTCAGGTGTGCTAGGGGATGAGG - Intergenic
1018953212 6:168392112-168392134 GTCAGGTGTGCTAGGGGATGAGG - Intergenic
1018953226 6:168392166-168392188 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953247 6:168392246-168392268 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953268 6:168392329-168392351 GACAGGTGTGCTGGGGGATGGGG - Intergenic
1018953351 6:168392573-168392595 GACAGGTGTGCTGGGGGATGAGG - Intergenic
1019300394 7:300180-300202 GGCAGGTGCATTTGGGGGAGAGG + Intergenic
1019643565 7:2117245-2117267 GGAAGGTGCCCTTGGGAATGGGG - Intronic
1019686037 7:2382780-2382802 GTCAGGTGACCTTGGGGAGCAGG + Intergenic
1022012805 7:26323557-26323579 GGCAGGGGTGGTTGGGGAAGAGG + Intronic
1022941135 7:35240636-35240658 GGTAGGTGTGGGTGGGGAAGTGG + Intronic
1023155364 7:37245705-37245727 ACCAGGGCTCCTTGGGGAAGTGG + Intronic
1024737359 7:52320136-52320158 GGTGTGTGTCCTTGGGGAAGAGG - Intergenic
1025210915 7:57019265-57019287 GGCAGCTGTCCTTGGGGGGCTGG - Intergenic
1025661040 7:63557582-63557604 GGCAGCTGTCCTTGGGGGGCTGG + Intergenic
1026827842 7:73595397-73595419 GGGAGGAGTCCTTGGGTAAGGGG - Intronic
1026916345 7:74122148-74122170 GGCAGGGAGCCTTGGGGGAGAGG - Exonic
1026987253 7:74562267-74562289 GGCAGGTGTCCCAGGGCAGGTGG + Intronic
1027051842 7:75025613-75025635 GGCAGGTGACTTGGGGGCAGAGG - Intergenic
1027862021 7:83596340-83596362 GCCAGGGTTCCTTGGAGAAGTGG - Intronic
1028725888 7:94087591-94087613 GGAAAGTGTGCATGGGGAAGAGG - Intergenic
1030949684 7:115774434-115774456 GGAAGGTGTCCTTTGAGCAGAGG - Intergenic
1031478575 7:122251594-122251616 GGCAGGAGTCTTTGGGAATGTGG - Intergenic
1031883354 7:127221006-127221028 GGCAGGTGACTTTGGGGACTTGG - Intronic
1032757487 7:134904828-134904850 GGCATGTGTCCTAGTGGAAGAGG - Intronic
1033882586 7:145903278-145903300 CGCATGTGTGCTTGGGGAGGGGG + Intergenic
1034274081 7:149816493-149816515 GGAAGGTGCCCTCGGGGCAGTGG - Intergenic
1034393642 7:150803832-150803854 GGTAGGTGGCCAAGGGGAAGGGG + Exonic
1034859267 7:154582022-154582044 GGCAGCTGCCCTTGAGGAAAAGG - Intronic
1034987576 7:155526427-155526449 GGGAGGTGTCCATGGGGGAGAGG + Intronic
1035172904 7:157029748-157029770 GGAAGGTAGCCATGGGGAAGGGG - Intergenic
1035253301 7:157611270-157611292 GGCAGGTGACCTGGGGCAGGTGG + Intronic
1035406772 7:158604022-158604044 GGCAGGTGTCATTGGGCAGTGGG - Intergenic
1036184489 8:6612303-6612325 GGAGGTTGGCCTTGGGGAAGGGG - Intronic
1038484083 8:27921450-27921472 GGCAAGTGCACTTGGGGATGGGG + Intronic
1039413453 8:37374757-37374779 GGCTGGTGGCATTGGGGAACAGG - Intergenic
1040659531 8:49554700-49554722 GACAGGTGTCTGTGAGGAAGTGG - Intergenic
1041292574 8:56320686-56320708 GGCAGGCGGCCTAGGAGAAGAGG + Intronic
1041981458 8:63866164-63866186 AGCAGTTGTCCTGTGGGAAGGGG - Intergenic
1044725524 8:95191508-95191530 TGCAGATGTCCTGGGGGATGAGG + Intergenic
1045210778 8:100097139-100097161 AGCAGGTGTCTCTGGGGAATGGG + Intronic
1045254718 8:100509907-100509929 GGAGAGTCTCCTTGGGGAAGGGG + Exonic
1045266550 8:100623472-100623494 GGCTGGAGTCCTGGGGAAAGTGG - Intronic
1045316444 8:101047698-101047720 TCCAGGTGTTCTTGGGGCAGGGG - Intergenic
1046824006 8:118667150-118667172 GGCTGCTGTCCTTGCAGAAGAGG - Intergenic
1047357954 8:124141138-124141160 GACAGGAGGCCTAGGGGAAGTGG - Intergenic
1047421694 8:124712750-124712772 TGCTGGTGTGCTTGGGCAAGTGG - Intronic
1047914364 8:129565958-129565980 TGGAGGTGTCTTTGGGCAAGTGG - Intergenic
1048044376 8:130759403-130759425 CTCAGGGGTCCCTGGGGAAGGGG - Intergenic
1048418538 8:134253380-134253402 GGCACATGTCCTAGGGAAAGAGG + Intergenic
1048890109 8:138939268-138939290 GGAAGGGGTCATTGGGGAGGTGG + Intergenic
1048997405 8:139802410-139802432 GGGAGGGGTCCCTGGGGCAGTGG + Intronic
1049270775 8:141694925-141694947 GCCAGGGCTCCTTGGAGAAGAGG + Intergenic
1049345583 8:142136840-142136862 GGCAGGGGTCCTTCGTGATGAGG - Intergenic
1049413977 8:142487151-142487173 GGCAGGTGTGCCCGGGTAAGGGG - Intronic
1049455039 8:142682433-142682455 GGAAGGCTTCCTGGGGGAAGAGG - Exonic
1049464760 8:142745900-142745922 TGCAGGTGTACTTGGGGCAGAGG + Intergenic
1049762288 8:144336926-144336948 GGCGGGGGTCCTGGGGGGAGGGG + Intergenic
1050568417 9:6912075-6912097 GGCAGGTGACCTTAGGAAAGAGG + Intronic
1051840848 9:21396235-21396257 CGCGGGTCTCCTTGAGGAAGGGG + Intergenic
1051991137 9:23153876-23153898 GGAAGGTCTCTTTGGAGAAGTGG + Intergenic
1054810203 9:69428355-69428377 GGAAGGTGTCGCTGGAGAAGTGG + Exonic
1054978158 9:71172209-71172231 GGCAGGTGTTTTGGAGGAAGTGG + Intronic
1056235145 9:84586822-84586844 GGACGGTGTCCTTGGGGATGAGG + Intergenic
1056763696 9:89431867-89431889 GGAACGTGTCCTTGAGGAGGCGG - Intronic
1057139438 9:92717750-92717772 GACAGCTGGCCTTGTGGAAGGGG + Intronic
1057337566 9:94167056-94167078 GGCAGCCGTCCTTGGCGAGGGGG + Intergenic
1058608850 9:106753301-106753323 CCCAGCTGTGCTTGGGGAAGAGG - Intergenic
1058640475 9:107079279-107079301 GGAAGATGTCCCTGAGGAAGTGG - Intergenic
1058990296 9:110249405-110249427 GGCAGGTGTGCTAGGTGAAGGGG + Intronic
1059530420 9:115030370-115030392 GGGAGCAGTCCTTGGGGAAGGGG + Exonic
1060665221 9:125428598-125428620 GGCAGGCTTCCTGGAGGAAGAGG + Intergenic
1061048593 9:128180867-128180889 GGCAGCTGCCCTTGGGCAAGGGG - Intronic
1061158822 9:128881853-128881875 GGCACCTGACCTTGGGGAAGTGG + Intronic
1061203285 9:129149255-129149277 TGCAGCTGTGCTTGGTGAAGGGG + Intergenic
1061627015 9:131846689-131846711 GGGAGGTGTCCTTAGGGGAGTGG - Intergenic
1061878082 9:133554743-133554765 GGAAGGGGGCCTTGGGGAAGGGG + Intronic
1061933303 9:133844371-133844393 GGCAGGTGTTCCCTGGGAAGAGG - Intronic
1185923317 X:4118740-4118762 GGTAGGAGTCCCTGGGGAAGAGG - Intergenic
1186644051 X:11487322-11487344 GCCAGGTTTCTTTGGGGAAGTGG + Intronic
1189331225 X:40146094-40146116 GGAATGTGTGCTAGGGGAAGAGG - Intronic
1189338278 X:40184482-40184504 GGCATGGGTCTTTGGTGAAGGGG + Intergenic
1190296353 X:49030035-49030057 CCCAGGTATCCTGGGGGAAGAGG - Exonic
1190723669 X:53172148-53172170 GGCAGGTGCCCTGGGGAAAGGGG + Intergenic
1191083267 X:56537153-56537175 GGCAGGGGGCCATGGGGGAGTGG - Intergenic
1191846442 X:65550943-65550965 AGCAGCTGTCCTTGGGCCAGGGG - Intergenic
1191902072 X:66051906-66051928 GGAGGGAGTACTTGGGGAAGGGG - Intergenic
1192928389 X:75780044-75780066 GGCAGCAATCCTTGGGGCAGGGG + Intergenic
1193471948 X:81916643-81916665 AGCAGGTCTCCTTGGAGAAATGG + Intergenic
1195550001 X:106157518-106157540 GGCAGGTGACTTTGAGCAAGTGG + Intergenic
1197388133 X:125826453-125826475 TGCAGGGGTCCTTTGGGGAGAGG + Intergenic
1198616370 X:138462896-138462918 CACAGGGGTCCTTGGGGAGGGGG + Intergenic
1198680858 X:139180760-139180782 TGCAGTTGTCCTTTGGGGAGGGG - Intronic
1200222348 X:154397483-154397505 GGCGGGCGTCCTGGGGGAAGTGG - Intronic
1200835807 Y:7729979-7730001 GGCAGGTGTCCCTGAGGACACGG - Intergenic
1202115719 Y:21467724-21467746 GGCGGGTGTCCTGGGGAAAGGGG - Intergenic
1202133037 Y:21632113-21632135 GGAAGGTGGCCTTGGAGCAGAGG - Intergenic
1202593736 Y:26514466-26514488 GGTAGGAGTACTTGGGGAACTGG + Intergenic