ID: 901512559

View in Genome Browser
Species Human (GRCh38)
Location 1:9724707-9724729
Sequence GGTGTCCTTGGGGAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 629}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512550_901512559 -2 Left 901512550 1:9724686-9724708 CCCATTATCAGGGCAAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 220
Right 901512559 1:9724707-9724729 GGTGTCCTTGGGGAAGGGGCTGG 0: 1
1: 0
2: 2
3: 66
4: 629
901512544_901512559 9 Left 901512544 1:9724675-9724697 CCTTGTGTCCACCCATTATCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 901512559 1:9724707-9724729 GGTGTCCTTGGGGAAGGGGCTGG 0: 1
1: 0
2: 2
3: 66
4: 629
901512552_901512559 -3 Left 901512552 1:9724687-9724709 CCATTATCAGGGCAAGGGCAGGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 901512559 1:9724707-9724729 GGTGTCCTTGGGGAAGGGGCTGG 0: 1
1: 0
2: 2
3: 66
4: 629
901512549_901512559 1 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512559 1:9724707-9724729 GGTGTCCTTGGGGAAGGGGCTGG 0: 1
1: 0
2: 2
3: 66
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512559 Original CRISPR GGTGTCCTTGGGGAAGGGGC TGG Intronic
900191972 1:1355811-1355833 GGAGTCAGTGGGGGAGGGGCAGG + Intronic
900365091 1:2308733-2308755 GGCGGCCCTGGGGATGGGGCAGG - Exonic
900387974 1:2419301-2419323 GGGGTGCTGAGGGAAGGGGCTGG - Intergenic
900502217 1:3011878-3011900 GGTGTCCACAGAGAAGGGGCAGG + Intergenic
901005755 1:6170829-6170851 GGTGTCGGTGGGGCAGTGGCAGG + Intronic
901275435 1:7987342-7987364 GGAGTCCTTGGGGGAGGGGCTGG + Intergenic
901506583 1:9689460-9689482 GGCGTCCTCGGGGCTGGGGCGGG - Intronic
901512559 1:9724707-9724729 GGTGTCCTTGGGGAAGGGGCTGG + Intronic
901626382 1:10627448-10627470 GGGGTCCTTGGGGGTGGGGGTGG - Intronic
901658229 1:10782756-10782778 GGTCACCTGGGGGAGGGGGCTGG + Intronic
901684013 1:10933796-10933818 GGTGTCCATGAGGGAGGGGTTGG + Intergenic
901764777 1:11492740-11492762 GGTTTCCCTGGGGCTGGGGCAGG + Intronic
901907187 1:12423646-12423668 GGTGTCCTGGGACAAAGGGCTGG - Intronic
902098687 1:13967392-13967414 GGTGCACTTGGGGAAGGGTGGGG - Intergenic
902385462 1:16073332-16073354 GGAGACCTGGGGGATGGGGCTGG - Intronic
902512310 1:16973060-16973082 GGGGTGCTTGGGGAGGCGGCAGG + Intergenic
902575156 1:17372890-17372912 GGGGTCCTTTGGGAGGGGGTGGG + Intronic
902920912 1:19665518-19665540 GGCGCCCTCGGGGATGGGGCAGG - Exonic
903080264 1:20805249-20805271 CGTGTCCTTGGCCCAGGGGCTGG - Intergenic
903177652 1:21590328-21590350 TGTCTCCTCGGGGAAGCGGCTGG + Intergenic
903219206 1:21859729-21859751 GCTGTCCTTGTGCATGGGGCTGG - Intronic
904319671 1:29688891-29688913 GTTGTCTCTGGGGGAGGGGCTGG + Intergenic
904528769 1:31154944-31154966 AGAGTCCTTGGGGCGGGGGCGGG + Intergenic
904641939 1:31937925-31937947 GGGGGCCTCGGGGAAGGGGAGGG - Intronic
904813793 1:33180991-33181013 GGCCTGCCTGGGGAAGGGGCGGG - Intronic
905023764 1:34836236-34836258 GGTGTCTTTGGGGACCAGGCAGG - Intronic
905145815 1:35886093-35886115 GGGCTCCTTGGGGATGGGGGAGG + Intronic
905307955 1:37032395-37032417 GGTGTCCTTGGGGAAAAAGGTGG - Intronic
905645913 1:39625128-39625150 GGAGTCCTGGGGGAAGTGCCAGG + Exonic
906238069 1:44223698-44223720 GGTGGCCTGGGGGTTGGGGCTGG - Intronic
906326669 1:44850444-44850466 GGTGAGGTGGGGGAAGGGGCTGG + Intergenic
906964327 1:50441796-50441818 GGGGCCCTTGGGAAAGGTGCTGG + Intronic
907032200 1:51183549-51183571 TGTGTATTTGGGGAAGGGGAAGG + Intergenic
907246693 1:53113585-53113607 GGTGGCCCTGGGGATGGGGAAGG - Intronic
907364099 1:53945746-53945768 GGTGGCCGCGGCGAAGGGGCGGG - Exonic
908721555 1:67131666-67131688 GGTGTGCTTGAGAAAAGGGCAGG - Intronic
910130060 1:83893838-83893860 TGTGTCCTAGGGGAAGGGGCAGG + Intronic
910870515 1:91829028-91829050 GGTGTCATGGTGGAGGGGGCGGG - Intronic
912280480 1:108308056-108308078 GGTGGCCTTTGGAAAGGGGAGGG - Intergenic
912287746 1:108386301-108386323 GGTGGCCTTTGGAAAGGGGAGGG + Intronic
912761373 1:112370578-112370600 AGTGTCCTTGGGGCAAGGCCAGG - Intergenic
913224873 1:116690120-116690142 TGTGTCCTCGGGGAAGAGACAGG + Intergenic
913532552 1:119743071-119743093 GGTGTCCTTGAGGCTGGGGTGGG + Intronic
914825114 1:151134022-151134044 GGGGTCCCAGGGGAAGGGCCAGG + Exonic
915323681 1:155069907-155069929 AGTGCCCTTGGGGAGGGGGAGGG - Intergenic
915598355 1:156907857-156907879 TGTGGCCTTGGGGAGGAGGCTGG + Intronic
916126071 1:161572485-161572507 TCTACCCTTGGGGAAGGGGCTGG - Intergenic
916135988 1:161654332-161654354 TCTACCCTTGGGGAAGGGGCTGG - Intronic
917670256 1:177266945-177266967 GAGGTCCTTGTGGAAGAGGCTGG + Intronic
918826938 1:189336688-189336710 GGTGTTCGTGGGCATGGGGCTGG - Intergenic
919085446 1:192915974-192915996 GGTGTCTTTGGGGAAGTAGGTGG - Intergenic
920577230 1:207070409-207070431 GGTGCCTTTGAGGGAGGGGCTGG + Exonic
921182701 1:212644276-212644298 AGTGTCCTTGGGGTTGGGGTGGG - Intergenic
921407689 1:214799172-214799194 GGGGTCCTGGGGTAAGGGGTAGG + Intergenic
922615998 1:226961541-226961563 CATGTTCTTGGGGAAGGTGCAGG + Exonic
1064929520 10:20608956-20608978 GGTGGCCTTTGGGAAGAGCCAGG - Intergenic
1065695879 10:28379380-28379402 AGTGTCCTTGGGCATGGGTCAGG - Intergenic
1067044040 10:42974595-42974617 TGGGTCCCTGGGGAAGGGGCTGG + Intergenic
1068430685 10:56928366-56928388 AGTGTCATTAGGAAAGGGGCTGG + Intergenic
1069541313 10:69296188-69296210 TGTGTGCTTGGGGAATGGGAGGG - Intronic
1069589137 10:69630987-69631009 GGTGTTCCTGGGGAAGGCCCAGG + Intronic
1069922159 10:71822295-71822317 GGTGTCCTTGGAGATGTGGAAGG - Intronic
1070307394 10:75247892-75247914 GGTGTTCCTGGGGCAGGGGAGGG - Intergenic
1070555843 10:77527292-77527314 GGGATCCCTGGGGAAGGGGGTGG - Intronic
1070891190 10:79943126-79943148 AGTGGCCTTGGGGTAGGGGAAGG - Intronic
1071088796 10:81895420-81895442 GGTTCCCTTTGGGCAGGGGCGGG - Intronic
1072283730 10:93893899-93893921 GGTCTCCTTGGGGGAGGGTGCGG + Intergenic
1072468251 10:95687570-95687592 GGTGAGCCTGGGGAAGGGGATGG - Exonic
1072617861 10:97061461-97061483 GGTTACTTTGGGGAAGGGGCAGG - Intronic
1072764848 10:98086975-98086997 GGTGCCCTGGGGGGAGGGGTTGG + Intergenic
1073178526 10:101570461-101570483 GGCGTCCTTGGGGACGGGTGCGG - Intergenic
1074533960 10:114315503-114315525 CCTCTCCTTGGGGAAGGGGCAGG - Intronic
1074915916 10:117954774-117954796 GGTGCCCTTGGCAAAGGGGGTGG - Intergenic
1076294708 10:129375475-129375497 GGTGCCCTTGGAGCAGGGGCTGG + Intergenic
1076526376 10:131115038-131115060 GGTGTCATTGGGCGAGAGGCAGG - Intronic
1076634852 10:131875516-131875538 CGTGTCCTCTGGGGAGGGGCAGG - Intergenic
1076727234 10:132419496-132419518 GGTCTCCTGGGGGAGGGGCCTGG + Intergenic
1076727248 10:132419525-132419547 GGTCTCCTGGGGGAGGGGCCTGG + Intergenic
1076727262 10:132419554-132419576 GGTCTCCTGGGGGAGGGGCCTGG + Intergenic
1076727291 10:132419611-132419633 GGTCTCCTGGGGGAGGGGCCTGG + Intergenic
1077023538 11:430170-430192 GATCTCCTTGCTGAAGGGGCAGG + Exonic
1077043012 11:532866-532888 GGTGGGCCTGGGGAAGTGGCTGG - Intronic
1077062789 11:625185-625207 GGTGCCGTGGGGGTAGGGGCAGG + Intronic
1077103083 11:830728-830750 GGTGACCGTGGGGACAGGGCAGG - Intronic
1077218635 11:1405539-1405561 GTTTTCCTAGAGGAAGGGGCTGG - Intronic
1077316282 11:1920798-1920820 GGTGTGCTGGGGGCAGGGGATGG - Intronic
1077409831 11:2398782-2398804 GATGGGCTTGGGGTAGGGGCTGG + Intergenic
1077477722 11:2798201-2798223 GCTGTCCAAGAGGAAGGGGCTGG + Intronic
1077480563 11:2812572-2812594 GGAGCCCCTGGGGACGGGGCTGG - Intronic
1078585302 11:12580838-12580860 GTTGTCCTGGGGGTAGGGGCTGG + Intergenic
1081657745 11:44868535-44868557 GGGGTCTCTGAGGAAGGGGCTGG - Intronic
1081812997 11:45923565-45923587 GGTGTCCGTGGAGGAGGGTCAGG + Intronic
1081995294 11:47359817-47359839 AGTCTCCTGGGGGACGGGGCAGG + Intronic
1083171303 11:60925191-60925213 GGAGCCCTGGGGGAAGGGGGAGG - Intronic
1083634122 11:64110945-64110967 GCTGGCCTTGGGGAGGGGGGCGG + Intronic
1083772796 11:64877891-64877913 GGTTTACTCTGGGAAGGGGCAGG + Intronic
1083860476 11:65417620-65417642 GGTGGGCTTGGGGAGGAGGCTGG + Intergenic
1083879348 11:65540447-65540469 GGCGGCCGTGGGGAAGCGGCAGG - Intronic
1083898211 11:65630887-65630909 GGTGAGCTGGGGGCAGGGGCTGG - Intronic
1083951629 11:65959756-65959778 GGTTTCCTTGGGCATGGGGGTGG + Intronic
1083955127 11:65978693-65978715 GGTGCCCTTGGGGATGTGGGGGG + Intronic
1084085391 11:66852769-66852791 GGGGTCCGTGGGGCTGGGGCTGG + Exonic
1084165727 11:67373884-67373906 GGCCTCCTGGGGGAGGGGGCGGG + Intronic
1084190083 11:67494760-67494782 GGGGTGCTGGGGGGAGGGGCGGG + Intronic
1084384602 11:68835291-68835313 GATGTCCTTTGGGCAGGTGCAGG - Intronic
1085641884 11:78197873-78197895 GGTGTGCTGGGGGAAGGGAGGGG + Intronic
1085680911 11:78574420-78574442 TTTGTGCTTGGGGAAGGGGGCGG + Exonic
1086080760 11:82900581-82900603 GGTGTCCTCGGGGATGGGGGCGG - Intronic
1088569734 11:111211991-111212013 GGTTTCCTAGGGGTGGGGGCTGG - Intergenic
1088817934 11:113434072-113434094 GGCTTCCTTGGAGAAGGGGCTGG - Intronic
1089692781 11:120197300-120197322 TGTGTCCCTGGGGAAATGGCTGG - Intergenic
1089755522 11:120683387-120683409 AGAGACCTTGGGGTAGGGGCGGG + Intronic
1090263998 11:125342762-125342784 AGTGTCTCTGGGGGAGGGGCGGG + Intronic
1091558767 12:1594700-1594722 GGCGTCCTTGGTGCGGGGGCCGG - Intronic
1091640188 12:2230267-2230289 GGTGTACGTGGGGACGGCGCCGG + Intronic
1091744497 12:2982506-2982528 GGTGCACTTGGGGAAGGAGGAGG + Intronic
1091766418 12:3122989-3123011 GGGGTCCCTGGGGGAGAGGCAGG + Intronic
1091797437 12:3305392-3305414 GGGCTCCGTGGGGCAGGGGCAGG - Intergenic
1092523880 12:9297879-9297901 TGTACCCTTGGGGAAGAGGCTGG + Intergenic
1092526748 12:9314294-9314316 GCTGCCCTGGAGGAAGGGGCAGG - Intergenic
1092540524 12:9417485-9417507 GCTGCCCTGGAGGAAGGGGCGGG + Intergenic
1095818742 12:46453512-46453534 TGTTTCCTTTGGGAAGGGGGAGG + Intergenic
1095890939 12:47234912-47234934 GGAGACCATGGGGAAGGGGATGG - Intronic
1096231941 12:49901598-49901620 ATTGTCCCTGGGGTAGGGGCAGG + Intronic
1096370256 12:51063611-51063633 GGGGTCTTTGGGGAATGGGTGGG - Exonic
1096408263 12:51359237-51359259 AGTGCCCTTGGGGAAGGTGTGGG + Exonic
1096503808 12:52080811-52080833 GGTGGCCCTGGGGAATGGGGAGG + Intergenic
1096716844 12:53496471-53496493 GGAGGCCTCGGGGAAGGGGAGGG + Intronic
1096838127 12:54364197-54364219 GGGGTCTTTGGGGATGGGGAAGG - Exonic
1096842709 12:54389336-54389358 GGGGTCCCTGGGGGTGGGGCCGG + Intronic
1097021080 12:56021223-56021245 GATGTGCTTGGGGAGGGGGCTGG - Intronic
1097242128 12:57582717-57582739 GGAGCCTTTGGGGAAGGGGGAGG + Intronic
1097888871 12:64758049-64758071 GGCCTCCATGGGGAAGGGGTTGG + Intronic
1100235089 12:92652866-92652888 CCTCTCATTGGGGAAGGGGCTGG - Intergenic
1100359441 12:93862491-93862513 GGTGTGCTAGAGGAAGGGGAAGG + Intronic
1100982104 12:100170107-100170129 GGTGTTAGTGGGAAAGGGGCGGG - Intergenic
1102032914 12:109753344-109753366 GGGGTTCATGGGGATGGGGCAGG - Intronic
1102313904 12:111870607-111870629 GAGGACCTTTGGGAAGGGGCAGG + Intronic
1102993190 12:117329391-117329413 GGGGTTCTTGGGGAAAGGGTTGG + Intronic
1103109641 12:118264540-118264562 GGTTACCTGGGGGAAGGGGGTGG + Intronic
1103325496 12:120117242-120117264 GGGGTCGGTGCGGAAGGGGCGGG - Intronic
1103541493 12:121669432-121669454 GGAGTCCCTGTGGAAGGGGTGGG - Exonic
1103614973 12:122146080-122146102 CGTTTCCTTGGGGAAGGGAAAGG + Exonic
1104035188 12:125092801-125092823 GGTGTCCTTGTGGGAGGGTCTGG + Intronic
1104107378 12:125675851-125675873 GCTGTCCTTTGAGAAGGTGCAGG + Intergenic
1104842971 12:131833466-131833488 AGTGTCCCTGCGGAAGAGGCTGG + Intronic
1104846875 12:131851345-131851367 GGAGTCCCTGGGGGAGGTGCTGG + Exonic
1104861159 12:131924602-131924624 GGTGTTCTCGAGGAAGGGGAAGG + Intergenic
1105722897 13:23134616-23134638 GGTGGGCCTGGGGAAGGGGTGGG - Intergenic
1106134004 13:26961012-26961034 GCTGCCCATGGGCAAGGGGCTGG - Intergenic
1106463592 13:29993766-29993788 GGTGGCCCTGAGGAAGGTGCTGG - Intergenic
1106483714 13:30155242-30155264 GGTGTCCTTGAGGAGGAGGGAGG - Intergenic
1108541965 13:51453282-51453304 GGCGGGCTTCGGGAAGGGGCGGG + Intronic
1108885346 13:55174392-55174414 GGTGTCCATTGGGAAGTGACTGG - Intergenic
1110326041 13:74216512-74216534 GGTGTCCTGGGTGAAGGACCAGG + Intergenic
1113861465 13:113490378-113490400 AGGGGCCTTGGGGCAGGGGCCGG - Intronic
1113902955 13:113806685-113806707 GACGTCCCTGGGGCAGGGGCAGG - Intronic
1113968319 13:114167304-114167326 GGTGTCAGTGGAGAAGGGGCCGG + Intergenic
1114669330 14:24400414-24400436 GGTGTGCGTGGTGAAGGGGAAGG - Intronic
1117036885 14:51739344-51739366 GGTTGCCTTGGGAAATGGGCAGG - Intergenic
1117141008 14:52791366-52791388 TGTGTCCTGGGGGCTGGGGCGGG - Intronic
1117252653 14:53952223-53952245 GGTGTCTCTGGGGAGGGGGAGGG + Exonic
1117475234 14:56087648-56087670 AGTGTCCTTGCTGAAGAGGCAGG + Intergenic
1117606037 14:57430343-57430365 GGTGTCCTTGCAGAGGGGGTGGG - Intergenic
1118048656 14:62002662-62002684 TCTATCCCTGGGGAAGGGGCAGG - Intronic
1118349856 14:64965914-64965936 CATGTCCTTGGGGAAGGGGTGGG + Intronic
1118350526 14:64970341-64970363 GGAGGACTTGGGGAAGAGGCAGG - Intronic
1119436129 14:74599163-74599185 TGTGTCCTGGGGGAAGTGACTGG - Intronic
1120689977 14:87581592-87581614 GCTGTCCTTGGTGGAGGGACAGG + Intergenic
1120952243 14:90052001-90052023 TGTGTCCTGGGGGTGGGGGCTGG - Intergenic
1121250756 14:92497737-92497759 TGGGTCCTTGGGGGAGGGGTTGG + Exonic
1121428648 14:93871929-93871951 GGTGTCCCTGAGGAGGGGCCTGG + Intergenic
1122151140 14:99726811-99726833 GGTGGCCCAGGGGACGGGGCAGG - Exonic
1122399414 14:101458296-101458318 CGTGACCCTGGGGAGGGGGCAGG - Intergenic
1122631622 14:103109857-103109879 GCTGTGCTGGGGGAGGGGGCAGG - Intronic
1122716911 14:103701367-103701389 CGTGACCTTGGGGCTGGGGCTGG + Intronic
1122784358 14:104156975-104156997 TGGGCCCTTGGGGAAGGGGCCGG + Intronic
1122820388 14:104341798-104341820 AGTGCCCTTGCAGAAGGGGCTGG - Intergenic
1122860966 14:104582210-104582232 GGCGTCCTGGAGGACGGGGCAGG + Intronic
1122917275 14:104865052-104865074 GGTGGGCCTGGGGCAGGGGCGGG + Intergenic
1123057040 14:105575556-105575578 CCTGTCCTGGGGGAGGGGGCGGG - Intergenic
1123081206 14:105696335-105696357 CCTGTCCTGGGGGAGGGGGCGGG + Intergenic
1123984378 15:25632252-25632274 GGATTCCTTCGGGAAGGTGCAGG + Intergenic
1124426723 15:29569847-29569869 GGCGTCCTGGGGCAGGGGGCAGG - Intronic
1124590285 15:31047602-31047624 GGTGGGGTTGGGGAAGGGGGTGG - Intronic
1124811534 15:32944099-32944121 GGAGTGCCTGGGGAAGGGGAAGG + Intronic
1125086539 15:35736814-35736836 GGTTACCATGGGGCAGGGGCAGG - Intergenic
1125712714 15:41799822-41799844 GGTGACCTTGGAGAAGGTGCTGG + Exonic
1125734367 15:41913326-41913348 GTTGTCCCTGGGGAAGGAGGTGG + Intronic
1125956196 15:43792665-43792687 GGTCTCCGTGGGGGATGGGCTGG - Intronic
1126112595 15:45184662-45184684 GGTGTAATTAGGGAAGGGGATGG - Intronic
1127376758 15:58392240-58392262 CATGACCTTGGGCAAGGGGCTGG + Intronic
1127384918 15:58459742-58459764 GGCGTCCTTGGGGACGGGTGTGG - Intronic
1128458077 15:67844139-67844161 GGTGGCCTGGGGGAAGAGACAGG + Intergenic
1128775224 15:70315276-70315298 GGTCTCCTTGGTGAAGAGGGGGG + Intergenic
1129232091 15:74202669-74202691 GGTGGGCTTGGGAAAGGGGAAGG - Exonic
1129365207 15:75049803-75049825 GGTGTGGCTGGGGAAGGGTCTGG + Exonic
1129389558 15:75213828-75213850 GGTCTCCTTGGGGGTGGGGGCGG - Intergenic
1129450993 15:75651364-75651386 CGTGTCCTTGGGGAGGTGGCAGG - Intronic
1129452623 15:75659359-75659381 GGTGCGGTGGGGGAAGGGGCGGG + Exonic
1129688244 15:77698494-77698516 CGTGTAGTTGGGGAAGGGGCGGG + Intronic
1129771469 15:78206017-78206039 GGTGTCCTTGGGGGTGGAGGGGG - Intronic
1130048122 15:80461659-80461681 GGTGGTCTGGGGGCAGGGGCTGG + Intronic
1130171797 15:81522821-81522843 GCTTTCCTTGGGGATGGGGATGG - Intergenic
1130985433 15:88841896-88841918 GGTGGCCTTGGGAAGGGAGCTGG - Intronic
1131156819 15:90080664-90080686 GCTGTCCTTGGGGGAGGCCCAGG + Exonic
1131262670 15:90895836-90895858 GGTGGCCTTGGGGAAGGAGGAGG + Intergenic
1131373462 15:91903919-91903941 GGTGTGCTTGTGGAGAGGGCAGG + Intronic
1131735688 15:95329442-95329464 GGTGCACTTGTGGAAGGTGCCGG - Intergenic
1131828402 15:96338320-96338342 GGTTTCTTTTGGGGAGGGGCAGG - Exonic
1131990504 15:98088651-98088673 GGTGACCCTGGGGGAGGGGAAGG - Intergenic
1132047823 15:98579550-98579572 GATGGTCTTGGGGAGGGGGCGGG + Intergenic
1132099640 15:99014646-99014668 GGTGACCCTGGGGGAGGGGAAGG + Intergenic
1132198931 15:99934422-99934444 GGTGTCATTTGGGAAGAGGGAGG - Intergenic
1133039104 16:3050409-3050431 GCTGTCCTGGTGGAAGGCGCGGG - Exonic
1133162347 16:3920440-3920462 GGGGTCCCTGGGGTAGGGGATGG + Intergenic
1133365392 16:5205050-5205072 GGTATGCATGGGGGAGGGGCAGG - Intergenic
1133758741 16:8781571-8781593 GGTGGTCTTGGGGGAGGGGAGGG + Exonic
1134237460 16:12478574-12478596 TGTGTCATTGTGCAAGGGGCTGG + Intronic
1134244906 16:12532769-12532791 GGAGTCCATGGGGCAGAGGCAGG + Intronic
1134686758 16:16164373-16164395 GGTTTCCTGTGGGAAAGGGCTGG + Intronic
1134880624 16:17742609-17742631 GGTGACCTTGTGGAAGGAGCCGG + Intergenic
1135383059 16:22009368-22009390 GGTGCCCTCGGGAAAGAGGCGGG + Intronic
1135592053 16:23711932-23711954 GGTGCCCTTGGGAGGGGGGCTGG + Intronic
1135712390 16:24729326-24729348 TGTGTCAGTGGGGGAGGGGCCGG + Intergenic
1135748342 16:25036488-25036510 GATATCCCTGGGGAAGGGTCAGG - Intergenic
1135776339 16:25259918-25259940 GGTGTCCTTAATGAAGGGGCTGG + Intergenic
1136189994 16:28609821-28609843 GATATCCATGGGGAAAGGGCAGG + Intronic
1136412299 16:30084564-30084586 GGTGGACTTGGGGAGGGGCCAGG + Intronic
1136501372 16:30671111-30671133 GGTTACCTGGGGGAAGGGGATGG - Intergenic
1136615797 16:31397711-31397733 GGTGTTGTTGGGGAGGAGGCTGG + Intronic
1137814811 16:51388590-51388612 GCAGTCCTTGGGGCAGGGACAGG + Intergenic
1138009182 16:53361981-53362003 GGGGTCCCAGGGGATGGGGCAGG + Intergenic
1138215692 16:55203406-55203428 GGTGTCCCTGGAGAAAGGTCTGG + Intergenic
1138322575 16:56129013-56129035 GGGCTCCTTGGAGAAGTGGCTGG + Intergenic
1138414307 16:56862585-56862607 GGTGTCCCTGGAGGAGGGTCAGG - Intergenic
1138442666 16:57044479-57044501 GGGGTCCTTAGGGAAGGGAAAGG - Intronic
1138472048 16:57245486-57245508 GGTGTCCTTAGGGGCCGGGCCGG + Intronic
1139390553 16:66604619-66604641 GGGGTCCGAGGGGGAGGGGCGGG + Intronic
1139395063 16:66632365-66632387 GGTGGACTGGGGGAAGGGGCAGG + Intronic
1139472153 16:67184091-67184113 TGTGGCCTTGGGAAGGGGGCGGG - Intergenic
1140958636 16:79891433-79891455 GGTGCATTTGGGGAAGGAGCTGG - Intergenic
1140972005 16:80022424-80022446 ACTATCCTGGGGGAAGGGGCTGG + Intergenic
1141202827 16:81910802-81910824 GGTGTCCTGGGGGACTGGCCCGG - Intronic
1141516309 16:84547664-84547686 GGTCTTCTGGGGGTAGGGGCAGG - Intronic
1141645802 16:85366953-85366975 GGTGTCCCCGGGGCAGGGCCAGG + Intergenic
1141908271 16:87041697-87041719 GGCCTCGTTGGGGAAGGGGAAGG + Intergenic
1142107716 16:88315272-88315294 GAGGTCCCTGGGGCAGGGGCTGG + Intergenic
1142157776 16:88540428-88540450 GCTGTCCTTGGGCAGGGAGCAGG + Intergenic
1142268518 16:89077350-89077372 AGTGTCCTTGAGGCAGGAGCTGG - Intergenic
1142930729 17:3282080-3282102 GGAGTCTTTGTGGAAGTGGCTGG - Intergenic
1143010743 17:3865027-3865049 GGAAGCTTTGGGGAAGGGGCTGG - Intronic
1143477990 17:7213912-7213934 GGAGTCAGTGCGGAAGGGGCTGG + Intronic
1143845716 17:9771578-9771600 GGCGGCCTTGGGGATGGGGTTGG + Exonic
1143906647 17:10214569-10214591 GGTCACCTGGGGGAAGAGGCTGG + Intergenic
1144073090 17:11692117-11692139 GGTCTTCTTGGGCAAGGGGCAGG + Intronic
1144159597 17:12544587-12544609 GGGCTCCTTGGGGAAATGGCTGG - Intergenic
1144656455 17:17040296-17040318 GGTGGCCTTGAGGAATGGGCAGG + Intergenic
1145904908 17:28510970-28510992 CATGTCCCTGGAGAAGGGGCAGG - Intronic
1146951601 17:36910463-36910485 GATTTCCATGGGGAAGGAGCTGG + Intergenic
1147214271 17:38890371-38890393 GGTGACTCTGGGGGAGGGGCAGG - Intronic
1147721643 17:42543295-42543317 GGTGGAGTTGGGGAAGAGGCGGG - Exonic
1147808248 17:43147838-43147860 GGAGGCTTTGGGGAAGGGGTAGG - Intergenic
1147845642 17:43402356-43402378 GGTGTGTCTGGGGGAGGGGCAGG - Intergenic
1148487990 17:48003578-48003600 GGGCTCTTTGGGGAGGGGGCTGG - Intergenic
1148623881 17:49054471-49054493 TTTGTCCTTGGGGAACAGGCAGG + Exonic
1148647940 17:49230076-49230098 GGGATCCTAGGGGCAGGGGCAGG + Intronic
1149020819 17:51962288-51962310 GGTGTGACTGGGCAAGGGGCTGG - Intronic
1149054547 17:52347339-52347361 GGTGTCCTTGGGCAGGAGGAGGG + Intergenic
1149236198 17:54593667-54593689 GGTCTCCTTGGGGAAGGATGAGG + Intergenic
1149237764 17:54612945-54612967 TGTGTCCTTGGGGATGGGCCTGG - Intergenic
1150221390 17:63497529-63497551 CGTGTGCTGGGAGAAGGGGCTGG - Intronic
1151163113 17:72182663-72182685 GGTGAGCATGGGGAAGTGGCTGG - Intergenic
1151210500 17:72540587-72540609 ACTGTCCCTGGGGAAGGGTCTGG + Intergenic
1151221353 17:72615378-72615400 GGTGTACCAGGGGAAGGGGAGGG + Intergenic
1151336252 17:73441337-73441359 GGTGTGTTGGGGGAGGGGGCCGG - Intronic
1151978975 17:77498076-77498098 GGTGGCCTGGGGCAAAGGGCTGG - Intronic
1152407319 17:80105056-80105078 GATGTCCTTGGGGAAGAAGGTGG - Intergenic
1152574123 17:81132733-81132755 GCTGTGCTGAGGGAAGGGGCTGG - Intronic
1152659370 17:81535324-81535346 GGTGGTCATGGGGATGGGGCTGG - Intronic
1152749571 17:82056454-82056476 GGTTGTCCTGGGGAAGGGGCTGG - Exonic
1153803154 18:8689201-8689223 GAAGTCTTTGGGGAAGGGGAAGG + Intergenic
1154380361 18:13844187-13844209 TGTGTCTTGGAGGAAGGGGCTGG + Intergenic
1156020812 18:32597620-32597642 GAGGTCCTTGGGGAAGGGAAGGG + Intergenic
1156494563 18:37517393-37517415 GGTGGCTTTTGGGCAGGGGCAGG + Intronic
1157416983 18:47511852-47511874 GGTGTCCTTGGAGCAGGGCTGGG + Intergenic
1157481719 18:48059555-48059577 GGTCTCCTGGAGGGAGGGGCAGG + Intronic
1157586714 18:48805677-48805699 GGTGGCCTTGGAGCAGGGACTGG + Intronic
1157776470 18:50400557-50400579 CGAGTCCTTGAGGAAGGGGGTGG - Intergenic
1157790570 18:50527664-50527686 GATGTCGTTGGAGAAGTGGCTGG + Intergenic
1158511498 18:58094657-58094679 GGAGTCCATGGAGAAGGGGAAGG - Intronic
1158799511 18:60889877-60889899 TGTGTCCTTGGGGCAAGGGATGG - Intergenic
1158878248 18:61752826-61752848 GGTGGCCTTGGTGGAGGGGCAGG + Intergenic
1160243311 18:77137865-77137887 GGTGTCCTGGGGGAAATGCCAGG + Intergenic
1160505348 18:79423576-79423598 ACTGTCCTGGTGGAAGGGGCTGG + Intronic
1160774435 19:848537-848559 GGACTCCTTGAGGAAGGGGATGG + Intergenic
1160907153 19:1456751-1456773 GCTGCCCTTGGGGACGGGGCAGG + Intronic
1160966549 19:1749314-1749336 GGTGCCCGAGGGGAAGGGTCCGG - Intergenic
1160972544 19:1775927-1775949 GAGGTCCCTGGGGAGGGGGCCGG - Exonic
1161112542 19:2478299-2478321 CGTGTCCCCGGGGAGGGGGCAGG - Intergenic
1161239375 19:3213464-3213486 GGCCTCCTGGGGGAAGGGGAGGG + Intergenic
1161250388 19:3276715-3276737 CGTGGCCTTGGGGAAGGGCAAGG + Intronic
1161333617 19:3699738-3699760 TGTGTCCTGGGGGAAGGCTCGGG + Intronic
1161388937 19:4011338-4011360 GGTGTCCTCGAGGGATGGGCTGG - Intronic
1161482953 19:4519784-4519806 GCTGCCCTTTGGGAAGGGGAGGG - Intergenic
1161496180 19:4587079-4587101 AGTGTCATTTGGGCAGGGGCAGG + Intergenic
1161579391 19:5072343-5072365 GGAGTCCTTGGGGAGTGGGCTGG + Intronic
1161698437 19:5782922-5782944 GGGGGCCTTGGGGATGGGGAGGG - Intergenic
1161821450 19:6533300-6533322 GGAGGGTTTGGGGAAGGGGCAGG - Intronic
1161964524 19:7540907-7540929 GGTGACCCTGGGGGAGGGGAGGG - Exonic
1162061010 19:8095318-8095340 GGTGTACATGGAGCAGGGGCTGG + Intronic
1162466972 19:10848303-10848325 TGTGTGTTTGGGGAAGGGGTGGG + Intronic
1162479306 19:10919510-10919532 GCAGACCTGGGGGAAGGGGCAGG + Intronic
1162750311 19:12825645-12825667 GGTGTCCTGAGGGGCGGGGCTGG + Exonic
1162957429 19:14107115-14107137 GCTGTGCTGGGGGCAGGGGCGGG + Intronic
1163103140 19:15109413-15109435 GCTCACCTTGGGGAAGGGGATGG - Intronic
1163228505 19:15981110-15981132 GGGGTCCTAGAGGAGGGGGCAGG - Intergenic
1163272142 19:16260755-16260777 GGTGTCCTGGGAGAAGGCCCTGG - Intergenic
1163666224 19:18605338-18605360 GGGCTCCTCCGGGAAGGGGCAGG - Intronic
1163807767 19:19410319-19410341 GGAGTTCTTGGGGCAGGGGGTGG + Intronic
1164510146 19:28889946-28889968 GGTGTCCTGTGAGCAGGGGCAGG + Intergenic
1164593120 19:29517022-29517044 GGTGTGCTCGGGGAGGGGGCTGG - Intergenic
1164794208 19:31013547-31013569 GGGGGCCTTGGGGCTGGGGCAGG - Intergenic
1164836532 19:31358462-31358484 GTTCTCCTTGGTGAATGGGCAGG - Intergenic
1165453885 19:35900029-35900051 GGTCTCGGTGGGGAAGGGTCCGG - Intronic
1166051867 19:40265398-40265420 GGCGTCCTCAGGGAAGGGGCTGG - Intronic
1166052471 19:40268460-40268482 GGTGGCCTTGGGCAGGGTGCCGG + Intronic
1166136272 19:40778821-40778843 GCTGTCCTTGAGTTAGGGGCAGG + Intronic
1166250375 19:41565323-41565345 GCCTGCCTTGGGGAAGGGGCGGG + Intronic
1166254050 19:41589848-41589870 TGTGGTCTGGGGGAAGGGGCTGG - Intronic
1166569035 19:43782001-43782023 GATGCCCTGGGGGAAGGGGATGG + Intergenic
1166698849 19:44870247-44870269 GGTGGCCATGGGGAAGTGGTGGG + Intronic
1166806952 19:45493138-45493160 GGTGGGCTTGCGGAACGGGCTGG - Exonic
1166827662 19:45619393-45619415 GAGGTCCCTGGAGAAGGGGCAGG - Intronic
1166837829 19:45678010-45678032 GGGGACCGAGGGGAAGGGGCCGG + Intronic
1167001362 19:46747128-46747150 GGTGGCTATGGGGGAGGGGCTGG - Intronic
1167077058 19:47256609-47256631 GGTGACCTGGGGGAGGGGGCCGG + Exonic
1167253854 19:48415635-48415657 GGACTCCTAGGGGAAGGGGGCGG + Intronic
1167449020 19:49556281-49556303 GGAGTGCTGGGGGAAGGGGAGGG + Intronic
1167453015 19:49583445-49583467 GGGGTCCTGGAGGAAGGAGCAGG - Intronic
1168065218 19:53915380-53915402 GCTGACCATGGGGAAGGGGGTGG - Exonic
1168106640 19:54169471-54169493 GGTGTCCTGGGGGCAGGGCCTGG - Intronic
1168266315 19:55225544-55225566 GATTTCCTTGAGGAAGGGTCAGG - Intergenic
1168266654 19:55227264-55227286 GGTGGGCATGGGGCAGGGGCTGG + Exonic
1168392962 19:56025844-56025866 AGTGGCCTTGGGGAGGGGGAGGG - Intronic
926062802 2:9814559-9814581 GGCGTCCCTGGGGAAGGGAGAGG - Intergenic
927275709 2:21260629-21260651 TGTGTGCTTGGGGAAGGAGCTGG + Intergenic
927812642 2:26188465-26188487 AGAGTACATGGGGAAGGGGCTGG + Exonic
927926003 2:27014280-27014302 GGAGTCCTTGGGGTAGGTTCTGG - Intronic
929194686 2:39172947-39172969 GGTGTCACTGGGGAGGGGACAGG - Intergenic
929788895 2:45009880-45009902 GGTGTCCAGGAGGAAGGGGAGGG + Intergenic
931248250 2:60508752-60508774 GGTCTCCTTGGCGACAGGGCTGG + Intronic
931441629 2:62294242-62294264 GCTGTCCTGGGGGAACTGGCTGG + Intergenic
932318404 2:70801839-70801861 GGTGACCTGGGGGACGTGGCCGG - Intergenic
932479071 2:72027826-72027848 GGTGACTCTGGGGAAGGTGCTGG - Intergenic
932876116 2:75454516-75454538 GGTGTCCTTGGGTTGGGGCCTGG - Intergenic
933884072 2:86701658-86701680 GGAATCCTTGGGAAAGGTGCAGG - Intronic
934709494 2:96505639-96505661 GGAGTCTTTGGGGGCGGGGCTGG - Intronic
934856519 2:97733365-97733387 TGTGGCCTTGGGGATGGAGCTGG + Intronic
934892811 2:98085742-98085764 AGTGTCCTAGGGAAAGGAGCAGG + Intergenic
935393482 2:102580181-102580203 GGAGTCCTTTGGGAGGTGGCGGG + Intergenic
936039050 2:109135295-109135317 CGTGTCCTGGGGGAGGTGGCAGG - Intronic
936330645 2:111545250-111545272 GGGGTCCTTGGGAAAGGAGAGGG - Intergenic
936514660 2:113174127-113174149 TGGGTCCTTGTGGCAGGGGCTGG + Intronic
936884912 2:117299250-117299272 GGTGTCCTTGTGGCAGAGGGTGG - Intergenic
937060400 2:118976529-118976551 GGTGTTCCTGGGGCAGGGGCAGG - Intronic
937291662 2:120785620-120785642 GCTGGGCTTGGGGCAGGGGCAGG - Intronic
937400264 2:121576531-121576553 GGGCTCCTTGGAGAAGTGGCTGG - Intronic
938069732 2:128302057-128302079 GGTGTCCTGAGGGATGGGACTGG - Intronic
938070215 2:128304451-128304473 GCTGTCTTTGGCTAAGGGGCAGG + Intronic
938229816 2:129648808-129648830 TGTGGCCATGGGTAAGGGGCCGG - Intergenic
938616305 2:133002666-133002688 GGTTTCCTTAGGCAAGGGACGGG - Intronic
939914150 2:148020137-148020159 AGTGGCTTTGGGGAAGGAGCAGG - Intronic
939969501 2:148644416-148644438 GGTGTCCCGGAGGAAGGCGCCGG - Intergenic
940006885 2:149016380-149016402 GGTGGCCATGGGGGAGGGTCCGG + Intronic
942415293 2:175752250-175752272 GGTGCCCATGATGAAGGGGCTGG + Intergenic
943640379 2:190351468-190351490 GGTGTCCTTGGAGAAGAAGGTGG - Intronic
945137124 2:206641334-206641356 TGGTACCTTGGGGAAGGGGCTGG + Intergenic
947013490 2:225591490-225591512 AGTGTTCTCGAGGAAGGGGCTGG - Intronic
947743709 2:232496935-232496957 GCTGTACTTGGGGATGGGGCAGG - Intergenic
947744899 2:232502492-232502514 GCTGGGGTTGGGGAAGGGGCAGG - Intergenic
947814120 2:233024506-233024528 GGTGTGGGTGGGGAAGGAGCTGG - Intergenic
947817454 2:233047788-233047810 GGTGTCCTGGAGGAGGAGGCGGG + Intergenic
948155307 2:235776720-235776742 GGTGTGCAAGGGGAAGGGGGAGG - Intronic
948395867 2:237644511-237644533 GGTGTTCTTGGGTTAGAGGCGGG + Intronic
948426049 2:237887074-237887096 GCTGCCCATGGGGAAGGGGTGGG + Intronic
948458078 2:238116491-238116513 TGAGTCCCTGGGGCAGGGGCCGG + Intronic
948575535 2:238947184-238947206 GCTGTGCCTGGGGCAGGGGCGGG + Intergenic
948598735 2:239096487-239096509 GGTGTCCATGGGGGCGGGGCGGG - Intronic
948686541 2:239673990-239674012 GGTGACTTTGGGCATGGGGCAGG - Intergenic
948821790 2:240553566-240553588 GGGGGCCTTGGTAAAGGGGCAGG - Intronic
948830205 2:240594886-240594908 GGTGGGCTTGTGGGAGGGGCTGG + Intronic
948835669 2:240624873-240624895 GGTGGGCTTGGAGGAGGGGCCGG + Intronic
948888442 2:240895642-240895664 GGTGTGCCCAGGGAAGGGGCTGG - Exonic
948908491 2:240991341-240991363 GGCGGCCCTGGGGAAGGTGCTGG + Intronic
948910795 2:241001677-241001699 GGTTTCCTAGGGGCAGGTGCAGG + Intronic
948913720 2:241019479-241019501 GTGGTCCTGGGGGCAGGGGCAGG + Intronic
948931139 2:241133206-241133228 GGTGTCCTGGGCCAAGGAGCAGG - Intronic
949064546 2:241981774-241981796 GGTGGCAGAGGGGAAGGGGCAGG + Intergenic
1169186973 20:3626695-3626717 GGTACCTTTGGGGAAGAGGCAGG - Intronic
1169198820 20:3697756-3697778 GGTGGCCTGGGGGCAGGGGCTGG - Intronic
1169568730 20:6884171-6884193 CCTGTGTTTGGGGAAGGGGCAGG + Intergenic
1170522062 20:17196937-17196959 AATGTAATTGGGGAAGGGGCAGG + Intergenic
1171309534 20:24135188-24135210 GGTGGCGCCGGGGAAGGGGCAGG + Intergenic
1171347857 20:24479420-24479442 GATGGCCTTGGGTAAGGGGTAGG - Intronic
1171387141 20:24778167-24778189 TGTTTGCTTGAGGAAGGGGCTGG - Intergenic
1172118150 20:32583798-32583820 GGTGGCGTGGGGGAGGGGGCGGG - Intronic
1172406463 20:34693547-34693569 GCTGTCCTTGGGGAAGGCAGTGG - Intergenic
1172603271 20:36198001-36198023 GGTGCCCTTGGGGGAGGGGGAGG - Exonic
1172767428 20:37358316-37358338 GCTGGGCTTTGGGAAGGGGCTGG + Intronic
1172783638 20:37451789-37451811 GCTGCCCTTGGGGAACGGGCAGG - Intergenic
1172799736 20:37567470-37567492 GCTGACTTTGGGGAAGGGGAGGG - Intergenic
1174113829 20:48213788-48213810 GGTGGCCTTGCAGGAGGGGCGGG + Intergenic
1174136058 20:48380658-48380680 GGTGTGCCTGGGGAAGAGGCAGG + Intergenic
1175141929 20:56867225-56867247 GGGGTCCTTGGGGCAGGGTGTGG - Intergenic
1175643937 20:60655421-60655443 GGTGTCCTTAGGGAAGGTGGAGG - Intergenic
1175697596 20:61114038-61114060 GGCGACCTTGGGGAATGGTCAGG + Intergenic
1175915065 20:62422451-62422473 GGCGTCTTTGGGGGTGGGGCTGG + Intronic
1175959115 20:62626122-62626144 TGTGGGCCTGGGGAAGGGGCCGG + Intergenic
1176141755 20:63547903-63547925 GGTGCCCTTGGGCATGGGCCAGG - Intronic
1176210806 20:63920366-63920388 GGTGTGGTGGGGGAAGGGGCTGG + Intronic
1176215439 20:63945554-63945576 GGAGGCCTTGGGGACAGGGCAGG + Intronic
1176233344 20:64042772-64042794 GGGGTCGTGGGGGACGGGGCGGG + Intronic
1176233364 20:64042813-64042835 GGGGTCGTGGGGGACGGGGCGGG + Intronic
1176233385 20:64042855-64042877 GGGGTCGTGGGGGACGGGGCGGG + Intronic
1176233396 20:64042876-64042898 GGGGTCGTGGGGGACGGGGCGGG + Intronic
1176233417 20:64042918-64042940 GGGGTCGTGGGGGACGGGGCGGG + Intronic
1176233445 20:64042980-64043002 GGGGTCGTGGGGGACGGGGCGGG + Intronic
1176235125 20:64050343-64050365 AGGGCCCTTGGGGAAGGGGCTGG + Intronic
1176267994 20:64220733-64220755 GGGGTCCCTGTGGAAGGAGCAGG + Intronic
1177273550 21:18877818-18877840 GGGCTCCCAGGGGAAGGGGCAGG - Intergenic
1178480326 21:32974637-32974659 TATGTCCTTGGGGAAGGGGAAGG + Intergenic
1178785158 21:35646915-35646937 GGTCTCCTTGGGGAAGGCACTGG - Intronic
1178893855 21:36542861-36542883 GTAGTCCTTGGGGCAGAGGCAGG - Intronic
1178958617 21:37044440-37044462 GGGGTCCCTGGGTAGGGGGCAGG - Intergenic
1179193335 21:39142126-39142148 TTTGTCCTGGGGTAAGGGGCGGG + Intergenic
1179281847 21:39940512-39940534 TGTGTCCTTGAGAAAGGGACAGG + Intergenic
1179561646 21:42219467-42219489 GGTGGCCCTGGCGGAGGGGCAGG - Intronic
1179874818 21:44262287-44262309 GGTGGCTGTGGGGTAGGGGCAGG + Intergenic
1179904711 21:44416473-44416495 GGGGTGCATGTGGAAGGGGCAGG - Intronic
1180090457 21:45531272-45531294 GGTATCCATGGGGCAGGGGGCGG + Intronic
1180189064 21:46154063-46154085 GGTGTCCTGGGAGAGGGGGTAGG - Intronic
1180970401 22:19812041-19812063 GGAGGCGTTGGGGGAGGGGCCGG - Intronic
1180998444 22:19976914-19976936 GGGGTCAGTGGGGCAGGGGCAGG + Intronic
1181029270 22:20142122-20142144 GAGGTCCCTGGGGATGGGGCTGG - Intronic
1181638562 22:24185377-24185399 GGTGTCCTGGAGGGTGGGGCTGG + Intronic
1182093165 22:27609605-27609627 ATTGTCCTGGGGGAAGGGACGGG - Intergenic
1182108133 22:27703936-27703958 GGTGTTCTTGGAGAAGGAGAAGG - Intergenic
1182122690 22:27797775-27797797 GGTGTAGTTGGGGGAGAGGCTGG + Exonic
1182472541 22:30557344-30557366 GGAGTCCATGGCTAAGGGGCTGG - Exonic
1183035083 22:35135149-35135171 GTTGGCCCTGGGGGAGGGGCAGG - Intergenic
1183220315 22:36507808-36507830 AGTGTTCTTGGGGGAAGGGCAGG + Intergenic
1183306604 22:37086249-37086271 GGGGTCCCTGGGGCAGGGGAGGG - Intronic
1183661029 22:39221364-39221386 GGGGGGCTTGGGGCAGGGGCAGG + Intergenic
1183673917 22:39289496-39289518 TGTGTCCTTGGGGCACTGGCGGG - Intergenic
1183931350 22:41237791-41237813 GGTGTCGCTGGGGAAGCCGCGGG + Exonic
1184098597 22:42329825-42329847 GCTTTGCTTGGGGATGGGGCAGG - Intronic
1184207535 22:43014762-43014784 GGTCGGCTCGGGGAAGGGGCGGG - Intronic
1184336512 22:43856311-43856333 TCTGCCCTTGGGGGAGGGGCAGG + Intronic
1184387223 22:44182986-44183008 GGGGTCCCTGGGTAGGGGGCTGG + Intronic
1184847557 22:47098577-47098599 GGTTGCCCTGGGGAAGGGCCAGG + Intronic
1185122119 22:48977516-48977538 GGTGTCCATGGTGGAAGGGCAGG - Intergenic
1185327252 22:50232903-50232925 GGTGTCATCCGGGATGGGGCCGG - Intronic
1185359432 22:50396731-50396753 GGTGTCCCTGTGGCAGGGGGTGG + Intronic
1185391353 22:50562994-50563016 GGTGTCCTCGGGAAAAGGGGCGG + Intergenic
1185408899 22:50672683-50672705 GGTCTCCCAGGGGAGGGGGCAGG - Intergenic
949966816 3:9363616-9363638 TGTGTGCTTGGGGTGGGGGCCGG - Intronic
950213370 3:11140267-11140289 GTTCTCCTTGGGGGAGGGGCGGG - Intronic
950452424 3:13072894-13072916 GGCATCGTTGGGGGAGGGGCAGG - Intronic
950580411 3:13858321-13858343 TTTCTCCCTGGGGAAGGGGCAGG + Intronic
950681332 3:14586997-14587019 AGTGGCCCTGGGGAGGGGGCAGG + Intergenic
950733900 3:14989219-14989241 AGTGGCTTTGGGGAAGGGGTGGG + Intronic
952307221 3:32157012-32157034 AGTGTTCTTGGTGAAGGAGCTGG + Intronic
953042075 3:39264548-39264570 GGAGTCCTTTGGGAAGGAGGAGG + Exonic
953367136 3:42354499-42354521 GATTTCCTCGGGGAAGGGGTGGG - Intergenic
953471837 3:43174025-43174047 GGTAGTCTTGGGGAAGGGGTTGG - Intergenic
953684343 3:45064614-45064636 GGTGTCCGTGGGGGAGGTGGGGG + Intergenic
953768883 3:45763827-45763849 GGTGTGCTAGTGGAAAGGGCAGG - Intronic
954437079 3:50502169-50502191 GGTGGCCAAGGGGAAGGGTCTGG - Intronic
954872760 3:53780225-53780247 GGAGGCCCTGGGGAAGGGGCTGG + Intronic
956057181 3:65312219-65312241 GGACTCATTGGGGAAGGGGATGG - Intergenic
960940665 3:122931157-122931179 GTTGTCCTTGGGAAAAGGGGTGG - Intronic
960985831 3:123280071-123280093 GGTGGCCTTGGGCAAGGCTCTGG + Intergenic
960987867 3:123292295-123292317 GATGTCCATGGGGAAAGAGCTGG + Intronic
961001524 3:123377355-123377377 GGTTTTCTTGGGAGAGGGGCTGG - Intronic
961209140 3:125111908-125111930 GCTGTTCCTGGGGAAGAGGCTGG - Intronic
961584479 3:127910889-127910911 GGTGACCCTGGGAAAGGGGAAGG - Intergenic
962528119 3:136254135-136254157 GTTGTTGTTGGGGAAGGGGACGG + Intronic
964704033 3:159599411-159599433 GGGGACTTTGGGGAAAGGGCAGG - Intronic
966209172 3:177435008-177435030 GGCCTCCTTGAGGAAGGGACCGG - Intergenic
966878375 3:184336195-184336217 GGGGGCCTTGAGGAGGGGGCCGG + Intronic
967168756 3:186807216-186807238 GGTGGCCTTTGAGAAGGGTCAGG - Intergenic
968513021 4:1003566-1003588 GCTGCCCTTGGGTCAGGGGCAGG - Exonic
968664068 4:1811101-1811123 GGAGTCCTGGGGTTAGGGGCTGG - Intergenic
968703286 4:2066731-2066753 GGTGCCCATGGGGAGCGGGCAGG - Exonic
968755121 4:2411815-2411837 GGTGGCAGCGGGGAAGGGGCTGG - Intronic
968813814 4:2811594-2811616 GCGGGCCTTGGGGCAGGGGCCGG + Intronic
969346925 4:6575687-6575709 GGTGCCCGCTGGGAAGGGGCCGG + Intronic
969973143 4:11068954-11068976 GCTGGCCTTGAGGAAGGGGAAGG + Intergenic
970156668 4:13149193-13149215 GGTGTCCTTAGGGAAGAGCCAGG - Intergenic
970750828 4:19358462-19358484 GGAGGCCTTGGGGCAGGGGCGGG + Intergenic
971426035 4:26516371-26516393 GAAGTCCTTGGGGGAGGGGAAGG - Intergenic
972517091 4:39818869-39818891 GGTTTTCTTGGGGTAGGGGTTGG + Intergenic
975329592 4:73099224-73099246 GGTGAGCCTGGGAAAGGGGCGGG - Intronic
975536856 4:75460156-75460178 GCTGTCGTGGGGGATGGGGCAGG - Intergenic
975622557 4:76308570-76308592 GGAGAACTGGGGGAAGGGGCTGG - Intronic
975788886 4:77926122-77926144 GGTGAGCTTGGGGATGGGACAGG + Intronic
975820493 4:78266257-78266279 GGTCTCCTTGGGGATGGGAGGGG - Intronic
981867952 4:149449184-149449206 GGTGTCCTTGTGGTGGGGGGTGG - Intergenic
983938551 4:173519485-173519507 TGTGTGCGTGGGGAGGGGGCGGG - Intergenic
985544094 5:500590-500612 GGGGTCAGTGTGGAAGGGGCCGG + Intronic
985544153 5:500779-500801 GGGGTCAGTGTGGAAGGGGCTGG + Intronic
985574991 5:669848-669870 AGTGTCTCTGGGGAAGAGGCAGG - Intronic
985646739 5:1088553-1088575 GCTGTCATAGGGGAAGGGGTGGG - Intronic
986185471 5:5432148-5432170 GGTTTCTTTGGGGAAGGTGGAGG - Intronic
986277860 5:6295964-6295986 GGTATCCTTGGGGAAATGGCTGG + Intergenic
986551366 5:8959538-8959560 GGTCTCACTGGGGTAGGGGCAGG - Intergenic
986624727 5:9712988-9713010 GATGTCCTGGTGGAAGGGGGTGG - Intergenic
987057489 5:14208485-14208507 GGTTGCCTTGGGGTATGGGCCGG + Intronic
987141762 5:14953632-14953654 AGTGTCCTGGGGGCAGAGGCAGG + Intergenic
989240632 5:39199732-39199754 GGTTTCTATGGGGTAGGGGCTGG + Intronic
989561686 5:42859291-42859313 GGGGACTTTGGGGAAAGGGCAGG - Intronic
991255242 5:64606387-64606409 GATGTCTTTGGGGAAAGGGAAGG + Intronic
991581588 5:68161292-68161314 AAAGGCCTTGGGGAAGGGGCGGG - Intergenic
991583502 5:68180161-68180183 GGTGTTCTTGAGAAAGGGGAAGG - Intergenic
992001851 5:72443928-72443950 GGTGACCTTGGGGCAGAGGGCGG - Exonic
993022330 5:82606057-82606079 GGTGGCAGTGGTGAAGGGGCTGG - Intergenic
995510415 5:112903420-112903442 GGGGACTTTGGGGAAAGGGCTGG + Intronic
996117334 5:119633198-119633220 GGGCTCCTTGGGTAGGGGGCAGG + Intronic
997284136 5:132666360-132666382 GGTGGTGGTGGGGAAGGGGCGGG - Intergenic
998058208 5:139097097-139097119 GGTGGCCTTTGGAAAGGGGAGGG + Intronic
998065469 5:139154598-139154620 GGTATTCCTGGGCAAGGGGCAGG - Intronic
998160588 5:139810785-139810807 GCTGGCAGTGGGGAAGGGGCAGG + Intronic
998161328 5:139814474-139814496 GGTGTCCTTGGGGAACTGTTGGG - Intronic
999406750 5:151313275-151313297 GGTGTCCTTGCAGCAGGGGTTGG + Intergenic
999771472 5:154779464-154779486 GGTGGCTTTGGGGTAGGGGTCGG + Intronic
1000049572 5:157550352-157550374 GGTGTCCTTTTAGAAGGGGGAGG - Intronic
1001527389 5:172438368-172438390 GGGGCCCTTGGGGCAGGGCCGGG + Intronic
1001557323 5:172645611-172645633 GTTGTGCCTGGGGAAGGGGGAGG - Intronic
1002576568 5:180177322-180177344 TGTGTCTTTGGGGAAGCTGCTGG - Intronic
1003076862 6:2989738-2989760 GGTGTCTTTAATGAAGGGGCTGG + Intronic
1006143664 6:31945706-31945728 GCTGGCCTTGGGGGAGGGGGAGG + Exonic
1006425746 6:33961943-33961965 GGTGTGCCTGGGGAGGGGGTGGG - Intergenic
1006474307 6:34244963-34244985 GGTGGGCCTGGGGAAGGGGTGGG - Exonic
1007231066 6:40348019-40348041 TGTGTGCTGGGGGAAGGGGCAGG + Intergenic
1007421630 6:41723320-41723342 GGTGTCTTTGGGGAGGTGGGTGG - Intronic
1007516521 6:42417311-42417333 GGGGTCCGTGGGGTAGGGGCTGG - Intronic
1008508443 6:52253862-52253884 GTTGTCCTTGGGGAAAGGACAGG - Intergenic
1011155099 6:84321764-84321786 GGTGTCCTGGGTGAAGAGCCTGG - Intergenic
1011702245 6:89966733-89966755 GGTGTCCTGGGGGAAGCTTCAGG - Intronic
1012341552 6:98131314-98131336 GGTGGAGTTGGGGAAGGGGTGGG + Intergenic
1012532127 6:100250722-100250744 GGTGAGCTTGGGGAGGAGGCAGG + Intergenic
1014830502 6:126097805-126097827 TGTGTTCTTGGGGCAGGGGCTGG + Intergenic
1016007955 6:139108474-139108496 GGTGTCGGTGGAGCAGGGGCGGG - Intergenic
1017383482 6:153857012-153857034 GGAGCCCATGGGGCAGGGGCGGG + Intergenic
1017711710 6:157174898-157174920 GGGGACATTGGGGAAGGGACTGG - Intronic
1018704952 6:166457279-166457301 GGTGACCTGTGGGCAGGGGCAGG + Intronic
1018825649 6:167406257-167406279 GGTGTCATCAGGGATGGGGCAGG + Intergenic
1019017138 6:168888133-168888155 TGTGACGATGGGGAAGGGGCCGG + Intergenic
1019299319 7:295578-295600 GGTGTCCCAGGGAAAGAGGCAGG - Intergenic
1019312073 7:367756-367778 GGTTCCCTTGGTGAGGGGGCTGG - Intergenic
1019316948 7:391254-391276 GGTGCCCTGAGGGAAGTGGCTGG + Intergenic
1019416013 7:926787-926809 GGTGTCCCTGGGGCAGGAGGAGG - Intronic
1019477839 7:1252510-1252532 GGTGGCCGTGGGGATGAGGCTGG + Intergenic
1019515547 7:1438347-1438369 GGTCTCCCTGGAGAAGGAGCAGG + Exonic
1019609385 7:1929248-1929270 GGTGTCTTTGGGGAGGAGGGAGG - Intronic
1019615332 7:1956854-1956876 GGACACCTTGGGGAAAGGGCTGG + Intronic
1019644335 7:2121067-2121089 AGTGTCCTTGCGGCTGGGGCTGG - Intronic
1019685119 7:2377588-2377610 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1019685142 7:2377716-2377738 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1019685153 7:2377780-2377802 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1019685187 7:2377969-2377991 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1019685198 7:2378033-2378055 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1019685209 7:2378097-2378119 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1019685262 7:2378410-2378432 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1019685273 7:2378474-2378496 GGTGTCATGGAGGAAGGAGCAGG + Intronic
1020109127 7:5438291-5438313 GATGTGCTTGGGGAAGGTTCAGG - Intronic
1021884986 7:25129450-25129472 AGTGTGCTTGCGGAAGGGACAGG - Intergenic
1023806266 7:43875169-43875191 GGAGCTCTTGGGGAAGGGCCTGG + Intronic
1023838662 7:44082893-44082915 TGTGTCCTTGGCGCCGGGGCTGG + Intergenic
1023926753 7:44675075-44675097 CGTGTCCTGGGGGGAGGGGGAGG + Intronic
1024522701 7:50319967-50319989 GGTTTCCCTGGGGAAGGTGCAGG + Intronic
1024676416 7:51641704-51641726 AGTGTCTATGGGGAAGGGTCAGG - Intergenic
1024729509 7:52238823-52238845 GGTGTGCCTGGGGAAGGGTGGGG - Intergenic
1025300822 7:57818739-57818761 GCTGGCCCTGGGGAAGGGGTTGG + Intergenic
1026184919 7:68075072-68075094 GCTGTTCTTGGGGATGGGGTTGG + Intergenic
1026570793 7:71528566-71528588 GCTGTTCTTAGGGAAGGGGCAGG + Intronic
1026846032 7:73699734-73699756 GGTGTCCCTCTGGAAGGGGCTGG - Exonic
1028466924 7:91162846-91162868 GGTGCTCTTAGGGAAGGGGCAGG + Intronic
1029084571 7:98001113-98001135 AATGGCCTTGGGGAAGGGGTAGG + Intergenic
1029215085 7:98942294-98942316 GGGGACCCTAGGGAAGGGGCTGG - Intronic
1029256511 7:99273268-99273290 GGCTTCCCTGGGGAAGGGGTGGG - Intergenic
1029438298 7:100574351-100574373 TGACTCCTGGGGGAAGGGGCCGG + Intronic
1029491115 7:100870597-100870619 GATGTGGTTGGGGATGGGGCTGG + Exonic
1029730272 7:102433884-102433906 GGCGTCCCTGGGGGAGGGACAGG + Intronic
1030173205 7:106625532-106625554 GGTGTTCTTGGGAACAGGGCTGG + Intergenic
1031484187 7:122308764-122308786 GTTGCTCTTGGTGAAGGGGCTGG - Intronic
1032211370 7:129917375-129917397 TGTGTCCTCAGGGTAGGGGCTGG - Intronic
1032306258 7:130734270-130734292 GGTGTCCTGCGGGCCGGGGCGGG - Intergenic
1032495775 7:132361071-132361093 TGAGTCCTTGGGGAAGTGGATGG - Intronic
1033628742 7:143136271-143136293 GGTGTCCTTCATGAAGGGTCTGG - Intronic
1033882587 7:145903282-145903304 TGTGTGCTTGGGGAGGGGGATGG + Intergenic
1034376459 7:150649126-150649148 GGTGTCTTAGGGGTGGGGGCAGG + Intergenic
1034377787 7:150661575-150661597 GGTCTCCTTGGGGAGAGGGTGGG - Intergenic
1034419091 7:150979580-150979602 TCTGTCCTTGGAGCAGGGGCTGG + Intergenic
1034462929 7:151208238-151208260 GTTGGCCTCTGGGAAGGGGCTGG - Intronic
1035172902 7:157029744-157029766 GGTAGCCATGGGGAAGGGGAGGG - Intergenic
1035177036 7:157058842-157058864 GGTGCCCATGGGGAAGGCGTGGG + Intergenic
1035231730 7:157469629-157469651 GCTGTCCTGGGGGAAGGGCAAGG + Intergenic
1035258225 7:157645734-157645756 GCTGGCCCTGGGGAGGGGGCTGG + Intronic
1035577958 8:720010-720032 GGTCTTCTTGGAGAAGGGGCTGG - Intronic
1035637010 8:1155128-1155150 GGTATCCCTGGGGCAGCGGCTGG + Intergenic
1036134516 8:6148014-6148036 GGTGTCCTTGGGAAAGGAGAGGG + Intergenic
1036630693 8:10512530-10512552 AGGATCCTTGAGGAAGGGGCTGG - Intergenic
1036710965 8:11078339-11078361 TGTGTTCTTGGGCAAGTGGCAGG - Intronic
1037812076 8:22092694-22092716 AGTGTGCCTGGGGAAGGGGTGGG - Intronic
1038256356 8:25954695-25954717 GGCTCCCTGGGGGAAGGGGCGGG - Intronic
1038280204 8:26157342-26157364 GGTTACCTTGGGTCAGGGGCTGG - Intergenic
1038436766 8:27541750-27541772 GGTGACCTTGGGGATGGAGCTGG + Intronic
1038438912 8:27558263-27558285 GCTGTCCCTGAGGAAGGGGCAGG - Intergenic
1039060377 8:33567387-33567409 GGTGTCCCTGGGCAAAAGGCAGG - Intergenic
1039693680 8:39887094-39887116 GGAGTCCTTGAGGCAGGGGAGGG + Intergenic
1040916333 8:52569258-52569280 GGTCTCCTTGGGGAAGGGCGGGG + Intergenic
1042591412 8:70402576-70402598 GGGGTGCTGGGGGAGGGGGCCGG - Intronic
1042727505 8:71893750-71893772 GGTGTCCTTGGACAAGGGAATGG + Intronic
1042805202 8:72763877-72763899 GGAGACCCTGGGGAAGGAGCTGG + Intronic
1042902878 8:73746488-73746510 GGTGTCCTGAGGGGAGGAGCCGG - Intronic
1043774193 8:84244059-84244081 AGTGGCTTTGGGGCAGGGGCAGG + Intronic
1044637585 8:94342038-94342060 GGTGGCCTGGGGGCAGGGGGTGG - Intergenic
1046801956 8:118438517-118438539 GGTGTGCTTTGGGTAGAGGCGGG - Intronic
1049040989 8:140111496-140111518 GGTGCTGTTAGGGAAGGGGCTGG - Intronic
1049321237 8:141997660-141997682 GTTGTCCCTTGGGAAGGGACAGG - Intergenic
1049412284 8:142478638-142478660 GGTGTCCATGGGGAAGTGGAGGG + Intronic
1049464762 8:142745904-142745926 GGTGTACTTGGGGCAGAGGTGGG + Intergenic
1049792701 8:144479328-144479350 GGGGGACTTGGGGCAGGGGCAGG - Intronic
1049800011 8:144513346-144513368 GGTGGCCTTTGGGATGGGGCTGG - Exonic
1049952239 9:656403-656425 AGTGTCCTTGGGAAATGGGTGGG + Intronic
1050053977 9:1632592-1632614 GGAATCATTGGAGAAGGGGCAGG - Intergenic
1051478649 9:17536096-17536118 GGTTTCCTAGGGCTAGGGGCAGG - Intergenic
1052465772 9:28828026-28828048 GCTATCTTTGGGGAAGGGGCCGG + Intergenic
1053268064 9:36730401-36730423 GGTGTTCTTGGAGAAGGGTCAGG - Intergenic
1056336267 9:85573094-85573116 GGAGACCGTGGGGAAGGGGAGGG - Intronic
1056812248 9:89773927-89773949 GGTTTCCATGCTGAAGGGGCAGG + Intergenic
1057139440 9:92717754-92717776 GCTGGCCTTGTGGAAGGGGAGGG + Intronic
1059471166 9:114505542-114505564 GGAGCCCGTGGGGAGGGGGCGGG - Intergenic
1060050347 9:120374294-120374316 GCTGTCATTGGGGAAGGAGAGGG - Intergenic
1060735366 9:126063459-126063481 GGTGTCCTTGGCATGGGGGCGGG + Intergenic
1060827598 9:126695681-126695703 TGTGCACCTGGGGAAGGGGCTGG + Intronic
1061041920 9:128145373-128145395 GGTGTACTTGGGGGAGGGTTGGG + Intergenic
1061293368 9:129665095-129665117 GTTTTCCTTGGGGAAGGGCCTGG + Intergenic
1061484713 9:130914454-130914476 GGTGGCCCTGGAGGAGGGGCAGG + Intronic
1061627013 9:131846685-131846707 GGTGTCCTTAGGGGAGTGGTGGG - Intergenic
1061841793 9:133362766-133362788 GAAGTCCTTGGGGAAGCTGCTGG - Exonic
1061870784 9:133519215-133519237 TGTGTCCATGGGGAAGCAGCAGG - Intronic
1062133846 9:134914415-134914437 GGTCTCCTGGAGGAAGAGGCAGG + Exonic
1062259589 9:135654804-135654826 GGAGCCGTTGGGAAAGGGGCGGG - Intergenic
1062318616 9:135979829-135979851 GGTGTCCCTGGAGGAAGGGCAGG - Intergenic
1062338786 9:136084305-136084327 GGTGTGCATGGGGACAGGGCTGG - Intronic
1185765101 X:2718993-2719015 AGTCTCCTTGAGGAAGGGACTGG + Intronic
1186445251 X:9621734-9621756 TGTGTCGTTGGGAAATGGGCTGG - Intronic
1186732084 X:12420613-12420635 GGTGTAAATGGGGATGGGGCAGG - Intronic
1187128415 X:16476260-16476282 GGTGTCCTGGGGTAAGGGCGGGG + Intergenic
1187804781 X:23107469-23107491 GGGCTCCTTGGAGAAGTGGCTGG - Intergenic
1187895269 X:23974515-23974537 GGTGGCCTGTGGGAAGGAGCTGG - Intergenic
1187913992 X:24135792-24135814 GGTGGCCTGTGGGAAGGAGCTGG - Intergenic
1188156421 X:26748434-26748456 GGTGGGCCTGGGGAAGGGACGGG - Intergenic
1189279092 X:39808720-39808742 TGTGTCCTTGGGGTGGGTGCTGG - Intergenic
1189663685 X:43330411-43330433 GGTGTTGTGGGGCAAGGGGCAGG + Intergenic
1190281633 X:48934920-48934942 GAGGCCTTTGGGGAAGGGGCAGG - Intronic
1190288123 X:48973984-48974006 GGGATCCTGAGGGAAGGGGCAGG - Exonic
1190296336 X:49029956-49029978 GGTTCCTTTGGGGAAGGTGCAGG + Exonic
1190452383 X:50594900-50594922 GGTGTCCTGGGGTAGGGGGTGGG - Exonic
1190650391 X:52563371-52563393 GGTGACCTGGGGCAGGGGGCAGG - Intergenic
1192430417 X:71107806-71107828 GGGGCCCTTGGGGAGGGGCCTGG - Exonic
1193301267 X:79891763-79891785 AGTTCCCGTGGGGAAGGGGCAGG + Intergenic
1193699942 X:84748011-84748033 TGTGCACTTGGGGAAGGGGGTGG + Intergenic
1193915007 X:87353359-87353381 GGTTTCCTTGGGGAAGGATGGGG + Intergenic
1195221374 X:102747449-102747471 GGTATGCATGGGGAAGGGGAAGG + Intronic
1195255306 X:103084006-103084028 GGGGTCCTTGTCAAAGGGGCAGG - Intronic
1196255660 X:113515366-113515388 GTAGTGCTAGGGGAAGGGGCGGG - Intergenic
1197727170 X:129784093-129784115 GTTGCCCTGGGGGAAGGGGGGGG - Intronic
1197758132 X:130010427-130010449 GGTGGTCTCGGGGAAGGGGAGGG - Intronic
1197870343 X:131058079-131058101 GGGCTCCCTGGGGTAGGGGCAGG + Intergenic
1198179402 X:134191181-134191203 GTTGCCCCTGGAGAAGGGGCTGG + Intergenic
1199559463 X:149147205-149147227 AGGTTCCTGGGGGAAGGGGCAGG + Intergenic
1200067973 X:153514114-153514136 TGAGGCCTTGGGGAAGGGGCTGG + Intergenic
1200162883 X:154018369-154018391 GGTGCGGTGGGGGAAGGGGCAGG + Intronic
1200686948 Y:6266138-6266160 GGTGTCCTGGGGGAAGTGATCGG - Intergenic
1200989826 Y:9337055-9337077 GGTGTCCTGGGGGAAGTGATCGG - Intergenic
1200992494 Y:9357388-9357410 GGTGTCCTGGGGGAAGTGATCGG - Intergenic
1200995146 Y:9377666-9377688 GGTGTCCTGGGGGAAGTGATCGG - Intronic
1200997811 Y:9398012-9398034 GGTGTCCTGGGGGAAGTGATCGG - Intergenic
1201000320 Y:9466545-9466567 GGTGTCCTGGGGGAAGTGATCGG - Intergenic
1201002982 Y:9486858-9486880 GGTGTCCTGGGGGAAGTGATCGG - Intronic
1201005641 Y:9507141-9507163 GGTGTCCTGGGGGAAGTGATCGG - Intergenic
1201008301 Y:9527471-9527493 GGTGTCCTGGGGGAAGTGATCGG - Intergenic
1201439317 Y:13991492-13991514 GGTGTCCTTGGTGGGGGGTCAGG - Intergenic
1201445256 Y:14051216-14051238 GGTGTCCTTGGTGGGGGGTCAGG + Intergenic