ID: 901512560

View in Genome Browser
Species Human (GRCh38)
Location 1:9724711-9724733
Sequence TCCTTGGGGAAGGGGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512549_901512560 5 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512560 1:9724711-9724733 TCCTTGGGGAAGGGGCTGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 459
901512552_901512560 1 Left 901512552 1:9724687-9724709 CCATTATCAGGGCAAGGGCAGGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 901512560 1:9724711-9724733 TCCTTGGGGAAGGGGCTGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 459
901512544_901512560 13 Left 901512544 1:9724675-9724697 CCTTGTGTCCACCCATTATCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 901512560 1:9724711-9724733 TCCTTGGGGAAGGGGCTGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 459
901512550_901512560 2 Left 901512550 1:9724686-9724708 CCCATTATCAGGGCAAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 220
Right 901512560 1:9724711-9724733 TCCTTGGGGAAGGGGCTGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512560 Original CRISPR TCCTTGGGGAAGGGGCTGGT TGG Intronic
900347249 1:2215612-2215634 TACTGGGGCAAGCGGCTGGTCGG - Intergenic
900387973 1:2419297-2419319 TGCTGAGGGAAGGGGCTGGCAGG - Intergenic
900516035 1:3082650-3082672 TCCTGGGGGAGGGGGTTGCTGGG - Intronic
900550616 1:3252602-3252624 GCCCTGGGGGTGGGGCTGGTGGG + Intronic
900591865 1:3463693-3463715 ACCGTGGGGAGGGGGCTGCTAGG + Intronic
900674043 1:3872843-3872865 TCCCTGTGGATGGAGCTGGTGGG + Intronic
901512560 1:9724711-9724733 TCCTTGGGGAAGGGGCTGGTTGG + Intronic
902364989 1:15967127-15967149 TCCTTTGGGATGGCGCAGGTAGG + Intronic
902511056 1:16967385-16967407 GCCTTGGGGGCGGGGGTGGTGGG - Intronic
902575157 1:17372894-17372916 TCCTTTGGGAGGGGGTGGGTAGG + Intronic
902630689 1:17702748-17702770 TCCTGGGGGTGGAGGCTGGTGGG - Intergenic
903383870 1:22914369-22914391 TCCTCGAGGCAGGGGCTGGCGGG - Intronic
904195443 1:28782019-28782041 TTCTGGGGGAAGGGGCAGCTGGG - Intergenic
904277963 1:29396387-29396409 CCCTCAGGGAAGGGGCTGATGGG + Intergenic
904563293 1:31413052-31413074 ACCCTAGGGAAGGGGCCGGTCGG - Intronic
904655272 1:32040888-32040910 TCCTTGGGCAAGCAGCTGATTGG - Intronic
907052009 1:51335983-51336005 GCCTGGGGGAAGGGGCTGGGAGG - Intronic
907370310 1:53998200-53998222 TCTTTGGTGAAGGGTCTGTTCGG - Intergenic
907451382 1:54547903-54547925 TCCCAGGGAAGGGGGCTGGTGGG - Intronic
907645146 1:56234972-56234994 TCCTTGGGAAAGGAGCAGTTAGG - Intergenic
909128421 1:71706108-71706130 GACTTGGGGAAGGGGGTGGCTGG - Intronic
910449233 1:87329482-87329504 TTCTTGGAAACGGGGCTGGTGGG + Intronic
910940663 1:92530330-92530352 ACCTGGGGGAAGGGGCGGTTGGG + Intronic
912638292 1:111319542-111319564 TCCCTGGGCAAGGGGGAGGTGGG - Intronic
914490653 1:148148534-148148556 TCCCAAGGGAAGGTGCTGGTGGG + Intronic
915216928 1:154346562-154346584 TTCTGGGGGAAGGGGCTTTTAGG + Intronic
915519241 1:156431588-156431610 ACCTTGGGGTACAGGCTGGTGGG - Intergenic
915558634 1:156674107-156674129 ACCAAGGGGAAGGGTCTGGTGGG - Intronic
915714166 1:157929053-157929075 TCTCTGGGGAAGGGGGTGGTAGG - Intergenic
917517016 1:175716597-175716619 GACTTGGGGCAGGGGATGGTTGG - Intronic
917791851 1:178504150-178504172 TCCTGGAAAAAGGGGCTGGTGGG + Intergenic
917815926 1:178710088-178710110 TCCTTTAGGAAGGGCCTCGTGGG + Intergenic
918111362 1:181457894-181457916 TGCTGGGGGAAGGGACAGGTGGG + Intronic
919979123 1:202631479-202631501 TGCTTGGGGGAGGGGCCGCTGGG - Intronic
921389881 1:214606682-214606704 TCCCAAGGGAAGGTGCTGGTGGG - Intronic
923143687 1:231183038-231183060 GCCTTGGGGCAGGAGCTCGTGGG + Intronic
923299815 1:232630361-232630383 TTCTTGGGGAGGGGGCTGCGGGG + Intergenic
1063130549 10:3173389-3173411 GCCTTGGGGATGGGGCTTGCAGG + Intergenic
1063348066 10:5329649-5329671 TAATTGGGGATGGGGCTGGGTGG - Intergenic
1066493905 10:35921899-35921921 TCCTTTGATAAGTGGCTGGTAGG - Intergenic
1067085115 10:43234069-43234091 GCCCTGGGGAAGGGGCTGGAAGG + Intronic
1067090155 10:43262377-43262399 TCCTGGGGGGTGGGGCTGGGAGG - Intronic
1068022357 10:51601195-51601217 TTCTTGGGGAAGGGAATGTTTGG + Intronic
1068283104 10:54902336-54902358 TGCTGGGGGAGGAGGCTGGTGGG + Intronic
1069913867 10:71775388-71775410 CCCCTGGGGAAGGGGTTGGCAGG - Intronic
1069984291 10:72273310-72273332 GCCTTGGGGAAGGGGCAGCATGG + Intergenic
1070349317 10:75576413-75576435 ACCTGGGGGAAGGGGCAGTTGGG + Intronic
1071140277 10:82501470-82501492 CCCATGGGGAAGGGGCTGGCAGG - Intronic
1071349049 10:84720977-84720999 TCCCTAGAGAAGGGGCAGGTTGG + Intergenic
1071517429 10:86308049-86308071 TCCTTGGGGGAGGGGATGTAGGG - Intronic
1071737625 10:88318848-88318870 TCTTTGGGGAAGGAGCAGTTGGG - Intronic
1072617859 10:97061457-97061479 ACTTTGGGGAAGGGGCAGGAGGG - Intronic
1072632279 10:97154648-97154670 GCTTTCGGGAGGGGGCTGGTTGG - Intronic
1073187903 10:101627873-101627895 TGCTTTGAAAAGGGGCTGGTGGG + Intronic
1073524155 10:104163685-104163707 TCATTTGGGAAGGGGCTCCTTGG - Intronic
1074482325 10:113835571-113835593 TGCTGGGGGAGGGGCCTGGTGGG + Intronic
1075075193 10:119345984-119346006 GCCTTGGGGGAGGGGGTGGGTGG - Intronic
1076179525 10:128396287-128396309 GCCTTGGGGAAGTGGATGCTGGG + Intergenic
1076618486 10:131771966-131771988 GCCTTGGGGAAGGTGCAGCTGGG + Intergenic
1076674470 10:132141034-132141056 TTCTGGAAGAAGGGGCTGGTGGG - Intronic
1076941351 10:133611407-133611429 TTCTTGGGGCAGAGGCTGCTGGG - Intergenic
1077093848 11:791154-791176 CCCTTGGGGATGGGGCTGCTGGG - Exonic
1077429531 11:2509265-2509287 ACTTTGGGGTAGGGTCTGGTAGG + Intronic
1077433298 11:2526549-2526571 AGCTTGGGGAAGGGGGTGGGGGG + Intronic
1078271866 11:9803473-9803495 TTATTGGGGATGGGGCTGGGGGG - Intronic
1080173182 11:29330730-29330752 TAATTGTGGAAGGGGTTGGTGGG - Intergenic
1080628528 11:34052181-34052203 TCCGCGGGGGAGGGGCGGGTCGG + Intronic
1080726442 11:34903150-34903172 TCCTTGGGGAAGAAGGTGGCTGG - Intronic
1081207515 11:40293015-40293037 TCTTTGGCGAAGGGGCCGGCCGG - Exonic
1081655451 11:44854184-44854206 TCATTGGGGCAGGGGGTGGGGGG + Intronic
1081680253 11:44997549-44997571 CCCTTGGTGATGGGGCTGTTTGG + Intergenic
1081819980 11:45983232-45983254 AGCTTGGGGTGGGGGCTGGTGGG + Intronic
1082986511 11:59174136-59174158 TCCTTGGCAAAGGGGTTGCTGGG - Intronic
1083259571 11:61515873-61515895 TCTGTGGGGGAGGGGCAGGTGGG + Intronic
1083735388 11:64677347-64677369 TTCTTCGGGGAGGGGATGGTGGG - Intronic
1084150447 11:67285702-67285724 CCCTCGGGGAAGGGGCGGGAGGG - Exonic
1084165730 11:67373888-67373910 TCCTGGGGGAGGGGGCGGGGAGG + Intronic
1084311072 11:68316712-68316734 TCCTGGTGGAGGTGGCTGGTGGG + Intronic
1084525970 11:69698176-69698198 AGGGTGGGGAAGGGGCTGGTGGG - Intergenic
1084650707 11:70487580-70487602 TGGTTGGGGAAGGTGGTGGTGGG + Intronic
1084891109 11:72237570-72237592 TCCTGGGGGAAGTGGCCAGTGGG + Exonic
1084938256 11:72598859-72598881 TCCTGGGTGTAGGGGCTGGAAGG - Intronic
1085251181 11:75144942-75144964 TGGTTGGGGATGGGGGTGGTGGG - Intronic
1086312247 11:85548586-85548608 ACCTGGGGGAAGGGGCGGTTGGG - Intronic
1086392028 11:86375057-86375079 TCCGTGGAGAAGGGGCTGGAGGG + Exonic
1087131165 11:94670561-94670583 ATCTTGGGGAGGGGCCTGGTGGG + Intergenic
1088359470 11:108975783-108975805 GGCTTGGGGAAAGGGCTGGAAGG - Intergenic
1089615520 11:119692586-119692608 TCCTTTGGGAGGGGCCTGGCAGG - Intronic
1089730246 11:120514676-120514698 CACTTGGGGTAGGGGGTGGTTGG - Intronic
1090880023 11:130825193-130825215 CCTTGGGGGAAGGGACTGGTGGG - Intergenic
1091464711 12:673896-673918 TTCTTGGGGAAAGAGCTGTTAGG + Intergenic
1094332925 12:29315795-29315817 TGCATTGGGAAGGGGGTGGTTGG + Intronic
1095750025 12:45699559-45699581 TCTGTGGGGAGGGGGTTGGTTGG - Intergenic
1095818743 12:46453516-46453538 TCCTTTGGGAAGGGGGAGGATGG + Intergenic
1095983150 12:47984035-47984057 CCCTGGGGGCAGGGGCTGGGAGG - Intronic
1096214988 12:49793706-49793728 TTCTTGGGGTAGGGACTGGGTGG - Intronic
1096513385 12:52144057-52144079 GCCCTGGGGAAGGAGCTGGAGGG - Intergenic
1097522619 12:60688372-60688394 TCCTTGTGGAATGGGCTCATTGG - Intergenic
1098915616 12:76254025-76254047 TCCATGGGGAGGGGGCAGTTTGG + Intergenic
1100394156 12:94170329-94170351 GGCTTGGGGATGGGGATGGTGGG - Intronic
1100491299 12:95081391-95081413 TCTTTGATGAAGGGTCTGGTTGG + Exonic
1100980695 12:100160039-100160061 TCCTGGGGGCGGGGGGTGGTGGG - Intergenic
1102347102 12:112167393-112167415 TCCTTCTGGAAGACGCTGGTGGG - Exonic
1102506574 12:113387961-113387983 GCTTTGGGGAAGGGACAGGTTGG + Intronic
1102582941 12:113903060-113903082 TGCTTAGGGAAGGGGAAGGTAGG - Intronic
1103614975 12:122146084-122146106 TCCTTGGGGAAGGGAAAGGAGGG + Exonic
1104035190 12:125092805-125092827 TCCTTGTGGGAGGGTCTGGAGGG + Intronic
1104134103 12:125921248-125921270 TCCTTGGGGGTGGGGCTGGGAGG - Intergenic
1104889473 12:132133281-132133303 TCCTTGGAGCCGGGGCTGATGGG + Intergenic
1104964076 12:132501215-132501237 CCCTGGGGCTAGGGGCTGGTAGG - Intronic
1105559964 13:21480978-21481000 TCTCTGGGAAAGGGGCTGATTGG - Intergenic
1105896845 13:24723830-24723852 TCCGTGGGGCAGGTGCTGGTGGG + Intergenic
1106130951 13:26939067-26939089 TCCTGGGGGAGGGTCCTGGTGGG - Intergenic
1107442358 13:40439686-40439708 GCCTTGGAGGAGGGGCCGGTGGG - Intergenic
1110543562 13:76732476-76732498 TCCTTGGGCATGTGGCTGGGTGG - Intergenic
1111950036 13:94702927-94702949 TGGTTGGAGAAGGGGCTGGCGGG - Intergenic
1112537568 13:100275040-100275062 CCCTTGGGGGAGGGGGTGGGGGG + Intronic
1113380005 13:109795662-109795684 TTCCTGGGGAAGGGACGGGTTGG + Intergenic
1114883096 14:26811294-26811316 TCATTGGGGAAAAGGCAGGTGGG + Intergenic
1117993652 14:61458873-61458895 ATGTTGGGGAAGGGCCTGGTGGG - Intronic
1118368505 14:65115915-65115937 TGCTGGAGGAGGGGGCTGGTGGG - Intergenic
1118391983 14:65303560-65303582 ACTTTGGGGATGGGGCTGGAGGG + Intergenic
1119415030 14:74464230-74464252 ACCTTGGCTAAGGAGCTGGTTGG + Intergenic
1120009466 14:79397010-79397032 TCTTTGGGGAGGGAGCTGTTAGG + Intronic
1121019813 14:90573028-90573050 TCCTTGGGGCGGGGGTTGGGGGG + Intronic
1121739059 14:96238780-96238802 GACTTGGAGAGGGGGCTGGTGGG - Intronic
1121800944 14:96773753-96773775 TCCTCAGAGAAGGGGCTGATTGG + Intergenic
1122199697 14:100114867-100114889 TCCTTGCGGAAGCGGCAGGGTGG + Intronic
1122706691 14:103626367-103626389 ACATTGGGGAAGGGACAGGTGGG + Intronic
1122820385 14:104341794-104341816 CCCTTGCAGAAGGGGCTGGAGGG - Intergenic
1122877431 14:104675212-104675234 TCTTGGAGGAAGGGCCTGGTGGG - Intergenic
1122941841 14:104984994-104985016 TCCTGGGGGAAGGAGCTGCGGGG - Intergenic
1122942790 14:104989932-104989954 ACCCTGGGGCAGGTGCTGGTTGG - Intronic
1123541064 15:21292033-21292055 TAATGGGGGAAGGGGATGGTGGG + Intergenic
1123696186 15:22880747-22880769 TCCTTGGGGAAGGGGCACTCGGG - Intronic
1124291314 15:28455964-28455986 TCCCAAGGGAAGGCGCTGGTGGG - Intergenic
1125511278 15:40293762-40293784 TGCTTGGGGAAGAGCCTGGGTGG - Intronic
1126958829 15:53966827-53966849 TCTTTGGGGAAGGGGTTCATGGG + Intergenic
1127848638 15:62894115-62894137 TTCTGGGGGAAGGCCCTGGTGGG - Intergenic
1129473326 15:75767002-75767024 ACCTGGGGGAAGGGGTTGGGGGG + Intergenic
1129695574 15:77739048-77739070 TCCCTGGGGTGGGGGCTGCTGGG - Intronic
1129731562 15:77935400-77935422 ACCTGGTGGAAGGGGCAGGTGGG + Intergenic
1130661367 15:85833753-85833775 CTCATGGGGAAGGGGCAGGTGGG + Intergenic
1130750215 15:86703605-86703627 TCCCTGTGGAAGGACCTGGTGGG + Intronic
1130960477 15:88655536-88655558 TCCCTGCGGAACGGGCTGGATGG - Exonic
1132091155 15:98948848-98948870 TCCTTGTGGAAGGAGCTGAGTGG + Intronic
1132248867 15:100318461-100318483 ACCTGGGGGAAGGGGCTAGCTGG - Intronic
1202949377 15_KI270727v1_random:19174-19196 TAATGGGGGAAGGGGATGGTGGG + Intergenic
1132684204 16:1155481-1155503 GCCATGGGGAAGGGTCTGGAAGG + Intronic
1133453567 16:5923295-5923317 TGATTGGGGATGGGGATGGTGGG + Intergenic
1133678675 16:8099716-8099738 TGCTGGGGGAGGGGCCTGGTGGG + Intergenic
1133950115 16:10384665-10384687 TATTTGGGGAACTGGCTGGTTGG + Intronic
1134040745 16:11066386-11066408 TCCAGGGGGCAGGGGCTGGGAGG + Intronic
1135798111 16:25465576-25465598 TCCTGGTGGAAGGAGGTGGTAGG - Intergenic
1137222517 16:46470206-46470228 ACCTTTGGGAAGGGGCTACTGGG - Intergenic
1137713777 16:50585317-50585339 TCCTGGGCTCAGGGGCTGGTAGG + Intronic
1137763119 16:50956583-50956605 CCCTTGGGGAAGGGTGGGGTGGG + Intergenic
1139489264 16:67278040-67278062 TCCTGGGGGACTTGGCTGGTGGG + Exonic
1141530516 16:84643411-84643433 TCCTGGGGGAGGAGGCTGGGAGG - Intergenic
1141810200 16:86371036-86371058 TCCTGGGGGGAGGGGCGCGTGGG - Intergenic
1143010741 17:3865023-3865045 GCTTTGGGGAAGGGGCTGGTGGG - Intronic
1143102899 17:4513993-4514015 CCCTGGAGGGAGGGGCTGGTGGG - Intronic
1144647730 17:16987051-16987073 GCCTCTGAGAAGGGGCTGGTAGG - Intergenic
1144956972 17:19023567-19023589 TCCTTGATGAAAGGGCTGGCTGG + Intronic
1144991674 17:19237712-19237734 TCCGTGGGGCGGGGCCTGGTTGG - Intronic
1145191237 17:20843136-20843158 TCCCAAGGGAAGGTGCTGGTGGG + Intronic
1145718913 17:27049904-27049926 TCCTGGTGGAAGGGGCAGGATGG - Intergenic
1146912921 17:36659668-36659690 TGCTTAGAGAAGGGGATGGTGGG + Intergenic
1146937661 17:36822378-36822400 GCCTTGGGTGAGGGGCTTGTGGG + Intergenic
1148226031 17:45898217-45898239 GATTTGGGGAAGGGGCTTGTTGG + Intronic
1148388993 17:47256552-47256574 TCCCTGGGGAAGCAGATGGTGGG + Intronic
1148773275 17:50079082-50079104 CCAATGGGGGAGGGGCTGGTGGG + Exonic
1149566476 17:57644054-57644076 TGGTTGGGGAAGGGGGTGCTGGG - Intronic
1149867867 17:60160796-60160818 CCCTGGGGGAAGGGGCGGCTGGG + Intronic
1149998290 17:61416422-61416444 TCCCTGGAGAAGGAGCTAGTGGG - Intergenic
1150054672 17:62003052-62003074 TACCTGGGGATGGGGCTGGAGGG + Intronic
1150086785 17:62277662-62277684 CCCTGGGGGAAGGGGCGGCTGGG - Intronic
1150632866 17:66892280-66892302 TCCTTGGGGAAAGGGCTCAGAGG - Intergenic
1151193563 17:72415853-72415875 TTCTTGGGCACGGGGTTGGTGGG + Intergenic
1151317810 17:73334851-73334873 ACCCTGGGTGAGGGGCTGGTGGG - Exonic
1152659368 17:81535320-81535342 GTCATGGGGATGGGGCTGGTGGG - Intronic
1152781099 17:82227789-82227811 TGTTTGGGGATGGGGGTGGTTGG + Intergenic
1152821444 17:82439740-82439762 TCTTTCGGGGAGGGGCCGGTGGG - Intronic
1153273697 18:3348128-3348150 GTCTTGGGGAAGGGATTGGTAGG - Intergenic
1153805438 18:8705790-8705812 TCCTTGAGGAAGGGTCTGGCGGG - Intronic
1154493503 18:14939247-14939269 TCCTAGGGCAAAGGACTGGTGGG - Intergenic
1155341630 18:24819415-24819437 TCCAAGGGGCAGGGGCAGGTGGG + Intergenic
1157504855 18:48219014-48219036 AAGTTGGAGAAGGGGCTGGTTGG - Intronic
1157700888 18:49761120-49761142 GCCTAGGGGCAGGGGCAGGTGGG + Intergenic
1160780917 19:877706-877728 CACGTGGGGCAGGGGCTGGTGGG - Intronic
1160801890 19:974134-974156 CCCCTGGGGAGGGGGCTGGGGGG + Exonic
1160895903 19:1401664-1401686 TCCTTGGGGAGGGGGCGGCCGGG - Intergenic
1160994965 19:1878292-1878314 TCCCAAGGGAAGGTGCTGGTGGG - Intronic
1161021284 19:2012931-2012953 TCTTTGGGGAGGGGGTAGGTTGG - Intronic
1161301028 19:3543398-3543420 GCCTCGCGGAAGGGGCTGGCCGG - Exonic
1161479845 19:4505006-4505028 TCCCTGGGGGAGGGGGAGGTGGG - Intronic
1161708142 19:5831875-5831897 TCCCTGGGGCAGGGGCTTGTGGG + Exonic
1161864161 19:6821783-6821805 TCGGTGGGGAAGGGCCTGGGGGG - Exonic
1162576331 19:11501153-11501175 GATATGGGGAAGGGGCTGGTGGG - Intronic
1162591932 19:11597658-11597680 GACCTGGGGGAGGGGCTGGTTGG + Intronic
1162700860 19:12513694-12513716 GACTTGGAGGAGGGGCTGGTTGG - Intronic
1163488347 19:17602752-17602774 TCCGTGTGGAAGGGGAAGGTTGG + Exonic
1164811131 19:31156900-31156922 TGCATGGGGATGGGGCTGGCAGG + Intergenic
1164880389 19:31727987-31728009 TCCTTGGGGAGGGGTGGGGTGGG - Intergenic
1165225718 19:34353087-34353109 TCCTTGGGGACAAGGGTGGTTGG + Exonic
1165373062 19:35422132-35422154 GGCTGGGGGAAGGGGCTGGATGG - Intergenic
1166672001 19:44716013-44716035 TCCTAGGTGGAGGTGCTGGTGGG + Intergenic
1166818944 19:45564493-45564515 TCCTCTGGCATGGGGCTGGTGGG + Intronic
1166868859 19:45858368-45858390 TCTTTGAGGAAGGGGCATGTTGG - Intronic
1166987529 19:46670336-46670358 TGTTTTGGGAAGGGGGTGGTTGG + Intergenic
1167416349 19:49375061-49375083 TGCTTGGGGCAGGGTCTGATGGG - Exonic
1168099030 19:54131216-54131238 GCCATGGGGAAGGGCCTGGGGGG + Intronic
1168311967 19:55464997-55465019 GCCGTGGGGAGGGGGCTGGGAGG + Intergenic
926358354 2:12062224-12062246 TCCTTCTGGAAAGGGCTGGGAGG - Intergenic
926394731 2:12429015-12429037 TCCTTGGGGGCAGGGATGGTTGG - Intergenic
926891053 2:17639083-17639105 TCTTTTGCTAAGGGGCTGGTGGG + Intronic
926964570 2:18396020-18396042 TAGTTGGGCAAGGGGTTGGTAGG + Intergenic
927869449 2:26614354-26614376 GGCCTGGGGAAGGGGCCGGTGGG - Intronic
928451496 2:31382339-31382361 TACTTGGGGTGGGGGCTGGGAGG + Intronic
931940552 2:67247268-67247290 TCCTAGGGTTGGGGGCTGGTGGG - Intergenic
932144164 2:69304445-69304467 CAGTTGGGGAAGGGGGTGGTAGG + Intergenic
932876114 2:75454512-75454534 TCCTTGGGTTGGGGCCTGGTGGG - Intergenic
934499086 2:94839966-94839988 TCTTTGGGGACGGTGCTGGGTGG + Intergenic
934682688 2:96296549-96296571 TCCTTGGTGCAGGAGATGGTGGG - Exonic
934780386 2:96966144-96966166 GCCTGGAGGAGGGGGCTGGTGGG - Intronic
935605843 2:104971515-104971537 CGGTTGGGGATGGGGCTGGTGGG + Intergenic
935711318 2:105901786-105901808 GCCTTGGGGAAGCTGCTGTTGGG + Intergenic
935765127 2:106359276-106359298 TCCCTGGGGAAGGGCCTGGAAGG - Intergenic
937246533 2:120497502-120497524 GCCATGGGGCAGGGGCTGGGAGG + Intergenic
937982525 2:127623865-127623887 TCCTTAGGGAAGGGGCTGCAGGG + Intronic
938434052 2:131271787-131271809 CCCTTGGAGAGGTGGCTGGTTGG - Intronic
938904928 2:135828365-135828387 TCCTTGGTGACGGAGATGGTGGG + Intronic
939146110 2:138416818-138416840 TCCCTGGGAAAGGGGCTCATTGG - Intergenic
942130330 2:172872533-172872555 TGTTGGGGGAAGGGCCTGGTGGG + Intronic
944271554 2:197789315-197789337 TTGTTGGGTAGGGGGCTGGTAGG - Intergenic
945030041 2:205654969-205654991 TCCTGCTGGATGGGGCTGGTGGG + Intergenic
945993574 2:216416751-216416773 TCCTGGGAGCAGGGGCTGGCAGG - Intronic
946020462 2:216636563-216636585 TCTTGGGGGAAGGGGTGGGTAGG + Intronic
946155527 2:217804411-217804433 GCCATGGGGAAGGGGCTTGTGGG - Exonic
947043473 2:225950080-225950102 TAGTTGTGGAATGGGCTGGTAGG - Intergenic
947724390 2:232388117-232388139 CCCCTGGGGAAGGAGCGGGTGGG - Intergenic
947729557 2:232420463-232420485 CCCCTTGGGAAGGGGCGGGTGGG - Intergenic
947743707 2:232496931-232496953 TACTTGGGGATGGGGCAGGGAGG - Intergenic
947938287 2:234026086-234026108 TCCCTGGGGAGGGGGCTGCTAGG - Intergenic
948214714 2:236220219-236220241 TGCTTTGGGAAGGTGCTGGAGGG - Intronic
948613275 2:239183035-239183057 TCCATGGGGCAAGGGCTGTTGGG + Intronic
948887486 2:240891489-240891511 TTCTTGGGGAGGGGGCAGGAAGG - Intronic
1168768086 20:395924-395946 CCCTTGGGGAGGGGGCTGATGGG - Intronic
1169007289 20:2218485-2218507 TAATTGAGGAGGGGGCTGGTGGG - Intergenic
1169036103 20:2453684-2453706 TCCTTGGGGGAAGGATTGGTTGG - Intergenic
1169075326 20:2756506-2756528 TCCTTGTTGATGGGGATGGTGGG + Intronic
1170645124 20:18190966-18190988 GCCTTGGGGAGGGGGCTGGGAGG + Intergenic
1170658221 20:18310610-18310632 TACTAGGGGATGGGGGTGGTTGG + Intronic
1172042148 20:32052913-32052935 AGCTTGGGGAAGGGGGTAGTTGG + Intronic
1172083067 20:32358077-32358099 TGTTCGGGGAAGGGGCTGGGTGG - Intergenic
1172273041 20:33665086-33665108 TCCTAGGGGGAGGGGCTGACAGG - Intronic
1172767430 20:37358320-37358342 GGCTTTGGGAAGGGGCTGGAGGG + Intronic
1173145335 20:40519866-40519888 CCCATGGGGATGGGGTTGGTAGG - Intergenic
1174113029 20:48209211-48209233 TCCTTGGGGAAGTGGTTAATTGG + Intergenic
1174484228 20:50851347-50851369 GCCGTGGGGAGGGGGCTGGTAGG - Intronic
1174508172 20:51030545-51030567 TCCTGGGGGACCTGGCTGGTGGG - Intergenic
1175699312 20:61125516-61125538 CCCTCGGGGAAGGGGCTTCTTGG - Intergenic
1178691344 21:34752654-34752676 GCCTTGAGGAAGGGTCAGGTGGG - Intergenic
1178909536 21:36663461-36663483 TCCACAGGGAAGGGGCTGATTGG + Intergenic
1179158425 21:38872344-38872366 TGTTAGGGGAAGGGCCTGGTGGG + Intergenic
1179669507 21:42936578-42936600 TCCTTGAGGAAGGGGCTGCCAGG - Intergenic
1180087076 21:45512471-45512493 TCCTGGGGCCAGGGGCTGGCCGG - Exonic
1180258271 21:46649166-46649188 TTCTCAGGGAAGGGTCTGGTGGG - Intronic
1180597465 22:16988079-16988101 TTCTTGGGGGAGGTGCTGATGGG + Exonic
1180674802 22:17579882-17579904 TCCTTGGGGTAGCCGCTGTTGGG - Exonic
1181121021 22:20668826-20668848 TCCCAAGGGAAGGTGCTGGTGGG - Intergenic
1181307725 22:21926573-21926595 TCCTTTGGGCAGAGGCTGATAGG - Intronic
1181333987 22:22115852-22115874 TCCCAAGGGAAGGTGCTGGTGGG - Intergenic
1181523804 22:23466676-23466698 TCCCTGGGGAAGGAGCAGGGAGG - Intergenic
1181810566 22:25401331-25401353 TCCTGGTGGAGGTGGCTGGTGGG - Intronic
1182555409 22:31126119-31126141 TCTTTGGGGAGGGGGTTGCTGGG + Intronic
1182759123 22:32707790-32707812 CCCATGGGGAAGGGGCTTGGAGG + Intronic
1183661031 22:39221368-39221390 GGCTTGGGGCAGGGGCAGGTGGG + Intergenic
1183742313 22:39675675-39675697 TTCTTGGGGCAGAGACTGGTGGG - Intronic
1183954817 22:41373091-41373113 TTCTTGGGGAAGTGGCTGGTGGG + Intronic
1183986222 22:41572032-41572054 TCCCTGTGGAAGGGGAAGGTGGG - Exonic
1184098596 22:42329821-42329843 TGCTTGGGGATGGGGCAGGCAGG - Intronic
1184492921 22:44820565-44820587 CCCGGAGGGAAGGGGCTGGTGGG - Intronic
1185388198 22:50546148-50546170 CCCTTGGGGCAGGCGCTGGCCGG + Intergenic
949894307 3:8757974-8757996 CATTTGGGGAAGGGGCTGCTGGG + Intronic
950412910 3:12850638-12850660 TCCTGGGGGACAGGGATGGTGGG - Intronic
950640639 3:14346097-14346119 TCCTGGAGGAAGGAGCTGTTGGG - Intergenic
950966970 3:17153267-17153289 TACTTTGGGAAGGGTTTGGTGGG + Intergenic
951535349 3:23735738-23735760 GGCTGGGGGAAGGGGCTGGGTGG - Intergenic
953055872 3:39386838-39386860 ACCTTGGAGGAGGAGCTGGTCGG + Intronic
954332395 3:49897986-49898008 CTCATGGGGAAGGGGCTGCTTGG + Intronic
956060549 3:65344188-65344210 AACTTGGGGAAGAGGTTGGTGGG - Intergenic
957021971 3:75137664-75137686 TTCTTGGTGAAGGGGCGGGTGGG - Intergenic
957218774 3:77355171-77355193 TCCTGGGGTAAGGGGATGGGAGG - Intronic
959839315 3:110956048-110956070 TCCTTGGGGAGGGGGCTTGGTGG - Intergenic
961516829 3:127443338-127443360 TCCTTCGAGAAGTTGCTGGTAGG + Intergenic
961613426 3:128159693-128159715 TCCTGAGGGAAGCAGCTGGTGGG - Intronic
961818656 3:129564179-129564201 TCCTGGGGGAAGGGGGTAGTGGG - Intronic
962528120 3:136254139-136254161 TTGTTGGGGAAGGGGACGGTAGG + Intronic
962600813 3:136989717-136989739 TCTTTGGAGAAGAGGCTGATGGG - Intronic
963134529 3:141889186-141889208 TGCTGGGGGAGGGGCCTGGTGGG - Intronic
963827520 3:149970988-149971010 TCCTCGGGGAGGGGGGCGGTCGG - Exonic
966876629 3:184325788-184325810 CCCAAGGGGAAGGGGCTGCTAGG + Intronic
967627998 3:191708524-191708546 TCCTTGTGGAAGGGGAAAGTAGG - Intergenic
967968609 3:194983457-194983479 TGCTTGGTGAACTGGCTGGTTGG - Intergenic
968208885 3:196830015-196830037 TAATGGGGGAAGGGGATGGTGGG - Exonic
968312110 3:197692430-197692452 GCCTTGGGGAAGGGGGTCGTGGG + Intronic
968745297 4:2356769-2356791 GCCTTGGGGAAGGGCCAGGAGGG - Intronic
968912347 4:3482734-3482756 GTCTTGGGGAAGGGGCAGGGGGG + Intronic
969090550 4:4690840-4690862 TTCATGGGTAAGGGACTGGTGGG + Intergenic
969125993 4:4948486-4948508 TCATTGTGGAAGGGGGTGATGGG + Intergenic
969363625 4:6681226-6681248 CCCTGGGGGAAAGGGCTCGTGGG - Intergenic
969632440 4:8346515-8346537 TCATTGCGAAAGGGGCTGGATGG + Intergenic
969955762 4:10889139-10889161 TCCTACCGGAAGGGACTGGTAGG - Intergenic
970350148 4:15194278-15194300 TCCTAGGGGAAGCAGCTGCTTGG - Intergenic
970436029 4:16036511-16036533 TTCTTGGGGAAGGGGCACGCAGG + Intronic
971051507 4:22867621-22867643 TACTGGGGCAAGGGCCTGGTGGG - Intergenic
972165734 4:36281856-36281878 ACCTTTGTGAGGGGGCTGGTGGG + Intronic
972517095 4:39818873-39818895 TTCTTGGGGTAGGGGTTGGGGGG + Intergenic
972649312 4:41001132-41001154 GCCATTGGGAAGGGGCTGATGGG - Intronic
972724020 4:41730291-41730313 TCCTTTAGGAAGGGCCTTGTGGG + Intergenic
973832055 4:54771539-54771561 TGCTCGGGGAGGGAGCTGGTGGG + Intergenic
975305713 4:72846800-72846822 ACCTGGGGGAAGGGGCGGCTGGG + Intergenic
975834473 4:78407746-78407768 TGCTGGGTGAAGGTGCTGGTGGG - Exonic
978689790 4:111493573-111493595 ACCTGGGGGTAGAGGCTGGTTGG - Intergenic
979602702 4:122603817-122603839 GCCCTGGGGTAGGGGTTGGTTGG + Intergenic
982274756 4:153627799-153627821 GGCTTGCAGAAGGGGCTGGTGGG - Intronic
984710115 4:182877825-182877847 TCTTTTGGGAAGGAGCTGGTGGG - Intergenic
985539891 5:482969-482991 TGCTGGGGGATGGGGCTGGGCGG + Intronic
985579961 5:691363-691385 TCCCAGGGGCAGGGGCTGGCTGG + Intronic
985594808 5:783422-783444 TCCCAGGGGCAGGGGCTGGCTGG + Intergenic
985825898 5:2191449-2191471 TCCTTCCTGAAGGGGCTCGTGGG - Intergenic
987986023 5:25146927-25146949 TGCTTAGGGAAGGGTCTGATGGG + Intergenic
988111453 5:26827493-26827515 TTTTGGGGGAAGGGCCTGGTAGG + Intergenic
988187936 5:27890694-27890716 TACTGGGGGATGGGCCTGGTGGG + Intergenic
989259818 5:39406265-39406287 GCCTTGGTGCAGTGGCTGGTGGG + Intronic
990008024 5:50965588-50965610 ACGTTGGGGAAGGGGCTGCGGGG + Intergenic
990138448 5:52675888-52675910 TGATTGGGGTAGGGGATGGTCGG + Intergenic
990140322 5:52695612-52695634 TCCTTGGTGAATGGGTGGGTTGG - Intergenic
991095702 5:62737676-62737698 TTTTTGGGGAGGGGGCTGGTTGG - Intergenic
992460253 5:76953777-76953799 ATCTCGGGGAAGGGGCTGGCCGG + Intronic
994729642 5:103476726-103476748 ATCCTGGGGAAGGGGGTGGTGGG - Intergenic
994917996 5:106004468-106004490 ACCTGGGGGAAGGGGCGGCTGGG - Intergenic
995679518 5:114701254-114701276 TCCTTGGGGTAGGGTAGGGTAGG + Intergenic
996814195 5:127556288-127556310 TGATTGGGGAAGGGGCTGCTGGG + Intergenic
997303911 5:132825059-132825081 TCCTTGGGGAACAGCCTGGAAGG + Exonic
997436834 5:133881699-133881721 TCCTTGGGGCTGAGGCTGGGAGG - Intergenic
997467272 5:134096478-134096500 GTCTTGGGGAAGGGGGTTGTGGG + Intergenic
997871993 5:137514499-137514521 ACCTGGGGAAGGGGGCTGGTGGG - Intronic
998033731 5:138895223-138895245 ATCTTGGGGAGGGGGCTGGGTGG - Intronic
998313621 5:141158318-141158340 TCTTGGGTGAAGGGACTGGTGGG + Intergenic
998512139 5:142722475-142722497 TCTTTGGCGAACGGGCTAGTTGG + Intergenic
999316227 5:150585814-150585836 TCCTTGGAGGAAGGGCTGGCAGG + Intergenic
1000242869 5:159424792-159424814 TCTTGGGAGAAGGGCCTGGTGGG - Intergenic
1000982963 5:167836342-167836364 TCCTGGAGGTAGGGCCTGGTCGG - Intronic
1001021198 5:168183757-168183779 TCCTTGGGGAAGTGACAGCTTGG + Intronic
1001379457 5:171294130-171294152 CCTTTGGGGAAGGGCCTTGTAGG - Intronic
1002169248 5:177366257-177366279 TCGGTTGGGAAGGGGCTGCTGGG - Exonic
1002437112 5:179238442-179238464 TGCTGCGGGAAGGGGCTGGAGGG + Intronic
1002566459 5:180114869-180114891 GCCTTCTGGGAGGGGCTGGTAGG + Intronic
1003014242 6:2455249-2455271 TCCTTGGGAGAGGGGGTGGCAGG + Intergenic
1004120133 6:12813590-12813612 GCCTTTGCTAAGGGGCTGGTTGG - Intronic
1006316183 6:33293195-33293217 GCCTAGGGGAGGAGGCTGGTGGG + Exonic
1006728089 6:36214444-36214466 CAATTGGGGAAGGTGCTGGTTGG - Intronic
1007167809 6:39841115-39841137 TCCTTGGGGAAGGGTTGGGGAGG + Intronic
1007167884 6:39841295-39841317 TCCTTGGGGAAGGGTTGGGGAGG + Intronic
1007397728 6:41587136-41587158 ACCTTGCGGAAGGGTCTGGAGGG - Exonic
1007415830 6:41690758-41690780 CCCCTGGGGAGGCGGCTGGTGGG + Exonic
1008717528 6:54307147-54307169 TCCATGGGGGAGTGGCTGGTAGG + Intergenic
1010001293 6:70952697-70952719 TCATTGGAGAAGGAGGTGGTGGG - Intronic
1011653156 6:89525594-89525616 TGCATAGGGAAGGGGCAGGTTGG + Intronic
1011879126 6:92001535-92001557 TCCTTGGGGAGGGACCTGGTGGG + Intergenic
1012244746 6:96913823-96913845 TCATGGGGGAAGGGTGTGGTGGG + Intergenic
1012535307 6:100289009-100289031 TCTTTGGGGGAAGGACTGGTGGG - Intergenic
1013132755 6:107250540-107250562 TCCTTGGGGAGGGTGTTGGGGGG + Intronic
1013269378 6:108531551-108531573 TCCTGAGAGAAGGGGCAGGTGGG + Intergenic
1013426452 6:110017267-110017289 TCCTGGGGGAAGGGGAGGTTAGG + Intergenic
1014019082 6:116567156-116567178 TGCCAGGGGAAGGGTCTGGTGGG - Intergenic
1014477589 6:121892374-121892396 TCCCAGGGGAAGGCCCTGGTTGG - Intergenic
1015520988 6:134130982-134131004 TGCTGGGGGAGGGGTCTGGTGGG + Intergenic
1015649507 6:135440158-135440180 TCTTTGGGGATGGGGCTTTTAGG - Intronic
1015865638 6:137723757-137723779 TCCATGGGGAAGAGGATGTTTGG + Intergenic
1016996042 6:149963069-149963091 TCATTGGGGAATGGGCTGAGTGG + Intergenic
1017382064 6:153842734-153842756 TCCTGGGGGCGGGGGCTGGGTGG + Intergenic
1017711709 6:157174894-157174916 ACATTGGGGAAGGGACTGGCAGG - Intronic
1018370679 6:163165321-163165343 AGCGTGGGGCAGGGGCTGGTAGG + Intronic
1018455521 6:163948546-163948568 TCCCTGGGGCAGGGGCAGGTAGG + Intergenic
1018565900 6:165152977-165152999 TGCTTGGGGAAGGGGTGGCTTGG + Intergenic
1021195756 7:17672670-17672692 TCCTTGAGGATGGGGGTGGAGGG + Intergenic
1021502265 7:21344881-21344903 ACCTGGGGGAAGGGGCAGCTGGG - Intergenic
1022501002 7:30882384-30882406 TCCTTGGGGACAGGGTTGGGTGG - Intronic
1022792112 7:33699574-33699596 TGCTTGGGGAGGGGGTGGGTGGG - Intergenic
1023481889 7:40643808-40643830 TCCTTTGGGAGGGGGCTGGCAGG - Intronic
1023822181 7:43986431-43986453 GCCTGGGGGAAGGGGGTGGCTGG + Intergenic
1023875203 7:44283004-44283026 TCCATGGAGGAGGGGCTGGCCGG - Intronic
1024208272 7:47182259-47182281 TCCCTGGTGAAGGGGCTGATAGG - Intergenic
1024874763 7:54009182-54009204 TCTTAGGGAAAGGGGCTGGCAGG - Intergenic
1026846031 7:73699730-73699752 TCCCTCTGGAAGGGGCTGGCTGG - Exonic
1026953814 7:74364412-74364434 CCCCCGGGGAAGGGGCTGGGGGG + Intronic
1026956376 7:74378875-74378897 TCCTGGGAGAAGGGGCAGGAAGG - Intronic
1026978792 7:74514669-74514691 TCCTTGGAGCAGGGGTTGGGGGG + Intronic
1026982964 7:74537547-74537569 TGCTGGGGGCAGGGTCTGGTGGG - Intronic
1027214083 7:76173150-76173172 TGCTGGGGGCAGGGTCTGGTGGG - Intergenic
1027266448 7:76497584-76497606 TCCTGGGGGAAGGGGCTCAGTGG + Intronic
1027317829 7:76995702-76995724 TCCTGGGGGAAGGGGCTCAGTGG + Intergenic
1028182319 7:87740137-87740159 TCATTAGGGAGGGGGCTGTTGGG - Intronic
1029528362 7:101109140-101109162 TCCTAGGGGAATGAGCTGGCAGG + Intergenic
1029750447 7:102539845-102539867 GCCTGGGGGAAGGGGGTGGCTGG + Intronic
1029768399 7:102638953-102638975 GCCTGGGGGAAGGGGGTGGCTGG + Intronic
1029957484 7:104654831-104654853 CACTAGAGGAAGGGGCTGGTGGG - Intronic
1030110659 7:106023768-106023790 TCCTTGTGGGAGGAGCTGGTAGG + Intronic
1031471422 7:122173340-122173362 TAATTGGGGAAGGGGCAGGGAGG - Intergenic
1032016061 7:128381074-128381096 GGCTGGGGGCAGGGGCTGGTGGG + Intergenic
1032160146 7:129503345-129503367 GACTTGGGGCAGGGGCTGGAAGG - Intronic
1033763401 7:144461492-144461514 TGCTGGAGGAAGGGCCTGGTGGG + Intronic
1034347995 7:150398658-150398680 ACCTTGGGCAGGGGGCTGGCAGG - Intronic
1034990399 7:155544350-155544372 GCCCTGAGGAAGGGGCTGGAAGG - Intergenic
1034994691 7:155570519-155570541 CCCTTGGGGAAGGGTTTGCTGGG + Intergenic
1035065757 7:156104182-156104204 TGCCAGGGTAAGGGGCTGGTTGG - Intergenic
1035637011 8:1155132-1155154 TCCCTGGGGCAGCGGCTGGCCGG + Intergenic
1036476866 8:9101491-9101513 CCCATGGGGAGGGGCCTGGTGGG - Intronic
1037504908 8:19519907-19519929 TCCTTGGGGACTGTGCTGGTGGG - Intronic
1037816268 8:22114307-22114329 TCCTTGGGGAAAGCACTGGGAGG + Intergenic
1038007530 8:23445322-23445344 TCCTTTGGGTAGGGAATGGTGGG - Intronic
1038263303 8:26017048-26017070 TCCTTGGGGAAGGTTGTGTTTGG - Intronic
1040102671 8:43519374-43519396 TGCTTGAGGTAGGGCCTGGTGGG + Intergenic
1041668416 8:60468250-60468272 TCCTTGGGGCTGGGGGGGGTGGG - Intergenic
1042509164 8:69593165-69593187 TGCTGGAGGAAGGGGCTGGAAGG + Intronic
1044478706 8:92659670-92659692 TCCGAAGGGAGGGGGCTGGTGGG - Intergenic
1044899796 8:96931937-96931959 TCCCTGGGGAAGTTGCTGATTGG - Intronic
1044973401 8:97641801-97641823 TCCTTGGGGATGGGGGTGGAGGG - Intergenic
1045427537 8:102082039-102082061 TCCTTGTGGAAGGGGCGAGGGGG - Intronic
1045474794 8:102543536-102543558 CCCATGGGGAAGGGGTTGGGAGG - Intergenic
1048201079 8:132374247-132374269 ACCATGAGAAAGGGGCTGGTAGG - Intronic
1048967971 8:139627827-139627849 TCCTGGGGAGAGGGGCTGGAAGG + Intronic
1048970673 8:139643451-139643473 TCACTGGGGAAGGGGCTGCAGGG + Intronic
1049412286 8:142478642-142478664 TCCATGGGGAAGTGGAGGGTGGG + Intronic
1049494214 8:142922197-142922219 TCCCTGGGGCCGGGGCTGCTCGG - Intergenic
1049927214 9:421031-421053 TCCGTGGGGAAGGGGCCAGAGGG + Exonic
1049980979 9:903346-903368 TCCTTGGTGAAAGTGCTGGTAGG - Intronic
1050479966 9:6079250-6079272 TCCTTTGGGAAGGGGGTCTTTGG + Intergenic
1051768909 9:20555113-20555135 ACCCTGGGGAAGGGGATGATTGG - Intronic
1052240148 9:26261922-26261944 TCCTTGGGGAGGTGGATGTTAGG - Intergenic
1052347567 9:27425795-27425817 ACCTTGGGGAGGGGGATGCTAGG - Intronic
1052699008 9:31915175-31915197 TACCTGGGGAAGGGATTGGTGGG + Intergenic
1053165388 9:35840765-35840787 TGCTCAGGGAATGGGCTGGTTGG + Intronic
1053593296 9:39534300-39534322 CCCTGGGGGAGGGGGCTGGGGGG - Intergenic
1053658067 9:40240577-40240599 TCTTTGGGGAAGGTGCTGGGTGG - Intronic
1053851029 9:42289008-42289030 CCCTGGGGGAGGGGGCTGGGGGG - Intergenic
1053908440 9:42869852-42869874 TCTTTGGGGAAGGTGCTGGGTGG - Intergenic
1054370190 9:64386852-64386874 TCTTTGGGGAAGGTGCTGGGTGG - Intronic
1054526529 9:66135644-66135666 TCTTTGGGGAAGGTGCTGGGTGG + Intronic
1054573010 9:66830977-66830999 CCCTGGGGGAGGGGGCTGGGGGG + Intergenic
1054677820 9:67876608-67876630 TCTTTGGGGAAGGTGCTGGGTGG - Intronic
1055638840 9:78303736-78303758 GTCTTGGGGAATGGGGTGGTAGG - Intronic
1055686465 9:78780269-78780291 TCCTTGGGGTGGGGGTTGGAGGG - Intergenic
1056201149 9:84278009-84278031 TTGGTGGGGAAGGGGCTGGTGGG + Exonic
1056450848 9:86715531-86715553 TGCATGGGGAGGGGGCTGGGTGG + Intergenic
1056524181 9:87427415-87427437 TGCTTGGGGCAGGGGCAGGGCGG + Intergenic
1056667906 9:88596680-88596702 TCATTAGGGAAAGGGCTAGTGGG - Intergenic
1057018916 9:91680853-91680875 TCCATGGCAAGGGGGCTGGTGGG - Intronic
1057176604 9:93004787-93004809 AGCTTGGAGAACGGGCTGGTGGG - Intronic
1059644096 9:116247063-116247085 ACCTTGGGGAAGGAGATGATGGG + Intronic
1060209322 9:121700197-121700219 TCCGCGGGGAGGTGGCTGGTGGG + Intronic
1060484278 9:124037302-124037324 TCCCTGGGGCAGCGGCTGGCAGG - Intergenic
1060553370 9:124496073-124496095 TGCTTGGCCAAGGGGCAGGTGGG - Intronic
1060967505 9:127720188-127720210 TGCTGGGAGAAGGGGCTGGCAGG - Intronic
1061303161 9:129718064-129718086 ACCTTGGGGGAGGGGGTGGGGGG - Intronic
1061719618 9:132543536-132543558 TCCCTGGGGCAGGGGCTGTCTGG + Intronic
1062163334 9:135092212-135092234 TCCTTGGAGAAGGAGAGGGTGGG + Intronic
1062249897 9:135588745-135588767 TCACTGGGGCTGGGGCTGGTGGG + Intergenic
1186433923 X:9527516-9527538 TCCTTGGGGTGGGGGTTGATCGG + Intronic
1186450197 X:9666042-9666064 CCCTTGGGGGATGGGCTGATTGG + Intronic
1187490727 X:19748773-19748795 TCCTGGGAGAAGGGGCAGGTTGG - Intronic
1187969173 X:24642277-24642299 CCCATGGGTAAGGGGATGGTAGG + Intronic
1189673400 X:43436868-43436890 CCATTGGAGATGGGGCTGGTGGG - Intergenic
1189702564 X:43727268-43727290 ACCTGGGGGAAGGGGCAGCTGGG - Intronic
1189843346 X:45106007-45106029 ACCTAGGGGAAGGGGCGGGGGGG - Intronic
1190281630 X:48934916-48934938 CCTTTGGGGAAGGGGCAGGGTGG - Intronic
1190379958 X:49829693-49829715 TCGTGGGTGAAGGGGCTGATGGG - Intronic
1190414653 X:50168937-50168959 GGCTTGGGGAAGGGGGTGGATGG + Intergenic
1191934012 X:66406724-66406746 ACGTTGGAGATGGGGCTGGTTGG + Intergenic
1192436977 X:71148958-71148980 TCCTGGGGGCAAGGGCAGGTGGG - Intronic
1192964223 X:76159860-76159882 ACCTGGGGGAAGGGGCGGTTGGG + Intergenic
1193441899 X:81551574-81551596 TGTTAGGGGAAGGGCCTGGTGGG - Intergenic
1194206183 X:91014606-91014628 TGTTTGAGGAAGGGCCTGGTGGG - Intergenic
1194474733 X:94344754-94344776 ACCTTGGGGAAGAAACTGGTTGG + Intergenic
1194944294 X:100049284-100049306 TGTTTGGGGAAGGACCTGGTGGG + Intergenic
1194949410 X:100107189-100107211 TGCTGGAGGTAGGGGCTGGTGGG + Intergenic
1195219865 X:102736662-102736684 CCCATGGGGAATGGGCTGATTGG - Intronic
1195941892 X:110174037-110174059 TCCTGGAGGGAGTGGCTGGTTGG - Exonic
1196255658 X:113515362-113515384 TGCTAGGGGAAGGGGCGGGTGGG - Intergenic
1196269751 X:113697506-113697528 ACCTGGGGGAAGGGGCGGTTGGG - Intergenic
1196729039 X:118922637-118922659 TCCTTGGGGGAGGGGCTCCATGG - Intergenic
1197994989 X:132363335-132363357 TGTTGGGGGAGGGGGCTGGTAGG - Intergenic
1197998525 X:132406990-132407012 TTATTGGGGAAGGGGAAGGTGGG + Intronic
1198084002 X:133265784-133265806 GCCTCTGGGAAGGGGCTGGAAGG + Intergenic
1198229797 X:134678018-134678040 TCCTTGAGCAAGGGGATGGATGG + Intronic
1198369030 X:135973644-135973666 TCGCTGTGGAAGGGGCTGGTGGG - Exonic
1199882043 X:151981631-151981653 TCCTAGAGCAAGGTGCTGGTGGG + Intergenic
1200039593 X:153355661-153355683 TCCTTGGGGATGGGACAAGTGGG + Intronic
1200551938 Y:4589427-4589449 TGTTTGAGGAAGGGCCTGGTGGG - Intergenic
1201389317 Y:13480105-13480127 TCCTTGGCGAACTGGCTGGGCGG - Exonic
1201456925 Y:14178221-14178243 TCCATGGGCAAGAGGGTGGTAGG + Intergenic
1201722851 Y:17120569-17120591 TCCTGGGGGAGGGACCTGGTGGG + Intergenic