ID: 901512563

View in Genome Browser
Species Human (GRCh38)
Location 1:9724730-9724752
Sequence TTGGATGCAGAGCGGCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512550_901512563 21 Left 901512550 1:9724686-9724708 CCCATTATCAGGGCAAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 220
Right 901512563 1:9724730-9724752 TTGGATGCAGAGCGGCCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 96
901512552_901512563 20 Left 901512552 1:9724687-9724709 CCATTATCAGGGCAAGGGCAGGT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 901512563 1:9724730-9724752 TTGGATGCAGAGCGGCCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 96
901512549_901512563 24 Left 901512549 1:9724683-9724705 CCACCCATTATCAGGGCAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 901512563 1:9724730-9724752 TTGGATGCAGAGCGGCCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 96
901512561_901512563 -5 Left 901512561 1:9724712-9724734 CCTTGGGGAAGGGGCTGGTTGGA 0: 1
1: 0
2: 2
3: 36
4: 376
Right 901512563 1:9724730-9724752 TTGGATGCAGAGCGGCCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512563 Original CRISPR TTGGATGCAGAGCGGCCCTC TGG Intronic
900379920 1:2378644-2378666 TTGGCAGCAGCGCGGCCCTCCGG - Intronic
901054430 1:6442146-6442168 CTGCATCCAGAGAGGCCCTCAGG - Intronic
901211744 1:7530393-7530415 TTCGAGGCAGAGCGGCACTCTGG + Intronic
901512563 1:9724730-9724752 TTGGATGCAGAGCGGCCCTCTGG + Intronic
901725067 1:11235259-11235281 TAGGATGCAGTGAGGCTCTCGGG - Intronic
902407029 1:16189971-16189993 TTGGAAGCAGAGCGGGTCTGAGG + Intergenic
903574896 1:24333212-24333234 CTGGATTCAGAGCAGCCCCCTGG + Intronic
917549275 1:176007401-176007423 TTGGAGGAAGAGAGGCACTCTGG + Intronic
918328321 1:183431757-183431779 TTCTTTGCAGAGCGGCCCTGGGG + Intergenic
1062942553 10:1435127-1435149 TTGGAGGCACAGCCGGCCTCGGG - Intronic
1066024516 10:31341197-31341219 TTGGAGGCAGAGAGGCCATTTGG + Intronic
1067544611 10:47183995-47184017 TTGGAGGCAGAGCGGTCCCCAGG + Intergenic
1068933523 10:62614787-62614809 ATGGTTGCAGAGCAGCCCCCTGG - Intronic
1072477514 10:95777194-95777216 TTGGAGGAAAAGAGGCCCTCTGG + Intronic
1073290799 10:102412311-102412333 TTAGATGGAGAGCTGCCTTCAGG + Intronic
1075836130 10:125454437-125454459 TGGGAGGCAGAGCTGCCCTGTGG - Intergenic
1083439389 11:62665876-62665898 TTCGACGCAGCGCGGCCATCTGG - Exonic
1085133961 11:74067989-74068011 CTGGGTGCAGAGAGGCCCTGTGG + Intronic
1093519991 12:20037923-20037945 TTGGATGCAGAGCAGCTGTAAGG - Intergenic
1095878080 12:47103920-47103942 CTGGATGCACAGGGGCCATCGGG - Intronic
1095985241 12:47995048-47995070 TTGGATCCAAAGCGGTCCCCAGG + Intronic
1100966648 12:100020704-100020726 TTGGAAGCAGAGCTACCCTAGGG + Intergenic
1103043082 12:117711956-117711978 ATGGAGGCAGAGCTGGCCTCAGG + Intronic
1103212358 12:119176203-119176225 TTTGAGGCAGAGGGGTCCTCTGG + Intergenic
1104935177 12:132360698-132360720 TGGGATGCAGAGGGGCCCTCGGG + Intergenic
1112921969 13:104625272-104625294 TTGGTTTCAGAGCGGCTCTCGGG + Intergenic
1113635175 13:111914505-111914527 TGGGACACAGAGAGGCCCTCAGG - Intergenic
1122833770 14:104421154-104421176 TTGGCTACGGAGCTGCCCTCTGG - Intergenic
1124375376 15:29126076-29126098 TGGGGTGCAGAGGGGCCCACAGG + Intronic
1124415568 15:29470713-29470735 TTGAAGGCAGAGCGTCCTTCAGG - Intronic
1124586716 15:31016627-31016649 AAGGATGGAGAGTGGCCCTCAGG - Intronic
1124959180 15:34382239-34382261 TTGGCTCCAGAGCGGCCTTATGG - Exonic
1124975806 15:34528460-34528482 TTGGCTCCAGAGCGGCCTTATGG - Exonic
1130583300 15:85157974-85157996 ATGGATGAACAGCAGCCCTCGGG - Intergenic
1130908051 15:88253715-88253737 TTGGATTCTGAGAGGCCATCAGG - Intronic
1132577431 16:670503-670525 TGGGATGCAGGACGGCCTTCTGG - Exonic
1136355961 16:29744923-29744945 TTGACTCCAGAGCCGCCCTCTGG - Exonic
1139040797 16:62997406-62997428 TTGGAGGAAGAGAGGCGCTCTGG + Intergenic
1139090876 16:63645530-63645552 TTGGATCCATACCAGCCCTCAGG + Intergenic
1141376049 16:83531757-83531779 TTGGAAGCAGTGTGGCCCTGCGG + Intronic
1142231908 16:88903923-88903945 GTGGATGCAGAGAGCCCCACTGG + Intronic
1143006472 17:3838537-3838559 GTGGATGCAGAGCTGAACTCTGG - Intronic
1143917144 17:10302361-10302383 TTGTATGCAGAGCATCCCTCAGG - Intronic
1147162531 17:38576504-38576526 TGGGATGCGGAGTGGCCATCAGG - Intronic
1147364646 17:39952176-39952198 TGGGATGCAGAGGGGTCCCCTGG + Intergenic
1150654585 17:67031573-67031595 TTGGCTGCAGAGCTGTCTTCAGG - Exonic
1151763968 17:76122596-76122618 GCGGAGGCAGAGCGGCCCTGGGG + Intergenic
1152279582 17:79377572-79377594 TAGGACGCAGAGCTGCACTCAGG + Intronic
1152348858 17:79771992-79772014 TTGGATGGAGAGTGACCTTCTGG + Intergenic
1152600580 17:81260237-81260259 GTGGAGGCAGCGCGGCTCTCAGG - Exonic
1168284019 19:55321533-55321555 TTGGAGGTAGAGAGCCCCTCAGG - Intronic
932434268 2:71694081-71694103 ATGGAAGCAGAGCTGCCTTCTGG + Intergenic
934770358 2:96903756-96903778 TTGCATGCAGAGAGGCTCCCTGG + Intronic
943923363 2:193738875-193738897 TTGGGTGCAGAGGTGCCATCTGG - Intergenic
943964833 2:194320062-194320084 TTGTATGCAGTGGGGCCCACTGG - Intergenic
948350297 2:237334397-237334419 TGGGATGCAGTCCTGCCCTCTGG - Intronic
948723472 2:239918148-239918170 CTTGATGCAGAGGGTCCCTCAGG - Intronic
1170775402 20:19371071-19371093 TTGGGTGCAGTGCATCCCTCTGG + Intronic
1173727946 20:45309773-45309795 TTAGACGCAGAGCAGGCCTCAGG + Intronic
1174042821 20:47712194-47712216 TTGGACTCAGAAGGGCCCTCTGG - Intronic
1175189921 20:57204608-57204630 TTGGATGGAGAGAGGCCCAGAGG - Intronic
1175237297 20:57524045-57524067 TTGGAGGCCGAGCGTACCTCTGG - Exonic
1181760777 22:25057351-25057373 CTGGATGCCGACCGGCCCGCAGG + Intronic
1181945343 22:26512559-26512581 ATGGCTGCAGAGCGGCCGGCTGG + Intergenic
1184858031 22:47157077-47157099 CAGGATGCAGAGTGGCCATCTGG + Intronic
1185074359 22:48675382-48675404 GGGGATGCAGAGCAGCCTTCAGG + Intronic
953045186 3:39288606-39288628 TTGGCTTCAGAGCTCCCCTCTGG + Intergenic
954699744 3:52445056-52445078 CTGCCTGCAGAGCCGCCCTCTGG + Intronic
956008258 3:64803618-64803640 TTGTCTTCAGAGCGTCCCTCCGG - Intergenic
961442908 3:126963283-126963305 GTGGATGCAGAGTGGGCCACAGG - Intergenic
961662186 3:128475334-128475356 TAGGATGCGGAAGGGCCCTCAGG - Intergenic
964831341 3:160886790-160886812 TTGGAGGAAAAGAGGCCCTCTGG - Intronic
967199197 3:187057368-187057390 TTGGAGGCAAAGAGGCACTCTGG + Intronic
969072325 4:4549410-4549432 ATGGATGCTCAGCTGCCCTCTGG - Intergenic
969493062 4:7510814-7510836 TTGGGTGCAGAGTGGCCCGGAGG - Intronic
971223427 4:24730121-24730143 TTGCATGCAGCCTGGCCCTCAGG + Intergenic
974630271 4:64479754-64479776 ATGGATCCAGAGGTGCCCTCAGG + Intergenic
978352815 4:107838087-107838109 TTGTAGGCAGAGAGGCCCTGAGG + Intronic
985255903 4:188069871-188069893 TTGGATGAAGAGGGGCCGTTAGG - Intergenic
993163617 5:84321381-84321403 TTAGATGCAGAGCAGCATTCTGG + Intronic
994010736 5:94899344-94899366 TGGGATGAAGAGCAGCCCTTTGG - Intronic
1001580097 5:172792318-172792340 TTGGAAGCAGTGCAGCTCTCTGG - Intergenic
1006896079 6:37471984-37472006 TTGGATGCAGAGACACCCTAAGG - Intronic
1010065735 6:71680594-71680616 TTGGATGCAGAGCCAACTTCAGG + Intergenic
1013230446 6:108157528-108157550 CTGGAGGCAGAAGGGCCCTCGGG - Intronic
1019594042 7:1850251-1850273 GTGGGTCCAGAGGGGCCCTCGGG - Intronic
1024458995 7:49640287-49640309 CTTGAGGCAGAGCGGCACTCTGG + Intergenic
1032736024 7:134693390-134693412 TTGAAAGCAGAGCTGCCCTGTGG + Intergenic
1037803678 8:22048361-22048383 TCGGATGCTTCGCGGCCCTCAGG - Exonic
1038513631 8:28164168-28164190 TTGCATGCAGAGAGGACCCCTGG + Intronic
1045976549 8:108136181-108136203 TGGGTTGCAGAGCGGCACTAAGG - Intergenic
1050480952 9:6086304-6086326 ATGGATGCTGAATGGCCCTCGGG - Intergenic
1051478531 9:17534993-17535015 TTGGATCCAGAGGGCCCCTTTGG - Intergenic
1053572909 9:39328561-39328583 CTGGATGCAGTGGGGCCTTCTGG - Intergenic
1054094472 9:60887270-60887292 CTGGATGCAGTGGGGCCTTCTGG - Intergenic
1054115943 9:61163182-61163204 CTGGATGCAGTGGGGCCTTCTGG - Intergenic
1054124235 9:61290450-61290472 CTGGATGCAGTGGGGCCTTCTGG + Intergenic
1054591814 9:67019362-67019384 CTGGATGCAGTGGGGCCTTCTGG + Intergenic
1056732896 9:89181152-89181174 TTTGATGCTGAGAGGCCTTCGGG - Intergenic
1057796555 9:98161918-98161940 CTGGATGGAGAGTGGCTCTCAGG - Intronic
1060821453 9:126663899-126663921 TGGGAGGCAGAGAGGCCCCCGGG - Intronic
1062710823 9:137974281-137974303 ATGGATGCCCAGCGACCCTCAGG - Intronic
1201579865 Y:15499986-15500008 TTGGCTGCAGATGGGCTCTCTGG + Intergenic