ID: 901512674

View in Genome Browser
Species Human (GRCh38)
Location 1:9725220-9725242
Sequence CTAGGGGGCCGCGTGAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512662_901512674 24 Left 901512662 1:9725173-9725195 CCTGGTTGGGGTGCTGTGCTCAG 0: 1
1: 0
2: 2
3: 36
4: 643
Right 901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
901512661_901512674 29 Left 901512661 1:9725168-9725190 CCTCTCCTGGTTGGGGTGCTGTG 0: 1
1: 0
2: 3
3: 17
4: 284
Right 901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512674 Original CRISPR CTAGGGGGCCGCGTGAGCGC TGG Intronic
901198639 1:7454250-7454272 CTAGGTGGCCGCCTGAGCCATGG + Intronic
901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG + Intronic
906532761 1:46532994-46533016 CTAGGGGGCGGCGCGCGCCCGGG + Intergenic
908780520 1:67685871-67685893 TGACGGGGCCGCGGGAGCGCCGG + Intronic
909963665 1:81880687-81880709 CTAAGGGCCCGCGTGTGCACTGG - Intronic
915200194 1:154221245-154221267 CTAGTGGGCCGCGCCAGAGCCGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1065589596 10:27251613-27251635 CCCGGGGGCCGCCTGAGCCCTGG - Intergenic
1066023081 10:31320829-31320851 CCCGGGGGCGGCGGGAGCGCAGG + Intronic
1076692743 10:132232101-132232123 TGAGGGCGCAGCGTGAGCGCAGG - Intronic
1077610705 11:3641883-3641905 CCAGGGGTCCGGGTGAGGGCGGG + Exonic
1078106628 11:8361884-8361906 CCATGGGCCCGCGTGAGCACAGG - Intergenic
1089119012 11:116118754-116118776 GTATGGGGCAGCGTGAGCACAGG - Intergenic
1089452750 11:118608825-118608847 GTGAGGGGCTGCGTGAGCGCGGG - Intronic
1099826640 12:87784414-87784436 CGAGGGGGCCGCGGCAGCGATGG - Intergenic
1100306696 12:93356378-93356400 CTAGGGGATCGCTTGAGCCCTGG - Intergenic
1100565523 12:95790540-95790562 CTGGGGGGCGGCGGGAGCCCCGG + Exonic
1103363851 12:120368894-120368916 CAAAGGGCCCGCGTGAGCGCCGG + Intronic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1113667933 13:112153883-112153905 CTAGAGGGCGGCGTGAGGGTTGG + Intergenic
1116900946 14:50362009-50362031 CCAGGGGGCCGCTAGAGTGCCGG - Intronic
1117913804 14:60657129-60657151 CTTGGGCGCCGCGTCTGCGCCGG + Intronic
1128101766 15:65007048-65007070 CTAAGGGCCCGCATGAGCACTGG + Intronic
1132669906 16:1098271-1098293 CTCGGGGGCTGAGTGAGCCCAGG - Intergenic
1138360811 16:56425622-56425644 CTAGGCGGCGGCGCGACCGCTGG - Intergenic
1139852192 16:69958010-69958032 CTAGGGGGCCGGCTGGGAGCTGG + Intronic
1139881163 16:70180914-70180936 CTAGGGGGCCGGCTGGGAGCTGG + Intronic
1139972403 16:70784304-70784326 CTTGGTGGCCGCCTGAGCGCTGG - Intronic
1140371342 16:74414604-74414626 CTAGGGGGCCGGCTGGGAGCTGG - Intronic
1140420247 16:74813363-74813385 GCAGGGGGCCGCGAGAGGGCAGG - Intergenic
1142199234 16:88753263-88753285 CTGGGGGGGCGGGTGAGCTCTGG - Intronic
1143089378 17:4439921-4439943 GTAGGGTGCCGCGGGAGAGCAGG + Intronic
1144724636 17:17495823-17495845 CCAGGGCGCCCCGCGAGCGCCGG - Intronic
1144828785 17:18120790-18120812 CTTGGGGGCCGCGGGGGCACGGG - Exonic
1146646290 17:34579441-34579463 CTCGGGGGCCACGTGACCACGGG + Intergenic
1148186597 17:45649058-45649080 CTAGGGGGCCAAGTGGGGGCTGG - Intergenic
1148733450 17:49851425-49851447 CCAGGGCGCCGGGTGGGCGCAGG + Intergenic
1148879963 17:50718212-50718234 CGAGGGGGTCGCCTGAGCCCGGG + Intergenic
1151746480 17:76014379-76014401 CTAGGGGGCCACATGGGCACAGG + Intronic
1153688207 18:7567245-7567267 CTAGCGGGCCGCGGCGGCGCCGG + Exonic
1158960818 18:62586370-62586392 CTAGGGGGCAGCATCAGCACGGG + Intronic
1160714985 19:572502-572524 CTCGGGGGCGGGGCGAGCGCCGG - Intronic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1163507996 19:17719632-17719654 CTGGGGGCCCGCGGGAGCCCGGG + Intronic
1163713901 19:18863120-18863142 CTGTGGGGCCGCGTGTGCCCCGG + Intronic
1165243125 19:34482521-34482543 CCAGGGGGCAGCGGGAGTGCAGG - Exonic
1166931817 19:46305560-46305582 CTAGGGGGCTGTGAGAGCACAGG + Intronic
929198058 2:39206480-39206502 CTAGGGGCCTGGGTGAGGGCAGG + Intronic
937311637 2:120906461-120906483 CTAAGGGGCCAGGTGAGCACCGG + Intronic
937859730 2:126698240-126698262 CTAGGAGGCCTCGAGAGCCCTGG - Intergenic
941987296 2:171522317-171522339 CTCGGCGGCCGCGTGATCCCGGG + Intronic
948791400 2:240379225-240379247 CTTGGGGGCCACGTGAGAGAAGG - Intergenic
1170419092 20:16174633-16174655 CAAGGGGGTCGAGTGAGAGCTGG - Intergenic
1172001658 20:31782783-31782805 CTAGGGGGCAGCCTGAACCCAGG + Intronic
1174046052 20:47734284-47734306 CTAGGTGGCCACGTGAACACAGG + Intronic
1174758881 20:53186865-53186887 CTTGGGGGCAGTGTGTGCGCAGG + Intronic
1176152487 20:63599162-63599184 GGAGCGGGCCGCGTTAGCGCTGG - Intronic
1178269638 21:31177871-31177893 CTTGGGGTCCACGTGAGTGCTGG - Intronic
1180108568 21:45636915-45636937 CGAGGGGGCAGCGTGAATGCAGG - Intergenic
1182544241 22:31064583-31064605 CTGGAGGGCCGCTTGAGCCCAGG - Intronic
957991855 3:87636367-87636389 CTAGGGGCCCACGTGTGCACTGG + Intergenic
963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG + Intronic
963888152 3:150603637-150603659 CTAAGGGGCCGCGAGAAGGCTGG - Intronic
969608516 4:8214236-8214258 CATGGGGGCCACGTGAGCTCTGG + Intronic
971326695 4:25650385-25650407 CAAGGGGGCTGCTTGAGCCCAGG - Intergenic
985848497 5:2371618-2371640 CTAGAAGGCCGCGTGTGCACAGG - Intergenic
992098175 5:73381586-73381608 CTGAGGCGCCGCGGGAGCGCAGG - Intergenic
1000351290 5:160354867-160354889 CTGGGGGGCCGGGTGGGCCCTGG + Exonic
1001256058 5:170184230-170184252 CTAGGGGGCAGCATGAGCTCTGG - Intergenic
1006860961 6:37171093-37171115 CGAGGGGGCCGCGTTAGGGCGGG - Intronic
1007447950 6:41921444-41921466 CTAGGGGGCGCTGTGATCGCCGG + Exonic
1009905608 6:69867241-69867263 CTGGGGGGCGGCGCGGGCGCGGG + Intronic
1018215074 6:161518637-161518659 CTAGGGGGCTGGGTGAGCGGAGG - Intronic
1027391809 7:77711430-77711452 CAAGGGGACCGCATGAGCCCAGG - Intronic
1029701370 7:102248756-102248778 CTCGGGGGCCGCGGGCGCGGCGG - Exonic
1033365983 7:140673009-140673031 CGAGGGGGCCGCGCGGGCGGAGG - Intronic
1039531837 8:38269293-38269315 CTGGGGAGCCGCCGGAGCGCGGG - Intronic
1039873646 8:41567510-41567532 CTGCGGGGCACCGTGAGCGCAGG + Intergenic
1049591568 8:143465223-143465245 CAAGGGGGCCGCCTGAGCCGTGG - Intronic
1054835526 9:69672093-69672115 GTCGGGGGCCGCATCAGCGCCGG + Intronic
1055611754 9:78031494-78031516 CTCGGGGGGCGCGTGAGAGAAGG + Intergenic
1060399210 9:123338378-123338400 CTAGGGGGTAGCTTGAGCCCAGG - Intergenic
1060596802 9:124853472-124853494 CTAGGCGGCCGCGGGACCCCAGG - Exonic
1061938190 9:133870246-133870268 CTAGGGGGCCGGCAGAGTGCAGG + Intronic
1062722572 9:138052020-138052042 CTGGGGGGCCACGTGGGAGCTGG + Intronic
1191145016 X:57156599-57156621 CTAGGTGGCAGCCTGAGCCCTGG + Intergenic