ID: 901512674

View in Genome Browser
Species Human (GRCh38)
Location 1:9725220-9725242
Sequence CTAGGGGGCCGCGTGAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901512661_901512674 29 Left 901512661 1:9725168-9725190 CCTCTCCTGGTTGGGGTGCTGTG 0: 1
1: 0
2: 3
3: 17
4: 284
Right 901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
901512662_901512674 24 Left 901512662 1:9725173-9725195 CCTGGTTGGGGTGCTGTGCTCAG 0: 1
1: 0
2: 2
3: 36
4: 643
Right 901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901512674 Original CRISPR CTAGGGGGCCGCGTGAGCGC TGG Intronic