ID: 901513745

View in Genome Browser
Species Human (GRCh38)
Location 1:9731460-9731482
Sequence CGGCTGTGCCTGGTCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901513736_901513745 6 Left 901513736 1:9731431-9731453 CCAGAAGGCCACTGTGCCCTTGA 0: 1
1: 0
2: 1
3: 17
4: 149
Right 901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG 0: 1
1: 0
2: 0
3: 8
4: 127
901513735_901513745 7 Left 901513735 1:9731430-9731452 CCCAGAAGGCCACTGTGCCCTTG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG 0: 1
1: 0
2: 0
3: 8
4: 127
901513739_901513745 -10 Left 901513739 1:9731447-9731469 CCCTTGACCTCCTCGGCTGTGCC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG 0: 1
1: 0
2: 0
3: 8
4: 127
901513737_901513745 -2 Left 901513737 1:9731439-9731461 CCACTGTGCCCTTGACCTCCTCG 0: 1
1: 0
2: 2
3: 38
4: 475
Right 901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901513745 Original CRISPR CGGCTGTGCCTGGTCAAAAC GGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900831563 1:4969290-4969312 AGGCTATGCCTGGTCACAAATGG - Intergenic
901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG + Intronic
904914264 1:33958557-33958579 TGGGTGAGCCTGGTCAAATCAGG + Intronic
907295532 1:53449968-53449990 CAGCTTTTCCTGGACAAAACAGG + Intergenic
910191591 1:84601184-84601206 CTGCCGTACCTGGTCCAAACTGG - Intergenic
913326494 1:117632769-117632791 CTGCTGTTCCTGGTCAGATCAGG - Intergenic
914767804 1:150654674-150654696 CGTCTGGGCCTGTTCCAAACCGG + Intronic
914780959 1:150784644-150784666 CCACTGCACCTGGTCAAAACAGG - Intergenic
916483104 1:165233165-165233187 CCGCCGTGCCCGGCCAAAACTGG - Intronic
917867112 1:179207035-179207057 CAGCTGTGCCTGTTGGAAACTGG - Intronic
919007861 1:191922934-191922956 CCGCTGTGCCTGGCCAGAAAGGG - Intergenic
920736984 1:208541743-208541765 AGGCTGTGCCTGAGCAAAGCTGG + Intergenic
923302604 1:232655831-232655853 CCGCAGTGTCTGGTGAAAACTGG + Intergenic
923913489 1:238476675-238476697 CGGTTGTACCTGGTCTACACAGG - Intergenic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1064198007 10:13261169-13261191 CCACTGTGCCTGGTCAAGAAAGG - Intergenic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1066733412 10:38452493-38452515 CAGCTGTGCCGGGGGAAAACTGG - Intergenic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG + Intronic
1075608172 10:123831361-123831383 AGGCAGTGCCTGCTCAACACTGG - Intronic
1081639782 11:44744920-44744942 CTGCTGAGCCTGGGTAAAACAGG - Intronic
1084149792 11:67282738-67282760 GGGCTGTGCCTGGGCAAGAAAGG - Exonic
1084504858 11:69559188-69559210 TAGCTGTGTCTGGTCAAAAAGGG + Intergenic
1085252802 11:75154692-75154714 AGCCTGTGCCTGGTGAACACAGG + Intronic
1093651383 12:21649699-21649721 TGGCTGTGTCTGGTCCACACAGG - Intronic
1096412098 12:51384402-51384424 CCACTGTGCCTGGTCCTAACTGG - Intronic
1096419572 12:51445453-51445475 CCGCTGTGCCTGGCCAGAAGTGG + Intronic
1100700342 12:97140539-97140561 CCACAGTGCCTGGTCAAAAGAGG - Intergenic
1101641223 12:106586849-106586871 GGGCTGTGCCTGGGCAAGAATGG - Intronic
1102515807 12:113445877-113445899 CTCATGTGCCTGGTCAAAATTGG + Intergenic
1103030757 12:117610450-117610472 CCACCGTGCCTGGTCATAACTGG - Intronic
1103421706 12:120790317-120790339 GGTCTGTGCCCGGTGAAAACTGG + Intronic
1104006927 12:124899575-124899597 CCACTGTGCCTGGTCTACACTGG + Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1112497164 13:99914481-99914503 CCACTGTGCCCGGCCAAAACTGG - Intergenic
1114635361 14:24184101-24184123 AGGCTGTACCTGGTCAAAGCAGG + Exonic
1116449673 14:45050538-45050560 CCACTGCGCCTGGTCAAGACGGG + Intronic
1117794706 14:59380422-59380444 GGGCTCTGCCTGGTCAAATCTGG - Intergenic
1119174107 14:72556599-72556621 AGGCTCTGCCTGGTAAACACTGG - Intronic
1120321571 14:82968574-82968596 CCACTGCACCTGGTCAAAACTGG - Intergenic
1202930776 14_KI270725v1_random:30865-30887 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1123421580 15:20140547-20140569 TGGCAGTGCCTGGTCAACTCCGG + Intergenic
1123530806 15:21147087-21147109 TGGCAGTGCCTGGTCAACTCCGG + Intergenic
1123579542 15:21703957-21703979 AGGGTGTGCCTGGTCTGAACTGG - Intergenic
1123616169 15:22146468-22146490 AGGGTGTGCCTGGTCTGAACTGG - Intergenic
1126102641 15:45129213-45129235 CGGCTGTGACCGGACAAACCGGG + Intronic
1127072190 15:55297913-55297935 CCACTGTGCCTGGCCACAACTGG - Intronic
1129245849 15:74278216-74278238 GGGCTGGGCCTGGACAAACCAGG + Intronic
1130918798 15:88326884-88326906 TGGCTGTGCCTAGTCAGAATGGG - Intergenic
1202988412 15_KI270727v1_random:438202-438224 AGGGTGTGCCTGGTCTGAACTGG - Intergenic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1136722741 16:32337918-32337940 TGGCAGTGCCTGGTCAACTCTGG + Intergenic
1136841063 16:33543917-33543939 TGGCAGTGCCTGGTCAACTCTGG + Intergenic
1138074724 16:54030632-54030654 AGGAAGTGCTTGGTCAAAACTGG - Intronic
1140468554 16:75201395-75201417 CGGCTGTGCAAGGAAAAAACAGG + Intergenic
1141716530 16:85730135-85730157 GGGCTGTGGCTGGTCAGAGCGGG + Intronic
1203003690 16_KI270728v1_random:179846-179868 TGGCAGTGCCTGGTCAACTCTGG - Intergenic
1203135298 16_KI270728v1_random:1716253-1716275 TGGCAGTGCCTGGTCAACTCTGG - Intergenic
1203151228 16_KI270728v1_random:1844214-1844236 TGGCAGTGCCTGGTCAACTCTGG + Intergenic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1151310650 17:73290714-73290736 CGGGTGTGGATGGTCAGAACCGG + Intronic
1154165967 18:12014727-12014749 CAGCAGTGCCTGGGCAAAATCGG - Intronic
1158399806 18:57111710-57111732 GGGCTGTGCCTGGACAAGCCAGG + Intergenic
1162789866 19:13057256-13057278 CGGCTGTGCCTGTGCAGAGCGGG + Intronic
1164724113 19:30453736-30453758 TGGGTGGGCCTGGGCAAAACGGG + Intronic
1167899616 19:52609777-52609799 CCACTGTGCCTGGTCCAAAAAGG - Intronic
925962403 2:9030015-9030037 CAGCTGTGCCGGGTCAACTCTGG + Intergenic
926332073 2:11833877-11833899 CATTTGTTCCTGGTCAAAACAGG - Intergenic
927999370 2:27509227-27509249 CAGCTGTGTCTGGTCAAGCCAGG - Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
933955076 2:87356937-87356959 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
934273919 2:91563547-91563569 TGGCAGTGCCTGGTCAACTCCGG + Intergenic
936240191 2:110781352-110781374 CGACTGTGCCTGGCCAAGTCTGG - Intronic
941181591 2:162265891-162265913 CGGCTCTTCCTTGTCAAAAGAGG + Intergenic
941269529 2:163408149-163408171 AGCCTGTGCCAGGTCAAAACTGG + Intergenic
942840416 2:180353628-180353650 TGTCTGTGCCTGGTCAGAAATGG + Intergenic
944674047 2:202020322-202020344 CAGCTGTGCCTTGTCAAGAAAGG - Intergenic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
1176090738 20:63317596-63317618 CGGCTGTGTGGGGACAAAACAGG - Intronic
1176592796 21:8659488-8659510 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1180275649 22:10636630-10636652 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1180550130 22:16531570-16531592 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1181354544 22:22290251-22290273 TGGCAGTGCCTGGTCAACTCCGG + Intergenic
1181703107 22:24631979-24632001 CTGCTGAGCCTGGTCAACAGAGG + Intergenic
1184232368 22:43165412-43165434 CCACTGTGCCTGGTCAATTCCGG + Intergenic
950076327 3:10189777-10189799 GGGCTGTGCCAGGTCCAGACAGG + Intronic
950929245 3:16772513-16772535 CACCTGTACCTGGACAAAACGGG - Intergenic
961623252 3:128241001-128241023 CGGGTGTTCCAGGACAAAACGGG - Intronic
966787266 3:183632884-183632906 CAGCTGTGACTATTCAAAACTGG + Intergenic
967889793 3:194356902-194356924 CTGCTGTGCCTGGTGCCAACAGG - Intronic
968881525 4:3302688-3302710 CGGCTGTGCCTGTTCACTCCTGG - Intronic
977301188 4:95269573-95269595 CCACTGTGCCTGGTGAAGACTGG + Intronic
985593000 5:775004-775026 CAGCAGTGCCGGGTCAAAGCTGG + Intergenic
985706267 5:1403128-1403150 CGGCGGTGCCAGGACAAAGCAGG + Intronic
990909500 5:60839528-60839550 CAACTGTGCATGGTCAAAACTGG + Intronic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
1002668539 5:180846088-180846110 CGGCTGAGCCTGCTCAGACCAGG - Intergenic
1003301860 6:4891351-4891373 CAGCTGTGCCTGGTCATCCCAGG - Intronic
1003539673 6:7007357-7007379 CCGCTATGCCCGGTCAAGACAGG - Intergenic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1018967030 6:168497238-168497260 CAGCTGTGCGTGGTCAAATGAGG + Intronic
1019855025 7:3596949-3596971 CGCCTGTGATTGGCCAAAACTGG + Intronic
1024038822 7:45533479-45533501 CGGCTGTCCCAGGCCAACACTGG + Intergenic
1025171895 7:56766380-56766402 CCACTGTGCCCGGCCAAAACAGG + Intergenic
1025699967 7:63809175-63809197 CCACTGTGCCCGGCCAAAACAGG - Intergenic
1029312946 7:99684453-99684475 CCACTGTGCTTGGTCAAAAAAGG + Intergenic
1029320765 7:99757455-99757477 CCACTGTGCCTGATCAAAAAAGG + Intronic
1034225089 7:149475370-149475392 TGGCTTGGCCTGGTCCAAACAGG + Exonic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1044736679 8:95286035-95286057 CACATCTGCCTGGTCAAAACTGG - Intergenic
1047492373 8:125385750-125385772 CCACTGCGCCTGGTCGAAACTGG + Intergenic
1049390330 8:142364729-142364751 AGGCTGTCCCTGGCCAAATCTGG + Intronic
1054272618 9:63045328-63045350 TGGCAGTGCCTGGTCAACTCCGG + Intergenic
1054303440 9:63393123-63393145 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1054402219 9:64719633-64719655 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1054435824 9:65203948-65203970 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1054494568 9:65817739-65817761 TGGCAGTGCCTGGTCAACTCCGG + Intergenic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061446140 9:130639242-130639264 GGGCTGTGCCTGGCCAATACCGG + Intergenic
1061913672 9:133738174-133738196 GGGCTGGGCCTGGTCAGATCTGG - Intronic
1203622842 Un_KI270749v1:138294-138316 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1185945924 X:4376090-4376112 CCACTGTGCCTGGTCCAAACTGG - Intergenic
1188067287 X:25678094-25678116 TGGTTGTACCTGGTCTAAACTGG - Intergenic
1188067547 X:25680401-25680423 CAGCTGAAGCTGGTCAAAACTGG - Intergenic
1193135171 X:77962670-77962692 CTGCTGCTCCTGCTCAAAACGGG - Intronic
1199682962 X:150240138-150240160 AGGCTGGGCCTGGGCAAGACAGG + Intergenic
1199768688 X:150959519-150959541 TGGCAGTCCCTGTTCAAAACTGG + Intergenic
1201190796 Y:11440686-11440708 TGGCAGTGCCTGGTCAACTCCGG - Intergenic
1201733042 Y:17226246-17226268 CCACTGTGCCTGGTCCAAACTGG - Intergenic