ID: 901514406

View in Genome Browser
Species Human (GRCh38)
Location 1:9735277-9735299
Sequence GTTCCTGGAGTGGCCCCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901514406 Original CRISPR GTTCCTGGAGTGGCCCCGGC AGG (reversed) Intronic
900294303 1:1941193-1941215 CTTCCTGGACTTGCCCCCGCCGG - Intronic
900365928 1:2311983-2312005 GTCCCTGCAGAGGCCCAGGCAGG - Intergenic
900712359 1:4122458-4122480 GTGCCTGGAGCAGCCCTGGCCGG + Intergenic
900981464 1:6048464-6048486 GCTCATGGTGTGGCCCAGGCAGG - Intronic
901022799 1:6263481-6263503 GTCCCTGTAGTGGCCTTGGCTGG + Intergenic
901514406 1:9735277-9735299 GTTCCTGGAGTGGCCCCGGCAGG - Intronic
902466925 1:16624212-16624234 GTTCATGGCGTGGCCCCAGGAGG + Intergenic
902613549 1:17610924-17610946 GATCCTGGATTGGCACCAGCAGG - Intronic
904829755 1:33299116-33299138 GTTCCTGGAGGGCCCCCGGAGGG - Exonic
909335228 1:74465361-74465383 GTGCCTGGAGTGGCGCCCACCGG - Intronic
912452280 1:109774383-109774405 CTTCCCCGAGTGGCACCGGCTGG - Intronic
912930746 1:113958180-113958202 GTTCCTGGAGTTGCCCAGCAGGG + Exonic
915553476 1:156648170-156648192 GGTCCTGCAGAGGCCCCGGGAGG - Intronic
916606094 1:166343449-166343471 CTTCCTGGGCTGGCCCAGGCTGG - Intergenic
919827911 1:201516895-201516917 GCTCCTGGAGTGGCCAGGTCAGG - Intergenic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
922774111 1:228207183-228207205 GTTCCAGGAGAGCCCCCGGGTGG + Intronic
1062861270 10:812297-812319 GTTTCTGGGGTGGCCCCTGCAGG + Exonic
1064030576 10:11880343-11880365 GTCCCTGGACTGGGCCGGGCTGG - Intergenic
1065946815 10:30612294-30612316 GTTCCCTGAGTGGGGCCGGCTGG + Intronic
1066266271 10:33778346-33778368 GTTCCTGAAGTGACCCCGGTAGG - Intergenic
1067317272 10:45180534-45180556 CTTCCAGGCGTGGCCCCGGGAGG - Intergenic
1070653387 10:78254080-78254102 CTTCCTGGAGGGGCCCATGCTGG + Intergenic
1075818091 10:125281759-125281781 TTTTCTGGAGTGGCCCAGGTTGG + Intergenic
1076909370 10:133379507-133379529 GTTCCGGGAGGGGCTCCGGGAGG - Intronic
1077029411 11:457465-457487 GTTCATGATGTTGCCCCGGCTGG + Intronic
1078534669 11:12163387-12163409 GTCCCGGGATTGGCACCGGCTGG - Intronic
1083921030 11:65781381-65781403 GCTCCCGGAGTGGCCCCTGGGGG + Intergenic
1084196131 11:67524300-67524322 GTTCCTGGAGTGCCCTCAGAGGG + Intergenic
1084709353 11:70834478-70834500 GCTCCTGGCTTGGCCCCCGCTGG - Intronic
1088114211 11:106297582-106297604 CTTCCTGCAGTGGCTCAGGCTGG + Intergenic
1091381910 12:67239-67261 GCTCCTGGAGCAGCCCCAGCGGG + Exonic
1096431063 12:51543363-51543385 GTTCCTGGAGTCACCCCAGAAGG - Intergenic
1097185951 12:57196529-57196551 GTTCAAGGAGAGGCCCAGGCTGG + Intronic
1104926351 12:132315993-132316015 GGTCCTGGAGAGGGCACGGCAGG + Intronic
1108359224 13:49653892-49653914 GTTGCTGAAGTGGCCCTGGGTGG - Intergenic
1113522758 13:110952438-110952460 GTTCCTGCAGTGGCTCCCGAGGG + Intergenic
1113702612 13:112398399-112398421 GTTCCTGCAGTGGCTCCCGAGGG - Intronic
1113806138 13:113110748-113110770 GTTCCTGGAGGAGCTGCGGCCGG + Exonic
1113875068 13:113589116-113589138 GGTCCTTGAGTGGGCCCAGCTGG + Intronic
1114193003 14:20454847-20454869 GTCCCTGGAGGGGCCTTGGCGGG - Exonic
1114228255 14:20758053-20758075 GTACCTGGAATTGCCCCTGCAGG - Intergenic
1120313477 14:82861172-82861194 GTGCATGGAGTGGCCCCCTCAGG - Intergenic
1122694674 14:103546883-103546905 GCACCTGGCGTGGCCCAGGCAGG + Intergenic
1122722055 14:103727674-103727696 GCCCCGGGTGTGGCCCCGGCTGG - Intronic
1122809023 14:104278639-104278661 GTGCCTGGAGTGGCCAGTGCAGG - Intergenic
1122971970 14:105156032-105156054 GTTCCTGGAGGACCCCTGGCCGG - Intronic
1125448386 15:39782631-39782653 GTTCCTCGAGGAGGCCCGGCGGG - Exonic
1128524238 15:68401678-68401700 GTCCCTGGAGGGGCACTGGCTGG + Intronic
1128654855 15:69453118-69453140 GTTCGCGGCCTGGCCCCGGCCGG - Intronic
1131255717 15:90860653-90860675 GTTCCTGCGGTGTCCCTGGCTGG - Intergenic
1131741657 15:95399423-95399445 GTTCTTGGGGTGGCCCCAGGTGG - Intergenic
1131831021 15:96354498-96354520 GTTCCTACCGTGGCCCAGGCCGG - Intergenic
1132055839 15:98649691-98649713 GTTCCCGCAGTGGCCGCGGGCGG - Intronic
1139429644 16:66904284-66904306 GCCCCTGGAGAGGCCTCGGCTGG - Intergenic
1139489432 16:67278769-67278791 GTTCCTGGAGCGCCCCCAGCAGG + Exonic
1140480845 16:75262132-75262154 GTTCCTGGAGAGGCTGCTGCGGG - Intronic
1141837664 16:86553378-86553400 CTTTCTGGACTGGCCCAGGCCGG + Intronic
1141848477 16:86627508-86627530 GTGCCTGGAGTGGCTGGGGCTGG + Intergenic
1142224970 16:88872790-88872812 GGTCCTGGGGCGGCCCTGGCAGG + Intergenic
1145767190 17:27466797-27466819 GCACCTAGAGTGGCCCCAGCCGG - Intronic
1148233058 17:45949275-45949297 GGCCGTGGAGCGGCCCCGGCGGG - Intronic
1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150765535 17:67998895-67998917 GCTCCTGGGGTGGCACCAGCTGG + Intergenic
1152034555 17:77864100-77864122 GGTCCTGGAGTGGCCCACGCCGG - Intergenic
1152122063 17:78424911-78424933 GTTCCAGGAGTGGCAGCAGCTGG + Intronic
1152317726 17:79590611-79590633 TTTCCTGGAGGAGCCCCAGCTGG - Intergenic
1152821119 17:82438375-82438397 GTTGTAGGAGTGGCCCCTGCAGG + Intronic
1157375503 18:47160434-47160456 GTTCCTGGAATGCCATCGGCTGG + Intronic
1157688456 18:49661762-49661784 GTGCTGGGAGTGGGCCCGGCTGG + Intergenic
1161773024 19:6241597-6241619 GGTCCTGGGGTGGCCGTGGCGGG + Intronic
1163236870 19:16035104-16035126 CTTCCCGGATTGGCCCAGGCAGG - Intergenic
1163634207 19:18430924-18430946 CTTCCAGGTATGGCCCCGGCTGG + Exonic
1165189324 19:34049324-34049346 CTTCCTGGAGTCACCCAGGCTGG - Intergenic
1165398128 19:35578651-35578673 GGTCCTGGTGGGGCCCAGGCAGG - Intergenic
1166139683 19:40799360-40799382 CTTCCCGGGGTCGCCCCGGCAGG - Intronic
1166305906 19:41936975-41936997 CTTCCTCTAGTGGCCCCAGCAGG - Intergenic
1167252145 19:48405084-48405106 GTTCATGGTGGGGCCCCAGCTGG + Exonic
1167396979 19:49236078-49236100 GTTACTGGAGGGGCTCAGGCAGG + Intergenic
929858620 2:45655976-45655998 GTTCCTGGCATGGCCACCGCAGG + Intronic
932335993 2:70931703-70931725 GACCCTGGAGAGGCCCAGGCAGG - Intronic
933305195 2:80588750-80588772 GTCCCTGGAGTGCCCTGGGCAGG + Intronic
935111556 2:100098999-100099021 GGGCCTGGAGGGGCCTCGGCAGG - Intronic
935738293 2:106124311-106124333 GTCCCTGGACTGGCACCGTCTGG + Intronic
936051791 2:109229480-109229502 GGTCCTGGGGTGGTCACGGCAGG + Intronic
936123412 2:109766165-109766187 GGGCCTGGAGGGGCCTCGGCAGG + Intergenic
936221273 2:110605299-110605321 GGGCCTGGAGGGGCCTCGGCAGG - Intergenic
938501669 2:131833891-131833913 GTCCCTGGACTGGGCCCTGCAGG - Intergenic
941281562 2:163558296-163558318 GTTCCTGGAGTGGTGCCACCAGG + Intergenic
942615133 2:177783964-177783986 CTTCCTGCAGTGGCACAGGCTGG - Intronic
1175870929 20:62209028-62209050 CTGCCTCGAGTGGCCCCAGCAGG - Intergenic
1176027910 20:62995462-62995484 AATCCTGGAGTGGGCCAGGCCGG - Intergenic
1176132157 20:63500717-63500739 GGTGCTCGAGTGGCCCAGGCCGG + Intergenic
1176283292 20:64327594-64327616 GCTCCTGGAGCAGCCCCAGCGGG - Intergenic
1178921705 21:36743184-36743206 TTTCCTGGGGTGGCCCAGCCTGG + Intronic
1180091790 21:45537287-45537309 GGTCCTGGAGGGAACCCGGCTGG - Intronic
1180954385 22:19735133-19735155 GTACCTGGATTGGCCCTAGCAGG + Intergenic
1181043572 22:20204222-20204244 GGCCTTGGAGTGTCCCCGGCAGG - Intergenic
1181559319 22:23690884-23690906 GTCCCAGGAGGGGCCCAGGCAGG - Exonic
1183063887 22:35350768-35350790 GTTCCTGGATTGGGCTCTGCGGG + Intergenic
1183936429 22:41265042-41265064 ATGCCTGGAGTGGCCCGGGAAGG + Intronic
1184067137 22:42127356-42127378 GTTCCTAGAGTGGGCCCACCTGG + Intronic
1184069860 22:42141061-42141083 GTTCCTAGAGTGGGCCCACCTGG + Intergenic
1184646581 22:45898605-45898627 CCTCCTGGGGTGGCCCCTGCAGG - Intergenic
1184783391 22:46660083-46660105 GATCCTGGAGTGGGGCTGGCGGG - Intronic
1184814236 22:46858568-46858590 GTTCCTGCAGAGGCGCCTGCAGG + Intronic
949977841 3:9477089-9477111 GTTTGTGGAGTGGCACCGACAGG + Exonic
950668017 3:14509074-14509096 GCTCCTGGAGCGCCCCCTGCTGG - Intronic
954540437 3:51390204-51390226 GCTCCTGGAGTAGCTCAGGCAGG - Intergenic
956858682 3:73301212-73301234 GTTGCTGTAGTTGCCCGGGCTGG + Intergenic
961377269 3:126475486-126475508 GGCCCTGGCGTAGCCCCGGCGGG - Exonic
969723139 4:8904362-8904384 GTTGCGGGGGTGGCCGCGGCTGG - Intergenic
985030392 4:185783425-185783447 GTTCCTGGACTGGCCACCTCTGG + Intronic
986013798 5:3740425-3740447 GTTCCTTGAGTGTCCCAGGGAGG + Intergenic
989122317 5:38017071-38017093 GCTCCTGGCATGGCCCCGGTCGG - Intergenic
991663041 5:68969553-68969575 GCTCCTGGAGTGGAACCTGCTGG - Intergenic
993872451 5:93268303-93268325 GATCCTGGAGTGGACACTGCGGG + Intergenic
995988490 5:118208364-118208386 GTCTCTGGGGTGGCCCAGGCTGG - Intergenic
1000188853 5:158888778-158888800 GTTCCTGGAGTGGCAGAGGCTGG - Intronic
1001400973 5:171446301-171446323 CTTCCTGCGGTGGCCCTGGCTGG + Intronic
1001644092 5:173267419-173267441 GTTCCTGTGGTGGCCCAGGGTGG + Intergenic
1002299427 5:178248969-178248991 GAGCCTAGAGTGTCCCCGGCCGG + Intronic
1002639054 5:180622003-180622025 TCTCCTGGAGGGGCCCCAGCTGG + Intronic
1004727486 6:18325360-18325382 GTTCCTGGAGCAGCCCCTGGAGG - Intergenic
1006168847 6:32081617-32081639 GTTCCTGGAGCAGCCCCTCCTGG - Intronic
1006670911 6:35729105-35729127 GTTCCGGGAAAGGCCCTGGCAGG + Intergenic
1006787662 6:36679207-36679229 GTCCCTGGAGGGGCCCAGGAAGG + Intronic
1006860994 6:37171238-37171260 GATCCTGGAGAGGCCCGAGCCGG + Exonic
1006915122 6:37588878-37588900 GGTCCTGCAGTGGCCCTTGCTGG + Intergenic
1012850941 6:104446280-104446302 CTTCCTGGGCTGGCCCAGGCCGG + Intergenic
1018643630 6:165928401-165928423 GATCCTGGAGTGGGTCCAGCAGG - Intronic
1019077533 6:169400152-169400174 GTTCTTGGAGTGTCGCTGGCTGG + Intergenic
1019266635 7:120851-120873 GCTCCTGGACTGGCCTCTGCTGG + Intergenic
1019282530 7:207676-207698 GTCCCTGGTGTGGCCCCGTGAGG + Intronic
1019287099 7:229064-229086 GGTCCTAGAGTGGCCCCCGTGGG - Exonic
1019565392 7:1676377-1676399 GATCATGGGGTGGCCCGGGCTGG + Intergenic
1020233043 7:6334659-6334681 GTTCCACGAGTTGCCCAGGCTGG + Intronic
1023758857 7:43445030-43445052 GTGCCTGGAGTAGCCCCCTCGGG - Exonic
1023845044 7:44115802-44115824 GATCCTGGAGTGGACCCTGCGGG - Exonic
1034188189 7:149195373-149195395 AGTCCGGGAGTGGCCCCGGTAGG + Intergenic
1034273540 7:149814520-149814542 GCTCCTGGTCTGGCCCCTGCAGG - Intergenic
1034298782 7:149996914-149996936 GGTGCTGGCGTGGCCCCGGGTGG - Intergenic
1034807235 7:154099867-154099889 GGTGCTGGCGTGGCCCCGGGTGG + Intronic
1035355921 7:158276194-158276216 GCTCCTGCCCTGGCCCCGGCAGG + Intronic
1035448028 7:158956361-158956383 GTTCCTGGAGGGGCCACCTCTGG + Intronic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1037812475 8:22095224-22095246 TTTCCTGGGCTGGCCCGGGCTGG - Intronic
1040521126 8:48177025-48177047 GATCCTGGAATCGCCCCTGCGGG + Intergenic
1049394895 8:142395402-142395424 CTGCCTGGAGTGGCCCCGACTGG - Intronic
1049586701 8:143435716-143435738 GTGCCTGGAGGGGTGCCGGCTGG - Intergenic
1049680048 8:143914081-143914103 GGAACAGGAGTGGCCCCGGCCGG - Intergenic
1055325087 9:75120439-75120461 ATTCATTGAGTGGCCCAGGCTGG - Intronic
1056773815 9:89497708-89497730 GTCCCAGGAGGGGCCCCGGGGGG + Intronic
1057312663 9:93951804-93951826 GTGCCTGGAGGCTCCCCGGCCGG + Exonic
1058744494 9:107976687-107976709 GTTCTTGCAGTGGTCCAGGCAGG + Intergenic
1060917953 9:127402561-127402583 GGTGCTGGAGTGGCGCTGGCTGG + Exonic
1062253985 9:135612568-135612590 GTTCCAGAAGTGGCCATGGCTGG - Intergenic
1062337518 9:136078806-136078828 GTTCCTGGAGGGGACCACGCTGG - Intronic
1189160294 X:38803787-38803809 GAATCTGGAGTGGCCGCGGCCGG - Exonic
1189333808 X:40158146-40158168 CTACCTGGACGGGCCCCGGCTGG - Intronic
1189551319 X:42096455-42096477 GATCATGGAGTGGTTCCGGCCGG + Intergenic
1196145004 X:112306830-112306852 GTTTCTGCAGTGGCCACAGCAGG + Intergenic
1202196562 Y:22304401-22304423 GTTCCTTGAGTGGCTGAGGCAGG + Intergenic