ID: 901514424

View in Genome Browser
Species Human (GRCh38)
Location 1:9735419-9735441
Sequence CAAGTGTCATTGGGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901514420_901514424 18 Left 901514420 1:9735378-9735400 CCTTACAGAAGGGGTTAGGCTGT 0: 1
1: 0
2: 0
3: 19
4: 92
Right 901514424 1:9735419-9735441 CAAGTGTCATTGGGCAAAACAGG 0: 1
1: 0
2: 1
3: 22
4: 143
901514418_901514424 23 Left 901514418 1:9735373-9735395 CCTTTCCTTACAGAAGGGGTTAG 0: 1
1: 0
2: 1
3: 9
4: 106
Right 901514424 1:9735419-9735441 CAAGTGTCATTGGGCAAAACAGG 0: 1
1: 0
2: 1
3: 22
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901514424 Original CRISPR CAAGTGTCATTGGGCAAAAC AGG Intronic
900304121 1:1994874-1994896 CAAGGGTCATTGGGAGAAACAGG + Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901514424 1:9735419-9735441 CAAGTGTCATTGGGCAAAACAGG + Intronic
905582823 1:39095107-39095129 GAAATGTGATTGGGCAAAAAGGG + Intronic
908035102 1:60043325-60043347 CTAGTGTAATTGGGAAAAGCAGG - Intronic
909401115 1:75231848-75231870 CAATTCTCATTGGCCAGAACAGG - Intronic
909504468 1:76372573-76372595 TCAGTGTCAATGGGAAAAACTGG + Intronic
910449963 1:87334768-87334790 CAAGTGTCGATGGGCAGAGCTGG + Intronic
910670321 1:89765979-89766001 TAAATCTCATTGGCCAAAACTGG - Intronic
911088671 1:94000760-94000782 CAAGTGTCAATGGAGAACACAGG + Intronic
916859390 1:168786658-168786680 CCAGTGTCATTGGGCAGAAGGGG - Intergenic
917532499 1:175849480-175849502 GACATGTCATTTGGCAAAACTGG + Intergenic
917782712 1:178415714-178415736 CAAGAGACATGAGGCAAAACTGG - Intronic
919084465 1:192905696-192905718 CAAGTGTAATTGGGCAGGATGGG - Intergenic
920182279 1:204139474-204139496 CAAGTCTCATTGGAGGAAACAGG - Intronic
921188981 1:212693336-212693358 CAAGTGTCGTTGGTCACAAGCGG - Intronic
1069238391 10:66106943-66106965 CTAATGTCATTGTGCTAAACAGG + Intronic
1071776832 10:88798452-88798474 CACGTGTCATTGGACGAACCTGG - Intergenic
1072286011 10:93915783-93915805 CACGTATCATTGGTCAGAACTGG - Intronic
1072604091 10:96963906-96963928 CAAGTGTCATACAACAAAACAGG + Intronic
1079875554 11:25852595-25852617 CCAGTGTTGTTGGGCAAACCTGG + Intergenic
1080066031 11:28014667-28014689 CAATTGTTATTGGGAAGAACAGG + Intergenic
1080781958 11:35437784-35437806 CATGTGTCTTTGGGAAGAACAGG + Intronic
1081399492 11:42626268-42626290 AATGTGTCATTGGCCAAAACTGG + Intergenic
1086324098 11:85681072-85681094 CCAGTGTCATTGGCCAAAATTGG - Intronic
1086448293 11:86890766-86890788 CCAGTGGCATTGGGCTAAGCAGG - Intronic
1087200742 11:95341843-95341865 AAAGTATCATTGGGCATAACAGG - Intergenic
1088942628 11:114475814-114475836 CAAGTGACATTTTACAAAACTGG - Intergenic
1094207062 12:27851743-27851765 CCAGTGGCAGTGGGCTAAACAGG - Intergenic
1097457598 12:59819216-59819238 CTAGTGTAATTGTGCAAAATTGG - Intergenic
1098986226 12:77015134-77015156 CAATTGTTATTGGTCCAAACTGG - Intergenic
1099297874 12:80852851-80852873 GAATTGTCATTGGACAGAACTGG - Intronic
1102036973 12:109776243-109776265 CTTGTCTCATGGGGCAAAACTGG + Intergenic
1102653822 12:114463196-114463218 CATATGTCATTGGCCAAAATTGG - Intergenic
1104007277 12:124902357-124902379 CAGGTCTCATTGGTCAGAACTGG - Intergenic
1105799521 13:23891482-23891504 CAGGTGTCTTTGGTCAAAAACGG - Exonic
1105849524 13:24321553-24321575 CAGGTGTCTTTGGTCAAAAATGG + Exonic
1107391370 13:39968033-39968055 CAAGAGTGATTTGGGAAAACTGG - Intergenic
1108055751 13:46483359-46483381 AAAATGTGATTGGACAAAACAGG - Intergenic
1108355422 13:49625324-49625346 CAAGGGCCTTTGGGCAGAACTGG + Intergenic
1110937267 13:81306951-81306973 TAAGTGTAATTGGACAAAAAGGG + Intergenic
1112004505 13:95242799-95242821 CAAGTGTCAATAGGCAAGGCTGG + Intronic
1112438225 13:99406831-99406853 CACGTGTCATTGGGAAGAACAGG - Intergenic
1114545176 14:23494663-23494685 CAAGTGTCTTTGGGAATCACTGG + Intronic
1119127043 14:72137196-72137218 CAAATGTCAATGTGGAAAACTGG - Intronic
1119840647 14:77790405-77790427 CATGTGTCATGAGCCAAAACAGG - Intergenic
1122456613 14:101858168-101858190 CAAGTGTCATTAGTCTGAACAGG - Intronic
1128673168 15:69589746-69589768 CCAGTGTCATTTTGCAAAACAGG + Intergenic
1130873030 15:87986671-87986693 CAAGTGTCAGTTGGCAGAATAGG - Intronic
1132060814 15:98691155-98691177 AAAGGAACATTGGGCAAAACTGG - Intronic
1132164592 15:99573345-99573367 AAAGTGTGATTTGGGAAAACTGG - Intronic
1134252949 16:12587594-12587616 CAAATGTTATTGGCCAAACCAGG - Intergenic
1135148271 16:19982736-19982758 GAAGTATGATTGGGCAAAAGTGG + Intergenic
1140726013 16:77813113-77813135 AAACTGTAATTGTGCAAAACAGG + Intronic
1141859865 16:86709176-86709198 TATGTCTCATTGGGCAGAACTGG - Intergenic
1142275341 16:89115549-89115571 CACGTGTCATTGCTTAAAACAGG - Intronic
1143510822 17:7394286-7394308 CAAGTGTCAGTGGGCGGGACCGG + Exonic
1144004260 17:11085952-11085974 CAATTGTCATTGGCCAGAAATGG + Intergenic
1144137895 17:12316356-12316378 CCAGTGTCACTGGTCAAAACTGG + Intergenic
1146809833 17:35894346-35894368 AAAATGTGATTGGGCAAAAAGGG + Intergenic
1146821472 17:35986290-35986312 CAAGTCTCATTGGTCAAGGCTGG + Intronic
1147866882 17:43559157-43559179 CAAGTGTCTCTGGGCAAGGCAGG + Intronic
1147891213 17:43718545-43718567 TAAGTGTCAGGGGGCAAGACAGG - Intergenic
1149045114 17:52236081-52236103 CAAGTGTCATTTGACAAAAAGGG + Intergenic
1153576511 18:6527262-6527284 CAAGTGCAACTGGGCAAGACAGG - Intronic
1154142296 18:11834913-11834935 CAAGTGGCCTTGGGCAAAGCAGG + Intronic
1156484973 18:37459260-37459282 CCAGTGTCATGGGGACAAACTGG - Intronic
1157418039 18:47522193-47522215 GAAGTGTGATTGGACAAAGCGGG - Intergenic
1158914674 18:62111151-62111173 CATGTGTCCTTGTGGAAAACAGG + Intronic
1159717601 18:71846517-71846539 CAATAGTCATTGCGGAAAACAGG - Intergenic
1159989550 18:74887825-74887847 CAAGTGAAATATGGCAAAACTGG + Intronic
1160036472 18:75305887-75305909 CAAGTGTCTTTGAGAAACACTGG + Intergenic
1165942911 19:39424191-39424213 CAAATCTCCTTGGGCAAAGCTGG - Exonic
1168183698 19:54682701-54682723 CAAGTGTTCTTGGGGCAAACAGG - Intronic
926005763 2:9372482-9372504 CAATTGGCATAGGGTAAAACTGG - Intronic
926309624 2:11666122-11666144 CAAGTGGCAGTGGGCCAAAGTGG + Intronic
932007910 2:67946051-67946073 CAATTGTCATTTGACAACACCGG - Intergenic
932943266 2:76194948-76194970 CAAGTGTCATTTGAAAAAGCAGG - Intergenic
933157893 2:78994274-78994296 CTAGTATCTTTGGGGAAAACTGG - Intergenic
935205711 2:100895157-100895179 CAAGTGTCTTTGGGAGAAACAGG - Intronic
935260060 2:101346838-101346860 GATGTGCCATTGGGGAAAACTGG - Exonic
937266873 2:120622164-120622186 CTAGTGTCACTCGACAAAACCGG - Intergenic
938142745 2:128810109-128810131 TAAGTTTCATTGGCCAAAACTGG - Intergenic
940903918 2:159151611-159151633 CAAGTGTAATTTGGAAAACCAGG + Intronic
946632044 2:221680367-221680389 CAAGTGTCATGAGGCTTAACTGG - Intergenic
947854057 2:233311401-233311423 CATATCTCATTGGCCAAAACTGG + Intronic
1169795388 20:9457278-9457300 CATGGCTCATTGGGCAACACTGG - Intronic
1170323101 20:15123122-15123144 CAAGTCTCTTTGGTCTAAACTGG - Intronic
1171482578 20:25465250-25465272 CCAGTGTCATGGGGAAAAACAGG + Intronic
1172934706 20:38611557-38611579 CAAGTGTGGTTGTGCATAACTGG - Intronic
1173741634 20:45406300-45406322 CAAGTGTGCGTGGGCAGAACCGG + Intronic
1178225342 21:30710796-30710818 CAAGTGTCATAGGAGAAACCTGG - Intergenic
1178368838 21:32010279-32010301 AAAGTGTCATTGGGGGAAAAGGG + Intronic
1178713766 21:34944571-34944593 CAAATGTCATTTGGCAAACTTGG + Intronic
1185178494 22:49345852-49345874 CTAGGGTCATTGCACAAAACAGG - Intergenic
949331420 3:2927452-2927474 CACATTTCATTGGCCAAAACAGG + Intronic
951374657 3:21898932-21898954 CACGTCTCATTGGCCAGAACGGG + Intronic
953043002 3:39271624-39271646 CAGGAGTCATTGGGCAACATAGG + Intronic
955142744 3:56285676-56285698 CCAGTGTCCATGGGCAAACCTGG + Intronic
955314667 3:57926548-57926570 GAAGTGTTATTGAGAAAAACTGG - Intronic
957298878 3:78365164-78365186 CTAATGTCATTGGACAAAGCGGG - Intergenic
958659859 3:97052765-97052787 CAAGTGTTATTGGTAGAAACAGG - Intronic
958802424 3:98771556-98771578 CATGTTTAATTGGGTAAAACAGG + Intronic
960036555 3:113108219-113108241 GAAGTGTGATTGGACAAAAGGGG + Intergenic
961090668 3:124108538-124108560 CACGTTTCATTGGCCAAAGCAGG - Intronic
963313229 3:143731117-143731139 CAAGTCTCATTGGCCAGAACTGG + Intronic
963339377 3:144016057-144016079 CATGTCTCATTGGCCCAAACAGG - Intronic
963917978 3:150877628-150877650 CAAGTGTGATTTGCCAAACCAGG + Intronic
965297988 3:166975062-166975084 CATTTTTCATTGGGGAAAACTGG - Intergenic
966564053 3:181356362-181356384 CAAGTATATTTGGGAAAAACAGG - Intergenic
969648896 4:8451385-8451407 GAACTGGCATTAGGCAAAACAGG - Intronic
970390756 4:15610188-15610210 CAAGTGTCATCTTGCAAAACTGG + Intronic
977411037 4:96664278-96664300 GAAATGTGATTGGGCAAAAAGGG - Intergenic
977581913 4:98734887-98734909 AAAGTATCATTGGGCAAAAGGGG - Intergenic
978273855 4:106924915-106924937 CAAGTGACCTTGGACAAAACTGG + Intronic
981853797 4:149262972-149262994 CAAGTTTCATTGGCCAAAACTGG - Intergenic
982596907 4:157397003-157397025 CTATTATCATTGGGGAAAACTGG + Intergenic
983903016 4:173156746-173156768 CAAGTGTCAATGGCTAAATCAGG + Intergenic
984709478 4:182873192-182873214 TAAGTCTCATGGGGCAAAAAGGG + Intergenic
989181231 5:38579279-38579301 CATGTTACATTGGCCAAAACAGG + Intronic
989601578 5:43205179-43205201 CAAGTGGAATTGGGTGAAACTGG + Intronic
990886919 5:60605022-60605044 AAAATGTCTTTGAGCAAAACTGG - Intronic
992396109 5:76371016-76371038 CAAATGTGATTGGACAAAAAGGG + Intergenic
994114207 5:96043735-96043757 CAAGTTTCACTGGCCAGAACAGG + Intergenic
994988207 5:106965242-106965264 TAAGTGTCATGGAGGAAAACTGG + Intergenic
997434112 5:133861839-133861861 CAAGTGACAATTGGCAAAGCAGG - Intergenic
998594046 5:143509295-143509317 CAAGTGTAATGTGGCAAAAGAGG + Intergenic
1000387913 5:160693091-160693113 CAAGTGTAAATGGTCAAAAAAGG + Intronic
1002277873 5:178114879-178114901 CAAGTGTCCTTGGGAGAAACAGG + Intronic
1003685978 6:8302632-8302654 AAAGTATCAATGGGAAAAACAGG - Intergenic
1004298184 6:14433334-14433356 CAAATGTCACTGGGCAAAGTGGG + Intergenic
1005642325 6:27808032-27808054 CTATTTTGATTGGGCAAAACTGG - Intergenic
1005643024 6:27814896-27814918 CTATTTTGATTGGGCAAAACTGG + Intergenic
1007316206 6:40991236-40991258 CATGTTTCATTGGCCAGAACTGG - Intergenic
1007450489 6:41938050-41938072 CAAGTGGCATGGGGCACTACGGG - Intronic
1011804846 6:91060388-91060410 CCAGTCTCATTGGTCCAAACAGG + Intergenic
1012497557 6:99850847-99850869 CATGTGTCATTGGCCAGAACTGG - Intergenic
1014990434 6:128068348-128068370 CAAGTGACATGCGGCAATACGGG + Intronic
1015089488 6:129338565-129338587 CAAGTGTCATTGCAGAAAAGTGG - Intronic
1020012376 7:4813454-4813476 CAAGTGTCTTAGGGAAAAGCCGG + Intronic
1020153666 7:5703654-5703676 CAAGTGACATTGGGAAAAGATGG + Intronic
1023174403 7:37421828-37421850 CCATTTTCATTGGTCAAAACTGG + Intronic
1023468157 7:40481704-40481726 CAAGTGTTATAGGGAAAAAGGGG - Intronic
1023851839 7:44154654-44154676 CACCTGTCATTGGCCAGAACTGG - Intronic
1024896783 7:54269610-54269632 CATTTGTTATTGGTCAAAACAGG - Intergenic
1028852160 7:95549986-95550008 CAAATCTCACTGGGCAAAACAGG + Intergenic
1030822420 7:114111682-114111704 CAATTGTCATTGTGTAAAACAGG + Intronic
1031807344 7:126324370-126324392 CAAGTCTCTTTGGGCAAATTTGG - Intergenic
1032146824 7:129390761-129390783 CGTGTCTCATTGGGCAGAACTGG + Intronic
1039537121 8:38326812-38326834 TAAGTGTCAGGGGGCAAGACAGG - Exonic
1040600205 8:48876139-48876161 TAAATGTCATGGGGCAAAAATGG - Intergenic
1043990163 8:86743053-86743075 CAAGGGACATTTGGCAAATCTGG - Intronic
1044132192 8:88537895-88537917 CAAATGTTATTGGGCATAAGTGG + Intergenic
1045911592 8:107416616-107416638 GAAGTGTGATTGGACAAAAAGGG + Intronic
1050615964 9:7402100-7402122 CAAGTGTCATTGGAAAAGAAGGG - Intergenic
1052519372 9:29525405-29525427 CAAGTATCAGTGGGAAATACAGG - Intergenic
1052559822 9:30070904-30070926 CAAATGGCAGTGGGGAAAACTGG + Intergenic
1053397575 9:37788104-37788126 CAAGAGATATTGGGCAAAACGGG - Intronic
1055355587 9:75434088-75434110 CAAGAGTCACTGGGGAAAAGAGG - Intergenic
1055887748 9:81084608-81084630 CAAGATTAATTGGGCAGAACAGG + Intergenic
1058017542 9:100052592-100052614 CAAATGTCAGTGGGCAATAACGG - Intronic
1059717854 9:116930424-116930446 CAAGTCTCATTCAGCAAGACTGG + Intronic
1188271226 X:28143648-28143670 GAAGTGTGATTGGACAAAAATGG + Intergenic
1190230245 X:48576224-48576246 CAAGGGTAAGTGGGCAAAAGAGG - Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1197172085 X:123445407-123445429 AAAGTGTCAAGGGGCAAAATAGG - Intronic
1199737542 X:150697660-150697682 CGTGTGACCTTGGGCAAAACTGG + Intronic