ID: 901514463

View in Genome Browser
Species Human (GRCh38)
Location 1:9735674-9735696
Sequence ACCACAGATGCCTCCACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901514460_901514463 -2 Left 901514460 1:9735653-9735675 CCAGTAACCGCAGGAGCTGAAAC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 901514463 1:9735674-9735696 ACCACAGATGCCTCCACAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 180
901514457_901514463 24 Left 901514457 1:9735627-9735649 CCAGCCACAGAGAGGAGAAGAAT 0: 1
1: 1
2: 1
3: 30
4: 295
Right 901514463 1:9735674-9735696 ACCACAGATGCCTCCACAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 180
901514461_901514463 -9 Left 901514461 1:9735660-9735682 CCGCAGGAGCTGAAACCACAGAT 0: 1
1: 0
2: 22
3: 394
4: 3759
Right 901514463 1:9735674-9735696 ACCACAGATGCCTCCACAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 180
901514458_901514463 20 Left 901514458 1:9735631-9735653 CCACAGAGAGGAGAAGAATAAGC 0: 1
1: 0
2: 4
3: 43
4: 316
Right 901514463 1:9735674-9735696 ACCACAGATGCCTCCACAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901514463 Original CRISPR ACCACAGATGCCTCCACAAA GGG Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
901514463 1:9735674-9735696 ACCACAGATGCCTCCACAAAGGG + Intronic
902404937 1:16177443-16177465 GCCCCAGATGCCACCACCAAGGG + Intergenic
903402576 1:23066584-23066606 ATCACATATGCCTCTACAATAGG - Intronic
906444885 1:45887716-45887738 GCCACTGATACCTCAACAAAGGG - Intronic
906802323 1:48748952-48748974 GACACAGATGCCTCCACAGTGGG + Intronic
910191812 1:84602962-84602984 ACCACAGGTGCCACCACACCTGG + Intergenic
910467138 1:87512072-87512094 ACCACAGATGCCTTCTGAATTGG - Intergenic
911169714 1:94757884-94757906 ACCACAGATGATTTCAGAAAAGG - Intergenic
912114931 1:106394301-106394323 ATCACAGAGTCCTCCACAACAGG - Intergenic
912177845 1:107182729-107182751 ACCACTGATGCATTCACAAAGGG + Intronic
912389800 1:109295131-109295153 TCCACAGATGCCTCCCCTAGGGG + Exonic
915448976 1:155991551-155991573 ATCACAGATGACTCCATAACTGG + Intronic
916004724 1:160649070-160649092 CCCACCTAGGCCTCCACAAATGG - Intergenic
916691779 1:167196855-167196877 ACCACAGAGCCCCCCAGAAAGGG + Intergenic
918125618 1:181580818-181580840 ACCACAGAAGCCTCCATCCAGGG - Intronic
922075070 1:222235480-222235502 ACCAATGAAGCCTCCATAAAAGG - Intergenic
922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG + Intergenic
923421385 1:233818914-233818936 ACCACAGGTGCCTTCGCAGAAGG - Intergenic
1063819169 10:9814400-9814422 ACTACAGATGTGTCCTCAAAAGG + Intergenic
1064450883 10:15441059-15441081 TCCACAGAGTCCTGCACAAAGGG + Intergenic
1067512013 10:46904071-46904093 ACCACAGATGCCTACTCCACAGG - Intergenic
1067650234 10:48147753-48147775 ACCACAGATGCCTACTCCACAGG + Intergenic
1068834803 10:61542209-61542231 ACCACAAAGTCATCCACAAAGGG - Intergenic
1069715724 10:70520042-70520064 ACCACAGCAATCTCCACAAATGG - Intronic
1069781837 10:70961783-70961805 TCCACAGGTGGCTCCACAGAGGG + Intergenic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072000926 10:91194944-91194966 ATCACAAATGCCCCCACACATGG - Intronic
1075372471 10:121949667-121949689 ACCACCCCTGCCCCCACAAAGGG + Intergenic
1075551828 10:123398381-123398403 AGCACAGATGCCTTCACCAAAGG - Intergenic
1079312870 11:19381778-19381800 AACTAAGATGCCTTCACAAATGG + Intronic
1080292892 11:30690762-30690784 ATCACTGCTGACTCCACAAAAGG + Intergenic
1080445190 11:32331733-32331755 ACCAAAGATGCTTCCTCAAGGGG + Intergenic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1083853260 11:65379814-65379836 GCCCCAGATGCCTCCCCGAAAGG + Intronic
1084138299 11:67204453-67204475 ATCAAAGAAGCCTACACAAAAGG - Intronic
1084887661 11:72221536-72221558 ACTCCAGAGGCCTTCACAAAGGG - Exonic
1087427577 11:98010692-98010714 AACACAGATGTCACAACAAAAGG - Intergenic
1087781481 11:102305395-102305417 ACCACAGAAGTATTCACAAATGG - Intergenic
1088467000 11:110150978-110151000 ACCACAGATTCCTAAACACATGG + Intronic
1092294953 12:7190077-7190099 CCAGCAGCTGCCTCCACAAAGGG - Intronic
1095624226 12:44296177-44296199 TCCACAGTTGGCTCCACAGATGG + Intronic
1097631422 12:62068282-62068304 ACTACAAATACCTCCACATAAGG + Intronic
1099194093 12:79594577-79594599 AACAAAGATCCCACCACAAAAGG + Intronic
1105960947 13:25338668-25338690 ACCACAGGGGCCTCCACATTTGG + Exonic
1105969715 13:25417182-25417204 ACCACACCTGTCTCCATAAATGG - Intronic
1106742191 13:32656483-32656505 ACCACAGATGACACAACAAATGG - Intronic
1107460680 13:40598929-40598951 ACCAGAGAAGCATCCATAAATGG - Intronic
1110242312 13:73282794-73282816 ACCACAGTGGTCTCCACAAATGG - Intergenic
1114194640 14:20466387-20466409 ACCACAGATGCCACCACACCTGG + Intergenic
1116280794 14:42904102-42904124 AAAACAGCTGCCTCCAAAAATGG - Intergenic
1119634314 14:76261679-76261701 ACCACAGAGGCAGCCCCAAAGGG - Intergenic
1122017764 14:98810703-98810725 CCCACAGAGGACTCAACAAATGG - Intergenic
1122246670 14:100407995-100408017 AGCACAGATGCCTGCACACCAGG + Intronic
1122387841 14:101361130-101361152 ACCACGGCTGCCTGCACACAGGG - Intergenic
1122536313 14:102466009-102466031 CCCACTGCTGCCTCCACAATTGG - Intronic
1122794298 14:104198266-104198288 TCCACAGATGCCTCTCCCAAAGG - Intergenic
1125071397 15:35558105-35558127 ACCACAGATGCCACCATACCTGG - Intergenic
1125475613 15:40046331-40046353 ACCTAAGTTTCCTCCACAAATGG - Intergenic
1126431591 15:48591278-48591300 AACTCAAATGCCTCCTCAAAAGG + Intronic
1130817243 15:87449969-87449991 ACCACAGATTCCTGAATAAAGGG + Intergenic
1130845095 15:87736607-87736629 CCCACAGATTCCACCACAGAAGG - Intergenic
1132062514 15:98704126-98704148 CCCTCAGACACCTCCACAAAGGG + Intronic
1132505328 16:305329-305351 ACCACAGGTGCCACCACACCCGG - Intronic
1133391639 16:5414940-5414962 AGCACAAAAGCCTCCACCAAGGG - Intergenic
1140777874 16:78266638-78266660 ACCTCAGATTCCTCATCAAATGG + Intronic
1141282987 16:82645550-82645572 AGCACAGCTCCCACCACAAAAGG + Intronic
1142015824 16:87746658-87746680 GAGACAGATGCCTCCACAAAGGG + Intronic
1142710362 17:1719859-1719881 ACCACAGATACCACCACACCTGG - Intronic
1144961950 17:19049411-19049433 ACCAGAGAGGACCCCACAAATGG + Intergenic
1144973211 17:19125111-19125133 ACCAGAGAGGACCCCACAAATGG - Intergenic
1156965502 18:43086609-43086631 ACCACATCTCTCTCCACAAAAGG + Intronic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161590705 19:5127932-5127954 ACCACAGGTGCCTGCTCAGAGGG - Intronic
1164618761 19:29681584-29681606 ACCACAGATGCCTCCATTCTGGG - Intergenic
1165140105 19:33694382-33694404 ACCACAGCTGCCTCCCCACTGGG - Intronic
1167473430 19:49687537-49687559 ACCACAAATGTTTCCACAGACGG - Intronic
1167574511 19:50311686-50311708 ACTACAGATGCCACCACACCTGG + Intergenic
925090430 2:1150825-1150847 ACCCCAGCTGCCTCCACACAGGG - Intronic
925600881 2:5607707-5607729 ACCTCAGATGCCTCCCTGAAGGG + Intergenic
929306563 2:40369770-40369792 ACCACAGATGATTCCTCAATTGG - Intronic
935262472 2:101367192-101367214 ACAACAGATGGCACCAGAAAAGG + Intronic
935587605 2:104815853-104815875 ACCACAGACTCCTCCAGCAAAGG + Intergenic
935833424 2:107024119-107024141 ACCACAGATGCCTTGACATAAGG - Intergenic
936277279 2:111110658-111110680 TCCACAGAAGCTTCCACACATGG - Intronic
938325184 2:130393665-130393687 ACCACAGGTGCTTCCAGCAAGGG + Intergenic
938369856 2:130762257-130762279 ACGACAGATGCCCCAACAAAGGG + Exonic
939996661 2:148926504-148926526 CCCACAGAAGCGCCCACAAAAGG - Intronic
944336928 2:198544867-198544889 CCCAAAGAGGCCTCCATAAAAGG - Intronic
945050757 2:205822011-205822033 AGCCCAGATGGGTCCACAAAAGG + Intergenic
948110214 2:235448908-235448930 GTCAGAGATGTCTCCACAAAAGG + Intergenic
948300377 2:236901997-236902019 ACCACAGACGTCTACACAAATGG + Intergenic
1168875347 20:1168125-1168147 ACCACAGATTGCTCCCCAAGGGG - Exonic
1169081377 20:2799523-2799545 TCCACAGCTGCCTCCAGAACAGG + Intronic
1169087685 20:2837642-2837664 CCCTCAGAAGCCTCCACCAAAGG + Intronic
1170300622 20:14880831-14880853 AACACAACTCCCTCCACAAAGGG + Intronic
1170540400 20:17381858-17381880 ACCACACAGGCCTCTACACAGGG - Intronic
1171442855 20:25179539-25179561 ACAGCAGATGCCTCCAGGAAAGG + Intergenic
1172871847 20:38141156-38141178 ACCACTGATGGGTCCACAGAAGG - Intronic
1174167901 20:48598199-48598221 ACCGCAGATGCCTCCACCCGGGG - Intergenic
1174761516 20:53211335-53211357 TCCATAGATGCCTCCACTCAGGG + Intronic
1175770255 20:61618953-61618975 CCCACAGATACCTCAACAATAGG + Intronic
1176512937 21:7762249-7762271 CTCACAGCTGCCTCCACAGAGGG + Intronic
1177965806 21:27725123-27725145 CCCACAGATGCATCCCCCAAAGG - Intergenic
1178647050 21:34392773-34392795 CTCACAGCTGCCTCCACAGAGGG + Intronic
1179194902 21:39155806-39155828 TCCATAGATGCCAACACAAAAGG + Intergenic
1179910348 21:44444119-44444141 ACCCCAGGTCCCTCTACAAAAGG - Intergenic
1180039775 21:45269838-45269860 GCCACAGATGCCGTCAGAAAGGG - Exonic
1181407590 22:22695587-22695609 ACCACAGATGCACCCCCACAGGG + Intergenic
1181788934 22:25248104-25248126 GCCACAGATGCATCCAAAGAGGG - Intergenic
1182158176 22:28095889-28095911 ACAACAGCTGCCTACACACAGGG + Intronic
1182176736 22:28297777-28297799 ACCACAGACACGACCACAAAGGG + Exonic
1182834158 22:33327887-33327909 ACCACAAATGCTTCAAGAAAAGG + Intronic
1183719051 22:39551630-39551652 GCCAAAGAAGGCTCCACAAAGGG - Intergenic
1185179747 22:49352524-49352546 GCCACAGCGGCCTCCACAGAGGG + Intergenic
950548849 3:13654624-13654646 AGCACAGACTCCTCCACAGAAGG - Intergenic
950687002 3:14625874-14625896 TCCACAGGGGGCTCCACAAAGGG + Intergenic
952106001 3:30070020-30070042 GCCACAGTTGCCTCCAGGAAAGG + Intergenic
953019303 3:39103773-39103795 TCCACAGATGCTTTCAGAAATGG + Intronic
953405356 3:42657140-42657162 ACCACAGCAGCCTCCCCAAAAGG - Intronic
953820735 3:46205579-46205601 ATTAAAGATGCCTCCCCAAATGG + Intronic
955539702 3:59961533-59961555 CCCACAGATGCCTACACCAGTGG - Intronic
956086804 3:65620118-65620140 ACCACAGATGCATCAAGAAATGG + Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
956171517 3:66437256-66437278 ACCACAGATGTGTCAAAAAAGGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
959186361 3:103052166-103052188 TACACAGATGCCTCCCCAAGGGG - Intergenic
959195217 3:103171775-103171797 ATCACAGTTGTCTCAACAAATGG - Intergenic
959234403 3:103700330-103700352 ACCAAATATGCTTCTACAAATGG + Intergenic
959315644 3:104802948-104802970 TCCACAGATGGCTCCACAGCTGG - Intergenic
959765250 3:110019014-110019036 ACCACAGATGTATCTAGAAATGG - Intergenic
961340516 3:126214005-126214027 ACCACACCTGCGTCCACAAGAGG - Intergenic
962265833 3:133943732-133943754 ACCACAGAAGCCACCACAACTGG + Intronic
962294537 3:134170395-134170417 ACGCTAGCTGCCTCCACAAAAGG - Intronic
963594858 3:147313542-147313564 TCCACAGATGCCTTCACATATGG + Intergenic
963643044 3:147881581-147881603 CCCCCAGGTGCCTCCACCAAGGG - Intergenic
965881805 3:173396374-173396396 ACCACAGATGCTTCTGTAAACGG - Intronic
966340595 3:178921535-178921557 AATACAGATGCTTCCACAATGGG - Intergenic
967451314 3:189626539-189626561 ACAACAGATGCCACCACAAGAGG - Intergenic
967905275 3:194494451-194494473 CCCTCTGCTGCCTCCACAAAAGG + Intronic
970835244 4:20396761-20396783 ACCACATATGCATACACAAAGGG - Intronic
972098507 4:35380881-35380903 AGGACAGATGCCTCCTGAAATGG + Intergenic
974409430 4:61520505-61520527 GCCACAAATGCTTCCACAAGAGG + Intronic
979213746 4:118137842-118137864 AACACAGATGCATCAACATAAGG + Intronic
980437924 4:132802819-132802841 CCCACAGATCCATCAACAAAGGG - Intergenic
981497888 4:145413911-145413933 ACCACCTATGCCTAAACAAAGGG - Intergenic
983737270 4:171077543-171077565 ACCAGAGATGTCTCCACATCTGG + Intergenic
984081821 4:175256417-175256439 AACACACATTTCTCCACAAATGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
988563072 5:32298278-32298300 ACCACAGAGGGCCCCACAAAGGG + Intronic
990229495 5:53696721-53696743 ACAACAGATGCCTCAGAAAAAGG + Intergenic
990608470 5:57434060-57434082 ATTACAGAGGTCTCCACAAATGG - Intergenic
992067526 5:73121082-73121104 CCCACAGATGCACTCACAAACGG - Intronic
995410441 5:111851364-111851386 AATACATATGCCCCCACAAAAGG + Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
998031378 5:138871977-138871999 ATCAAAGATGCCTTGACAAAGGG - Exonic
1002908505 6:1470213-1470235 ACCACAGATCACTTCACAGAGGG + Intergenic
1004184905 6:13413413-13413435 AGCACACATGCCTCATCAAAAGG + Intronic
1005493731 6:26370450-26370472 ACCACAGGTGCTTCCACAGCTGG - Exonic
1005498284 6:26407799-26407821 ACCACAGGTGCTTCCACAGTCGG - Exonic
1005502955 6:26445832-26445854 ACCACAGGTGCTTCCACAGCCGG - Exonic
1005716801 6:28557236-28557258 ATCACAGATGCCAATACAAATGG + Intergenic
1005928380 6:30463505-30463527 ACCACTGACTCCTCCAGAAAAGG + Intergenic
1009536297 6:64891039-64891061 ACCACAGATGCCTGTTCAACTGG + Intronic
1010917329 6:81636194-81636216 GAGACAGATGCCTCCATAAAAGG + Intronic
1011197617 6:84798319-84798341 TCCACAGATGTGTCCACAGAAGG - Intergenic
1012203721 6:96436498-96436520 AGCACAGAAGCCTCCACAGGTGG + Intergenic
1014999123 6:128192675-128192697 ACCACAGCTGCCACCACACCTGG - Intronic
1017184351 6:151586110-151586132 ACAACAGATGCTTCCACTCATGG - Intronic
1018904686 6:168068851-168068873 CCCACAGAGGCCTGCAGAAAGGG + Intronic
1019274781 7:170441-170463 ACCACAAATGCCTTTAGAAATGG + Intergenic
1023610658 7:41967301-41967323 ACCACAGATGCCTCCACTGCTGG + Intronic
1024028320 7:45433178-45433200 TCCACGGATGCCTCCCCAAATGG + Intergenic
1026466261 7:70657599-70657621 TCCAGAGATGGCTCCACAAGTGG - Intronic
1027299350 7:76814073-76814095 ATCAGAGATGCCACAACAAATGG - Intergenic
1029731821 7:102443501-102443523 ACCACAGAGGCCTCCAAGACAGG - Intronic
1041978330 8:63825502-63825524 AGCACAGAAGCCTGCTCAAATGG - Intergenic
1042277040 8:67016397-67016419 ACAACAGATACCAACACAAATGG + Intronic
1042364401 8:67919716-67919738 TCCACAGAGGCCTGCACAACAGG + Intergenic
1045181419 8:99787493-99787515 ATCATAGATGCCATCACAAAGGG + Intronic
1048032777 8:130648693-130648715 ACAACATTTGCCTCCAAAAAAGG - Intergenic
1049155867 8:141066409-141066431 ACCACAATTGCCTCCACAAGCGG - Intergenic
1049311917 8:141937911-141937933 AGCACAGATGCCTCCTCAAAAGG - Intergenic
1056639144 9:88355580-88355602 ATTACAGATGCCACCACAACTGG - Intergenic
1059676697 9:116547198-116547220 AACACAGCTGCATCCACACATGG - Intronic
1060174898 9:121490469-121490491 ACCACTGATGCCACCAGAGATGG - Intergenic
1062012138 9:134272986-134273008 TCTACAGATGCCTGCACACAGGG - Intergenic
1187175140 X:16889334-16889356 CCCACAGATGACATCACAAAGGG + Intergenic
1188924963 X:36028514-36028536 AACACAGATGACACAACAAATGG - Intergenic
1191664160 X:63681086-63681108 ACCACAGGTGCCTTGGCAAAGGG + Intronic
1192320474 X:70086592-70086614 AGCACAAATACCTCCCCAAAAGG + Intergenic
1195154945 X:102113575-102113597 GCCACAGCTGCCTCCACAACAGG - Intergenic
1195645690 X:107228578-107228600 ACCAAAAATGCCTCCACCTAGGG - Intronic
1196270776 X:113708218-113708240 AGCACAGATGGCTACATAAAAGG - Intergenic
1197633627 X:128890434-128890456 TCCACAGAGGCCTCAATAAATGG + Intergenic
1198332143 X:135631751-135631773 GCCACAAAAGCCTCCACATAAGG + Intergenic
1201252296 Y:12071658-12071680 ACCACAGACTCCTCCAGAAGAGG - Intergenic
1202344551 Y:23907803-23907825 TCCACACATGCATCCAAAAATGG + Intergenic
1202526217 Y:25762280-25762302 TCCACACATGCATCCAAAAATGG - Intergenic