ID: 901520342

View in Genome Browser
Species Human (GRCh38)
Location 1:9779040-9779062
Sequence AAGAAGAAGAAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901520339_901520342 26 Left 901520339 1:9778991-9779013 CCAGCCTGGGAGAGAAGCGAGAG 0: 1
1: 0
2: 9
3: 401
4: 4283
Right 901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
901520340_901520342 22 Left 901520340 1:9778995-9779017 CCTGGGAGAGAAGCGAGAGACTT 0: 1
1: 0
2: 5
3: 112
4: 1297
Right 901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901520342 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG Intronic
Too many off-targets to display for this crispr