ID: 901521090

View in Genome Browser
Species Human (GRCh38)
Location 1:9785665-9785687
Sequence CAGTGGTTCTCAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901521090_901521096 -1 Left 901521090 1:9785665-9785687 CCCTCCTCCCTTGAGAACCACTG 0: 1
1: 0
2: 5
3: 39
4: 368
Right 901521096 1:9785687-9785709 GACTGACATCCACCCCGTTAAGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901521090 Original CRISPR CAGTGGTTCTCAAGGGAGGA GGG (reversed) Intronic
901109235 1:6782371-6782393 CAGTGGTTCTCTAGGGACCTTGG - Intergenic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
902110798 1:14076650-14076672 CAGTGGTTCTCAAGCAGGGGTGG - Intergenic
902207297 1:14878447-14878469 TGGTGGTTCTCAAGTGGGGATGG - Intronic
902871690 1:19317585-19317607 CAAGGGTTCTACAGGGAGGAAGG - Exonic
903011355 1:20332875-20332897 CAGCCGTTCTCCAGGGAAGAGGG - Exonic
903140473 1:21335909-21335931 CAGTGGGTCTCCAGGGAGGGAGG + Intronic
904622021 1:31781463-31781485 CAGTGGTGGCCAAGAGAGGAGGG + Intergenic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
905262555 1:36729919-36729941 CTGTGGTTCTCCAGGGAGCCAGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
908970766 1:69826870-69826892 AAGTGGTTCTCTATGGATGATGG + Intronic
909016328 1:70383732-70383754 CAAAGTTTCTCAGGGGAGGAGGG + Intronic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
910391340 1:86747917-86747939 CAGTGGTTCTCCCTGGATGATGG - Intronic
910447919 1:87317629-87317651 CCGTGGTTCTCAACTGGGGATGG - Intergenic
910457457 1:87412597-87412619 CCTTGGTCCTGAAGGGAGGAGGG + Intergenic
911142043 1:94514386-94514408 CAGTGGTTCTCAACCAAGGTGGG - Intronic
911427548 1:97738539-97738561 CAGTGGACCTCAACGCAGGAGGG - Intronic
912735407 1:112145712-112145734 CAGTGGCTCTCAACTGAGGGTGG + Intergenic
914932383 1:151946880-151946902 CTGTGGTGGTCAAGGGAGGTGGG + Intergenic
915019943 1:152769673-152769695 CAGTGGTTCTCAATGGGGTGAGG - Intronic
915143386 1:153780310-153780332 CAGAGGTTCTCCAAGGACGAAGG - Intergenic
916869556 1:168898077-168898099 CAGTGTTTCTAAAGGCATGAGGG - Intergenic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
917361610 1:174182496-174182518 CACTGGATCTCAGGGGAAGAGGG + Intronic
919443949 1:197677568-197677590 CAGATGTTCTCAATGGAGGGTGG + Intronic
919762093 1:201104357-201104379 CAGTGGTTTTCAAGGGATTGGGG - Intronic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
921105333 1:211971270-211971292 CAGTGGTTCTCAACCAGGGATGG - Intronic
921373384 1:214448673-214448695 CAGTGGTTCTCAAAAGACCAGGG - Intronic
921683919 1:218067991-218068013 CAGTGGTTGGTAAAGGAGGAGGG + Intergenic
922477830 1:225919069-225919091 CAGTGTTTCTCTAGGCAGGCCGG - Intronic
922732576 1:227958765-227958787 CACTGATTCTCCTGGGAGGAGGG + Intergenic
922868511 1:228881299-228881321 CAGTAGTTCTCAAGGCAGAGTGG - Intergenic
923078600 1:230632555-230632577 CAGTGGTTCTCACCTGGGGAAGG - Intergenic
923961954 1:239095605-239095627 AAGTGGTTCCCAAGGGTGAAAGG + Intergenic
1065942315 10:30575903-30575925 CAGGGGAGCTCACGGGAGGAAGG - Intergenic
1067154690 10:43768771-43768793 TAGTGGTTTTCAGGGTAGGATGG - Intergenic
1067972677 10:50991037-50991059 GAGGGGGTCTCAGGGGAGGAAGG + Intergenic
1069020896 10:63487325-63487347 CAGTGATTCTCAACACAGGAGGG + Intergenic
1069881305 10:71595571-71595593 CAGTGGTTACCATGGGGGGAAGG - Intronic
1070112677 10:73500054-73500076 CAGTGGTTCTCAATGGATAAAGG - Intronic
1070496354 10:77027579-77027601 GAGTGTTTCTCCAGGGAAGAGGG - Intronic
1071386250 10:85124249-85124271 CAGTGGTTCTTAAGGGCAGGAGG - Intergenic
1072231869 10:93420713-93420735 CAGTGGTTATCTCAGGAGGATGG + Intronic
1073719637 10:106152616-106152638 CAGTGGTTGTCAGGGGCTGAAGG + Intergenic
1075011465 10:118874012-118874034 CAGTTGTTCTCAATTGAGGGGGG - Intergenic
1075174725 10:120148880-120148902 CAGTGGTTTTACATGGAGGATGG - Intergenic
1075249597 10:120854193-120854215 CAGTGGTTGCCAAAGGATGAGGG - Intronic
1075264258 10:120987494-120987516 CAGTGGTTCAGAAAAGAGGAAGG + Intergenic
1075988331 10:126808600-126808622 CAGTGGTTATCTATGGAGGTAGG + Intergenic
1076145068 10:128112248-128112270 CAGAGGTTCCTAAGAGAGGAGGG - Exonic
1076529684 10:131136109-131136131 CAGTGGCTCTCAACTGGGGAGGG - Intronic
1076556090 10:131322317-131322339 CAGTGATTCTCAGGGTAGGATGG - Intergenic
1076688434 10:132208593-132208615 CGGTGGGGCCCAAGGGAGGATGG - Intronic
1076890342 10:133280325-133280347 CAGTGGTTCTCAATGCAGGGTGG + Intronic
1077224304 11:1433420-1433442 CAGAGGCTCTCAAAGGAGGGAGG - Intronic
1077588052 11:3469683-3469705 CAGTGGCCATCAAGGCAGGATGG - Intergenic
1077667387 11:4125284-4125306 TAGTGGTTGTCAAGGGCTGAGGG - Intronic
1079423923 11:20322335-20322357 CTGTGGTCCTCTAGAGAGGACGG + Intergenic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1080206928 11:29740107-29740129 CAGTGGCACTCCAGGCAGGAAGG - Intergenic
1080467121 11:32508134-32508156 CAGTGGTTCTCAAGGGCTTTGGG - Intergenic
1080599939 11:33811530-33811552 CAGTGGTTCTCTTGGGCGGGGGG - Intergenic
1083837480 11:65281053-65281075 CAGTGATTCTCGAGGGAGACCGG + Exonic
1084094193 11:66899604-66899626 CGGTGGCTCACATGGGAGGATGG - Intronic
1085072925 11:73564407-73564429 CAGTGATTCTCAAGTGCAGATGG + Intronic
1089174181 11:116536476-116536498 CACAGTTTATCAAGGGAGGAAGG + Intergenic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089290798 11:117437101-117437123 CAGTGAGTCGCAAGGGTGGAAGG - Exonic
1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG + Exonic
1091453270 12:586854-586876 CAGTGATTCTCATGGGAGCAGGG - Intronic
1091591539 12:1845701-1845723 CCCGGGTGCTCAAGGGAGGATGG - Intronic
1092257590 12:6935962-6935984 CAATGGGTCCCAAGGGGGGAGGG + Exonic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093503860 12:19841929-19841951 CAGTGGTTCTCAAAAGGGGATGG - Intergenic
1094527892 12:31244901-31244923 CTGTGATCCTAAAGGGAGGAAGG + Intergenic
1095474865 12:42576003-42576025 CAGTGTTTTGTAAGGGAGGAAGG - Intronic
1095517941 12:43027813-43027835 CAGTGGTTGTCAAGGGCATAGGG - Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1099257825 12:80336621-80336643 CAGGGATTCTCACAGGAGGAGGG + Intronic
1100144082 12:91655764-91655786 AAGTGGGTGTCAAGGCAGGAAGG + Intergenic
1100726984 12:97419068-97419090 CAGTGGTTCTCAAGAGGACAGGG + Intergenic
1103131172 12:118469808-118469830 CAGTGGTTCTTATAGGAGTAAGG + Intergenic
1104195931 12:126538100-126538122 CAGTGGTTCTCAGCAGGGGATGG + Intergenic
1104940239 12:132391879-132391901 CAGAGGGTCTCCAGGGAGAACGG - Intergenic
1104984192 12:132587410-132587432 CAGTGCAGCTGAAGGGAGGACGG + Intergenic
1107079299 13:36357191-36357213 CAGTTTTTTTCAAGGGTGGATGG + Intronic
1108502717 13:51083190-51083212 CAGTGGTTCTCAAGCTTGAATGG + Intergenic
1108711592 13:53038268-53038290 AAGTGGTTCTAAATGGAGGGAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112559214 13:100497004-100497026 CACTTGTTCTCACGGGAGGCTGG + Intronic
1112729649 13:102346481-102346503 CATTGCTTCTCAAGGCAGAATGG + Intronic
1113163406 13:107409859-107409881 CAGTAGTACTCAAGAGATGAGGG - Intronic
1113866465 13:113528967-113528989 CAGTTATTCTCAACGGAGGGCGG + Intronic
1115353446 14:32422269-32422291 CAGTTGGTCTGAAGTGAGGATGG - Intronic
1116003590 14:39269350-39269372 TAGTGGTTGTCAAGGGATGAGGG - Intronic
1117062911 14:51981155-51981177 GAATGGTCCTGAAGGGAGGAAGG + Intergenic
1117077142 14:52116098-52116120 CAGTGGTTCTAGAGAGATGAGGG - Intergenic
1117615594 14:57530836-57530858 CACTGGTTCTCAATGTGGGAAGG - Intergenic
1117637864 14:57765430-57765452 CTGTGGTTCTCAATGCAGAATGG - Intronic
1117818213 14:59620125-59620147 CAGTTGTTTTCAAAGAAGGAGGG + Intronic
1118119232 14:62819437-62819459 CAGTGGTTGTCAGGGGTGCAGGG + Intronic
1118721804 14:68599824-68599846 AAGTGGTTCCGAAAGGAGGAAGG - Intronic
1119536041 14:75403135-75403157 AAGTGGTTGTAAAGGGAGGGAGG + Intergenic
1119685539 14:76628054-76628076 CAGTGGCTCTTAAAGGAGGGTGG - Intergenic
1119719265 14:76880197-76880219 CAGTGCTTCTCAGTGGAGGGTGG + Intergenic
1119778909 14:77265405-77265427 CAGTGGATCTCAGGACAGGATGG - Intergenic
1120959108 14:90108521-90108543 CAGTGATTCTCAAGGTGGGATGG - Intronic
1122001554 14:98660587-98660609 CAGTGGTTGCCTAGGGATGAGGG + Intergenic
1123974758 15:25542759-25542781 CACTGCTTCTCCATGGAGGAGGG - Intergenic
1125491896 15:40154794-40154816 CTGTGTTTCTCAAGGGTGGGAGG + Intergenic
1125712833 15:41800680-41800702 CAGTGGTTGCCTAGGGATGAAGG - Intronic
1126124385 15:45282287-45282309 CACTGCCTCTCACGGGAGGAAGG - Intergenic
1127696196 15:61450193-61450215 CAGAGGTTCTCAAGGTTAGAAGG + Intergenic
1127733328 15:61819727-61819749 CCGTGGTTCTCATGGGAAGCAGG + Intergenic
1129884213 15:79027262-79027284 CAGTGGTTCTCATGGGTAGAAGG - Intronic
1130582903 15:85154621-85154643 CAGTGGTTCTCTCTGGAGGCTGG + Intergenic
1130835870 15:87649453-87649475 CAGTGGTTCTCAACTGGGGGTGG + Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131883020 15:96878554-96878576 CAGTGGTTCTCAGGAGAAGCTGG - Intergenic
1132036546 15:98489897-98489919 CTGTTGGTCTCTAGGGAGGAGGG - Intronic
1132503192 16:293653-293675 CAGGGGTGCTCAAGGGACAAGGG + Exonic
1132816787 16:1832820-1832842 CAGTTCTCCCCAAGGGAGGATGG + Intronic
1132892880 16:2213125-2213147 GAGTGGTTTTCAAGGAAGTAAGG + Exonic
1133364007 16:5196769-5196791 CAGTGGTTCTCCAAGGGGGGAGG - Intergenic
1133439755 16:5811049-5811071 CAGTGGTTGTCTGAGGAGGATGG - Intergenic
1133882694 16:9797929-9797951 CAGTGGTTCTCAAAGGGTGAAGG - Intronic
1134317413 16:13131868-13131890 CAGTGGTTAATAAGGGAGGATGG - Intronic
1135815720 16:25631138-25631160 CAGTGGTTGTCAAGGGCTGGGGG + Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136581452 16:31153683-31153705 CAATGGATCTTATGGGAGGAAGG + Intergenic
1136998581 16:35208311-35208333 CACTGGTTCCCAACGGTGGATGG + Intergenic
1137333797 16:47528263-47528285 AATTGGTTCTCAAGAGAGCAAGG - Intronic
1137565832 16:49531955-49531977 CAGTGGTTCTCAAGCGTTAATGG - Intronic
1137846352 16:51692222-51692244 CAGTGGATGTCTGGGGAGGAGGG + Intergenic
1137929275 16:52571371-52571393 CAGTGGTTCACAAGTGACTATGG - Intergenic
1138070412 16:53987665-53987687 CAGTGTTTATGATGGGAGGATGG - Intronic
1138410428 16:56835256-56835278 CATTGGTTGTCATGGCAGGAGGG + Intronic
1138880774 16:61012493-61012515 CAAGGGTTCAGAAGGGAGGATGG - Intergenic
1139302143 16:65954475-65954497 CAGTGGTTCTCAACCTTGGATGG + Intergenic
1140036811 16:71377522-71377544 CACCCGTTCTCAAGGAAGGAAGG + Intronic
1140287732 16:73620455-73620477 CAGTGGCTGTCAGGGGTGGAGGG + Intergenic
1141278483 16:82608882-82608904 CTGTGGTTGTCAGGGGATGAAGG + Intergenic
1141743009 16:85906723-85906745 CAGTGGTTCTCAGGTGGGGGAGG + Intronic
1141823813 16:86465316-86465338 AAGTCATTCTCAAAGGAGGAGGG + Intergenic
1142057498 16:88007475-88007497 CAGAGGCTCTCAGGGGAAGACGG - Intronic
1142358443 16:89615050-89615072 CAGTGGGTGTCATGGGTGGAAGG + Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143670273 17:8392017-8392039 CTGGGGTTCTCAAGGGTGGCAGG - Exonic
1144236732 17:13268823-13268845 CAGTGGTTCTCAAAGTTGGCTGG - Intergenic
1144778064 17:17794866-17794888 CTGTGGTTCTCCAGCGAGAAGGG - Exonic
1144838448 17:18170980-18171002 CAGGGGATCTCTTGGGAGGAGGG + Intronic
1144934005 17:18883127-18883149 CAGTGGTTCCCTAGGGTGGAAGG - Intronic
1145029558 17:19494392-19494414 CAATGTTACTCAAGGGAGGGTGG - Intergenic
1145096371 17:20031671-20031693 CAGTGGTTGCCAAGGGCTGAGGG - Intronic
1146012684 17:29208292-29208314 CAGTGGTTCTCAAATAAGGGTGG - Intergenic
1146234330 17:31144283-31144305 CAGTCTTACTCAAGAGAGGATGG - Intronic
1146308893 17:31751842-31751864 CAGTGGTTACCAAGGGCTGAAGG + Intergenic
1146675436 17:34770385-34770407 CAGTGGTTCTCAACCAAGGGTGG + Intergenic
1146812904 17:35917922-35917944 CAGTAGTTGTCACGTGAGGAGGG + Intergenic
1147046318 17:37754964-37754986 CAGTGGTTCTCACTTGAGCATGG + Intergenic
1147255111 17:39176724-39176746 CTGTGGCTCCCATGGGAGGAGGG + Intronic
1148446494 17:47740987-47741009 CAGGGCTTCTCATGAGAGGAGGG + Intronic
1148577712 17:48723195-48723217 CAGTCGCTCTCCAGGGAAGAGGG - Intronic
1148862887 17:50613789-50613811 TTGTGGTACTCAAGGAAGGAAGG + Intronic
1148979726 17:51562139-51562161 CAGTAGTTCTCAGTGGGGGAAGG + Intergenic
1149086820 17:52727924-52727946 CAGTGGTTCTCAAGTAAGGATGG + Intergenic
1149542558 17:57478680-57478702 CAGTGGTTCTCAGAGTCGGAAGG + Intronic
1150471382 17:65440200-65440222 CAATGGTTCTCAAAGGAGGAGGG - Intergenic
1150711212 17:67532277-67532299 CAATGGTTCTCAAAGGTGGCTGG - Intronic
1150834282 17:68550699-68550721 CAGTGGTTCTCAAGGTTGCCTGG + Intronic
1150917584 17:69452102-69452124 CAGTGCTTCTCAACGGAGGGTGG + Intronic
1151203518 17:72487856-72487878 CAGAGGTTCTCCATGCAGGAGGG - Intergenic
1151350165 17:73527145-73527167 CAGGGGAGCTCCAGGGAGGAAGG + Intronic
1152422760 17:80202958-80202980 CAGTGGTTTTCAATGGAGCAAGG - Intronic
1152928815 17:83099855-83099877 CAGGGGTTCTGAGGGGCGGAAGG + Intergenic
1154951137 18:21210996-21211018 CAGTGGTTGCCAAGGGTTGAGGG - Intergenic
1156437648 18:37150426-37150448 CAGTGGTTCTCAAGTGTGGTAGG - Intronic
1157500497 18:48187078-48187100 CAGCTCTGCTCAAGGGAGGAGGG + Intronic
1157568653 18:48697705-48697727 AAGTGGTTCTCAAGGCCAGAGGG + Intronic
1157783055 18:50457270-50457292 CAGTAATTCAAAAGGGAGGAGGG + Intergenic
1157809017 18:50679914-50679936 CAGTGAGTCTCCAGTGAGGAGGG - Intronic
1158395385 18:57075375-57075397 CAGTGGTTCTCAACCAGGGATGG - Intergenic
1158577457 18:58651009-58651031 AAATGCGTCTCAAGGGAGGAAGG + Intergenic
1159837041 18:73350575-73350597 CAGTGGATCACAAGGAATGAGGG + Intergenic
1160237247 18:77095673-77095695 CTGCTGTTCTCCAGGGAGGATGG + Intronic
1161206987 19:3046631-3046653 CAATGGTTCTCAGTGGAGGGAGG - Intronic
1161361558 19:3852798-3852820 CAGTGGTTCTCAAAGAGGGCAGG + Intronic
1161482944 19:4519746-4519768 CAGTGCTTCCCAAGGGTGGCTGG + Intergenic
1161738442 19:6005841-6005863 CAGTGGGGCTTAAGGGAGGCTGG + Intronic
1163217327 19:15890468-15890490 GAGAGGTGCTCAAGGGAGCAAGG - Intronic
1164817695 19:31217825-31217847 CAGTGGTTATCAGGGGTTGAGGG - Intergenic
1166214990 19:41329000-41329022 CAGTGATTGTCCTGGGAGGAAGG - Intronic
1166741362 19:45116633-45116655 CCGTGGTTCTCTGGGGAGAAGGG + Intronic
1167514522 19:49915307-49915329 CAGGGGTTCTTCAGGGAGGCAGG + Intronic
1168049029 19:53814949-53814971 GACTGGTTCCCAAGTGAGGACGG + Exonic
1168067665 19:53927922-53927944 CAGTTGCTCTCAAGTCAGGATGG + Intronic
925639142 2:5970896-5970918 CAGTGGTTGTCAGGGGCTGAGGG - Intergenic
927846128 2:26473731-26473753 CAGGCGTTCTCCAGGGATGAGGG + Intronic
927964410 2:27260265-27260287 CTGGGGTTGTCATGGGAGGAAGG + Intronic
928232526 2:29511296-29511318 CAGTGGTTCCCCAGGAAGCAGGG - Intronic
928329698 2:30348272-30348294 CAGTGCTTCTTTAGGGAGTATGG - Intergenic
928524366 2:32124865-32124887 CAGTGGTTGCCAAGGGAGACAGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929969248 2:46559710-46559732 CAGTGGTTCTCAACTGGGGGTGG - Intronic
930042177 2:47134370-47134392 CAGTGGTTGTCAGGGGTTGAGGG - Intronic
930659936 2:54043304-54043326 CAGTGGTTCTCAACAGGGGCAGG + Intronic
932280377 2:70486251-70486273 CAGTGGCCCTTAAGGGACGAAGG + Intronic
932466179 2:71925781-71925803 CAGTGGCTCTTCAGGGTGGATGG + Intergenic
936086699 2:109474207-109474229 CAGTGGCTCTCTAGGGAGGTGGG + Intronic
936664824 2:114582127-114582149 CAGTGGTTGTCAGGGGTTGAGGG - Intronic
937627921 2:124064718-124064740 CAGTGGTAGTCACGGGAGGGTGG - Intronic
938195703 2:129325713-129325735 CAGTGGCTCTCAACGAAGGGTGG - Intergenic
938705542 2:133921466-133921488 CAGTGGTTGTCAGGGGTTGACGG - Intergenic
938801779 2:134770537-134770559 CAGTGGTTCTTATGAGAGGGAGG - Intergenic
938926889 2:136051572-136051594 CAGTTGCTTTCAAGGCAGGAAGG - Intergenic
943185068 2:184597810-184597832 CTGAGGTTCTCAGGGGAGGTGGG + Intergenic
943760385 2:191601484-191601506 CAGTGGTTCTCAACAGGGGTGGG - Intergenic
945005856 2:205405185-205405207 CAGTGGTTCTCAATGGGAGGGGG + Intronic
946038426 2:216763444-216763466 GAGTAGTTCTCAAGGGAGGTGGG - Intergenic
946153110 2:217789545-217789567 CAGTGGTCCTCAGGGGAGGATGG - Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
946935336 2:224714430-224714452 CGGTGGTTTTCAATGGTGGATGG + Intergenic
947079583 2:226381188-226381210 CTGGGGTTCTCCAGAGAGGAAGG - Intergenic
1170611235 20:17915250-17915272 CAGTGGGACTCTTGGGAGGAAGG + Intergenic
1171052467 20:21872686-21872708 CAGTGGTTGTCAAGGGTCCATGG - Intergenic
1171228706 20:23464630-23464652 CAGTGGTTCTCTGGGCATGATGG + Intergenic
1171966964 20:31537871-31537893 CAGGGGTTCTGAAGGGATAAGGG - Intronic
1172804549 20:37602309-37602331 CAGTGATTCTCAAGGCAGGATGG + Intergenic
1173572301 20:44085315-44085337 CAGTGGTTCTCAATCCAGGATGG - Intergenic
1174008418 20:47428832-47428854 CAGTGGTTCTTAATGCAGGGAGG - Intergenic
1174533483 20:51233104-51233126 CAGTGCTTATCTAGGGAGGAGGG + Intergenic
1174620951 20:51874238-51874260 CAGTGGTTCTCAAGCAGGGGAGG + Intergenic
1175883556 20:62274534-62274556 CTGTGGTTCTGAAGGAGGGAGGG + Intronic
1178603454 21:34014925-34014947 CAGTGGTTCAGAAGGAGGGAGGG + Intergenic
1180706602 22:17814163-17814185 CAGGGGCTCTAAAGTGAGGATGG - Intronic
1181481128 22:23199757-23199779 GAGTCATTCCCAAGGGAGGAGGG + Intronic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1183354521 22:37351088-37351110 CAGGGGACCGCAAGGGAGGAGGG - Intergenic
1184269331 22:43369879-43369901 CAGTGGTGCCCCAGGGAGGCAGG - Intergenic
950590353 3:13932431-13932453 CAGTGGTTCTCAAACCTGGAGGG + Intergenic
950881190 3:16323761-16323783 CAGTGGATCTCAAAGGGGCAGGG + Intronic
952095324 3:29944336-29944358 CAGTGATTCTCAACAGAGGTGGG + Intronic
954778251 3:53039438-53039460 CAGTGGTTGTCTAGGGTGGGAGG + Intronic
956118414 3:65941611-65941633 CAGTGGTTCTTAAGGGGAGGTGG - Intronic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
959303329 3:104630131-104630153 CACTTGTTCTCATGGCAGGAGGG + Intergenic
959922496 3:111884290-111884312 CACTGGTTCCCAAAGGAGAAGGG - Exonic
960682685 3:120265508-120265530 CAGTGGTTCTCATTAAAGGAGGG - Intronic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
962627268 3:137238405-137238427 CAGTGGTTCTCAGTGGAGATGGG + Intergenic
963480894 3:145873337-145873359 TAGTGGTTGTCAAGAGATGATGG + Intergenic
963574494 3:147042853-147042875 CAGTGGTTCTCAATAGGGGTAGG - Intergenic
964697830 3:159529799-159529821 CAGTTGATCTCATGGAAGGAGGG - Intronic
965418656 3:168428601-168428623 CAGTGGTTCTCAATTTCGGAAGG - Intergenic
965849494 3:173006543-173006565 AAGTGGTTCTGAAGAGATGATGG - Intronic
965876546 3:173329644-173329666 CAGTCTTTCTCCAGGGAGCATGG + Intergenic
966098275 3:176232972-176232994 CAGTGGTTACCAAGGGTAGAAGG + Intergenic
966597539 3:181738020-181738042 CAGTGGCTCTCTAGGGAAGGAGG - Intergenic
966811941 3:183854560-183854582 TGGTGGTTATCAAGGGATGAAGG + Intronic
967735697 3:192949694-192949716 CAGGGGTTAGCATGGGAGGAAGG + Intergenic
968511954 4:999742-999764 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968511975 4:999828-999850 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968511996 4:999914-999936 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968731183 4:2270095-2270117 CAGTGGTCCTCTAGGCAGGCAGG - Exonic
969203958 4:5628136-5628158 TAGTGGGTCTCCAGTGAGGAAGG + Intronic
969381740 4:6804324-6804346 CAGTGGCTCTAAACTGAGGATGG - Intronic
969516464 4:7650942-7650964 CTGCATTTCTCAAGGGAGGATGG - Intronic
970663165 4:18308623-18308645 CAGTGAGTCTCAAGGGATGATGG + Intergenic
970867876 4:20779870-20779892 CAGAATTTCTCAAGGGAGCATGG + Intronic
971317321 4:25578306-25578328 CAGTTGTTCCCAAGGGGGAAAGG + Intergenic
972259344 4:37392564-37392586 CAGTGATTCTCAATAGAGGTTGG - Intronic
973975177 4:56256082-56256104 CAGTAGTTCTCTACAGAGGATGG - Intronic
974017346 4:56659617-56659639 CAGTGCTTCTCAAGCCTGGATGG + Intronic
976776389 4:88710973-88710995 CAGTGGGTCTCAAGTGAAGCTGG + Intergenic
977560010 4:98522759-98522781 CAGTGACTCACAAAGGAGGAAGG + Intronic
978476522 4:109137455-109137477 CAGTGGATCTCAAGTGGAGAGGG - Intronic
981134689 4:141196560-141196582 CATTGTTTCTCAAGTCAGGAAGG + Intronic
981735833 4:147949409-147949431 CAGTGTTTCTCAACTGAGGATGG + Intronic
984419628 4:179503893-179503915 CAGTGGTTGACAAGAGTGGATGG - Intergenic
985545031 5:505149-505171 CAGAGGCTCTTAAGGGAGGGAGG + Intronic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986056180 5:4139084-4139106 CAGTGGTCATCAGGGCAGGAGGG - Intergenic
986597196 5:9436311-9436333 CTGTGGTTCTCCATGGGGGAGGG + Intronic
986599733 5:9459958-9459980 CAGTGGTTCTAAAGAAAGCAAGG + Intronic
987237738 5:15959976-15959998 TAATGGTGCTCAAGGGAGGGGGG - Intergenic
988963694 5:36393925-36393947 CAGTGGTTTTCAAGAGAAGAGGG - Intergenic
989375595 5:40756710-40756732 CAGTGGTTCTCAACGGGGCAGGG - Intergenic
989408338 5:41087514-41087536 CAATGCTTCTCAAAAGAGGAAGG + Intergenic
990596422 5:57316740-57316762 TAGTGGTTCTCAATGCAGGTGGG + Intergenic
990789499 5:59460996-59461018 CACTTGTCCTCAAGGCAGGATGG + Intronic
991525208 5:67548848-67548870 CAGTGATTCTTTAGTGAGGAGGG - Intergenic
992183732 5:74223278-74223300 CAGTGGTCCTCATTGGAGGTAGG - Intergenic
993053440 5:82952451-82952473 CAGTGGTTCTGAAGCAGGGATGG + Intergenic
993590807 5:89793271-89793293 CAGTGGTTACCAAGGGAGCAAGG + Intergenic
994091601 5:95814425-95814447 CAGTGATTTTCAAGGTGGGATGG + Exonic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
995704135 5:114968398-114968420 CAGTGGTTGTCAGGGGACGGTGG + Intergenic
995794712 5:115929185-115929207 CAGTAGTTCTCAACTGAGGTTGG - Intergenic
996202715 5:120696626-120696648 AAGTGGTTCTCTAGAGAAGATGG + Intergenic
997124226 5:131209760-131209782 CAGTGGTTTCCAAGAGATGAGGG + Intergenic
997258318 5:132446011-132446033 CAGGGGATTTCAAGGGAGGATGG + Intronic
997261079 5:132465888-132465910 CAGTGGTTTTTAAAGGGGGAGGG + Intronic
997448112 5:133957712-133957734 CACTGATTCTCAAAGCAGGAAGG + Intronic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
997838240 5:137214342-137214364 CATTGGTACTCTAGGGAGGTGGG - Intronic
998178413 5:139916561-139916583 CAGTGGTTGCCAGGGGATGAAGG - Intronic
998928418 5:147153729-147153751 CAGTGGTTACCAGGGGTGGAAGG + Intergenic
1000479217 5:161750903-161750925 CAGTGATTTTCAAGGTGGGATGG + Intergenic
1001044182 5:168358913-168358935 CAGTGGTTGCCTGGGGAGGAGGG - Intronic
1001454540 5:171850656-171850678 CAGTGGTTCTCAATGGGAGAGGG + Intergenic
1001535108 5:172492621-172492643 CAGTGGTTCTTCAGGAGGGAAGG - Intergenic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1004070517 6:12292869-12292891 CTGTGCTTCTCATGGGAGGGTGG + Intronic
1004164962 6:13249004-13249026 CTGTGGCTGGCAAGGGAGGACGG - Intronic
1005006092 6:21289125-21289147 CAGTGATTCTCAAGGGGGAGGGG - Intergenic
1005809432 6:29504987-29505009 CAGTGATTTTCAAGGGAGAGAGG - Intergenic
1006397210 6:33795315-33795337 CAGCAGTTCTCCAGGGAGGCGGG - Intronic
1007208116 6:40169369-40169391 CAGTGATTCTGAAGTGAGAATGG + Intergenic
1008129677 6:47706493-47706515 CAGTGGTTCTCAACTGGGGGAGG + Intronic
1010107747 6:72189079-72189101 TAGTGGGTCTCTAGGGATGATGG + Intronic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1010788090 6:80029153-80029175 CAGTGGTTGTCAGGGAAGGGAGG + Intronic
1011700089 6:89947918-89947940 CGGTATTTCTCAAGGGGGGAAGG + Intronic
1012249855 6:96968196-96968218 CAGTGATTCTCAATGGTGGATGG + Intronic
1012917331 6:105184481-105184503 CAGTGGTTCCCAGGGGAGAAAGG - Intergenic
1013126574 6:107190289-107190311 CATTGGTTCTCAAGGCAGAGAGG - Intronic
1013148385 6:107418235-107418257 CAGGGGTGCTCAAAAGAGGAAGG + Intronic
1013327033 6:109056630-109056652 CATAGCTTCTCAAGGGAGGCTGG - Intronic
1013788620 6:113811077-113811099 CACTGCTTCTCAAGTGAGAATGG + Intergenic
1014412019 6:121136376-121136398 CAGTGGTTCTCAAGTGGACATGG + Intronic
1015118342 6:129674317-129674339 CCTTGGTTTTCAAGGAAGGAAGG - Intronic
1015439175 6:133228017-133228039 CAGTGCTTCTTGAGGGAGGGAGG - Intergenic
1016919672 6:149279453-149279475 CAGTGGTTCTCAAGTGACTGGGG + Intronic
1017013861 6:150084280-150084302 CAGTAGTTCTAAAGGCAGGATGG + Intergenic
1017245667 6:152222044-152222066 ATGTGATTCTCAAGGGAGGGAGG - Intronic
1018377894 6:163231081-163231103 CAGGGGCTCTCAAGATAGGATGG + Intronic
1018722064 6:166580684-166580706 CAGTGGGTCCCCAGTGAGGACGG + Intronic
1019519632 7:1454832-1454854 CAGTGGCTCCCAAGGGTGGCGGG - Intronic
1022456914 7:30565483-30565505 CAGTGGTACCCAAGTGAGGAAGG - Intergenic
1022714262 7:32884124-32884146 CAGTGGATCACACAGGAGGAAGG + Intronic
1023125624 7:36951492-36951514 CAGTGGTTCTCAATCTAGGGTGG + Intronic
1024000445 7:45185809-45185831 CAGAGGCTCACAAGGCAGGAAGG + Intronic
1025254171 7:57372254-57372276 CAGAGGTTCTCAACCCAGGATGG - Intergenic
1027596384 7:80179406-80179428 CAGTGGTTCTGAAGCTATGATGG - Intronic
1029445955 7:100612863-100612885 CAACGGGTCCCAAGGGAGGAGGG - Exonic
1030889885 7:114986465-114986487 CAGTGATTCACAAGGAAGGAGGG - Intronic
1030982210 7:116199705-116199727 CAGTGGTTCTCAACTGAGGATGG + Intergenic
1031500873 7:122514482-122514504 CACTGTTTCTAAAGGGGGGAGGG - Intronic
1032433051 7:131878607-131878629 CAGTGGTTCTCAACAGGGGAAGG - Intergenic
1033655170 7:143368403-143368425 CATTGGTTCTCCATGGAGGAAGG - Intergenic
1034988244 7:155530923-155530945 CAGTGGTTCTCAACTGGGGATGG - Intronic
1035014418 7:155752657-155752679 CAGTGGTTCTCACAGGGCGATGG - Intronic
1035344692 7:158190496-158190518 CAGTGGTCCTGATGGGAGGTGGG + Intronic
1035476094 7:159145031-159145053 CGGGGGTTCTCGGGGGAGGAGGG - Intergenic
1037659685 8:20916100-20916122 CAGAGGTTCTTAATGGAGGGTGG - Intergenic
1040385771 8:46914150-46914172 CAGAGGTGCTGAGGGGAGGATGG - Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1040881997 8:52215830-52215852 CAGAGATACTCACGGGAGGAGGG - Intronic
1041334427 8:56764118-56764140 CAGAGGTTGTCAAGGGTTGAGGG - Intergenic
1041467470 8:58171327-58171349 CAGTGGGTGTCCAGGGATGAAGG - Intronic
1041789943 8:61683906-61683928 CAGTGGTTCTCAATAGAGTGAGG - Intronic
1044285771 8:90410953-90410975 TAGTGGTTCTCTAGGGGTGATGG + Intergenic
1045253074 8:100497421-100497443 GAGGGGTTTTGAAGGGAGGAGGG + Intergenic
1045474215 8:102539377-102539399 CAGGGGTTCTCAAGACAGAAAGG - Intergenic
1045691906 8:104767898-104767920 CAGTGGTAATCAATTGAGGATGG - Intronic
1047630959 8:126707678-126707700 CAGTGGTTATCAATGGAGTGAGG - Intergenic
1047640716 8:126818487-126818509 CAGTGGTTGTCAAGGGTTGTGGG - Intergenic
1047783529 8:128131349-128131371 CATTGGATCAAAAGGGAGGATGG - Intergenic
1047826649 8:128583395-128583417 GAGTGGTTTTTAAGGGGGGAGGG + Intergenic
1048036298 8:130680514-130680536 CAGTTATTCTCAAAGGGGGATGG - Intergenic
1049737227 8:144215514-144215536 AAGTGGTCCTCTAGGGAGGAGGG - Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1051895061 9:21977668-21977690 CAGTGGTTCTTAATGGGGGTGGG + Intronic
1052758987 9:32570252-32570274 CAGTGGGTTGCAGGGGAGGAGGG - Intronic
1054733610 9:68727794-68727816 CAGTGTGTCTCATGGAAGGAAGG + Intronic
1054921966 9:70552147-70552169 CAGTGGTTCTTAATGGAGCGTGG + Intronic
1055165291 9:73184775-73184797 CAATGGTTCTCCAGGGATGTGGG - Intergenic
1055324054 9:75110261-75110283 CAGTGGTTGTCAAGGGTTGGGGG - Intronic
1055358443 9:75462310-75462332 CAGAGCTTCTCCAGGGAGCAGGG - Intergenic
1056382983 9:86072180-86072202 CAGTGGTTGTACAGGCAGGAGGG + Intronic
1057106993 9:92428455-92428477 CAGTGGTTCTCAAGGTTTGGTGG - Intronic
1057374687 9:94509679-94509701 CAGTGGATCTCAAGAGCTGAAGG - Intergenic
1057995363 9:99818585-99818607 CAGTGCTTCTCGGGGTAGGAAGG - Intergenic
1058499852 9:105602384-105602406 TAGTGGTTCTCAAGGCAAGTGGG - Intronic
1058758463 9:108105670-108105692 CAGTGGTTCTCAATTTTGGATGG + Intergenic
1058778840 9:108312596-108312618 CAGTGATTCTCAACAGAGGGAGG - Intergenic
1059892735 9:118822153-118822175 TAGTGGTTGCCAAGGGATGAGGG - Intergenic
1059939875 9:119348136-119348158 CAGTAGTTATCAAGGGAGAATGG - Intronic
1060735907 9:126066470-126066492 CAGCACTTCTCAAGGGAGGGAGG + Intergenic
1062154314 9:135037963-135037985 CAGTGGTTTGCAAAGGAGGGCGG + Intergenic
1185825162 X:3242680-3242702 CAGTGGTTCTTATAGAAGGAAGG + Intergenic
1187077568 X:15950566-15950588 CAATGGTTCTAAATGGAGAAAGG - Intergenic
1187581020 X:20607417-20607439 CAGTGCTTCTCAAATGTGGAAGG + Intergenic
1189181655 X:39010443-39010465 CAGTGTTTGTCTAGGCAGGAAGG + Intergenic
1189852180 X:45188753-45188775 CAGTGGTTGCCAAGGGCTGAGGG - Intronic
1192009934 X:67258498-67258520 CAGAGGTTCTCAACTGAGGGTGG - Intergenic
1194675002 X:96783740-96783762 GAGTGATTCCCAAAGGAGGAAGG - Intronic
1194822053 X:98522005-98522027 CAGAAGATCTCAAAGGAGGATGG - Intergenic
1197895372 X:131307637-131307659 CAGTGGCTCTGACAGGAGGAGGG - Intronic
1200342643 X:155414823-155414845 CAGTGGTTGTCAAGGGCTGTAGG + Intergenic
1200760752 Y:7036715-7036737 CAGTAATTCTCAAGTGAGGCTGG - Intronic
1200988619 Y:9327901-9327923 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202119371 Y:21508291-21508313 CAGTACTTCTCCAGGGAGGGAGG - Intergenic
1202121823 Y:21531831-21531853 CAGTACTTCTCCAGGGAGGGAGG - Intronic
1202157183 Y:21897551-21897573 CAGTACTTCTCCAGGGAGGGAGG + Intronic
1202159629 Y:21921092-21921114 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202186076 Y:22186007-22186029 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202196735 Y:22305687-22305709 CAGTACTTCTCCAGGGAGGGAGG - Intergenic
1202205283 Y:22400389-22400411 CAGTACTTCTCCAGGGAGGGAGG - Intronic