ID: 901521610

View in Genome Browser
Species Human (GRCh38)
Location 1:9789114-9789136
Sequence GTGAACAATGCTGCTAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901521604_901521610 20 Left 901521604 1:9789071-9789093 CCCTGGTTAACAGACGCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG 0: 1
1: 0
2: 0
3: 18
4: 102
901521607_901521610 -7 Left 901521607 1:9789098-9789120 CCACCTTTTGGCCATTGTGAACA 0: 2
1: 35
2: 412
3: 1326
4: 3609
Right 901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG 0: 1
1: 0
2: 0
3: 18
4: 102
901521601_901521610 25 Left 901521601 1:9789066-9789088 CCATTCCCTGGTTAACAGACGCT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG 0: 1
1: 0
2: 0
3: 18
4: 102
901521605_901521610 19 Left 901521605 1:9789072-9789094 CCTGGTTAACAGACGCTGGGTTG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG 0: 1
1: 0
2: 0
3: 18
4: 102
901521608_901521610 -10 Left 901521608 1:9789101-9789123 CCTTTTGGCCATTGTGAACAATG 0: 3
1: 32
2: 491
3: 1230
4: 1902
Right 901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG 0: 1
1: 0
2: 0
3: 18
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901521610 Original CRISPR GTGAACAATGCTGCTAATGC TGG Intronic
900202649 1:1418021-1418043 CAGAACAAAGGTGCTAATGCAGG + Intergenic
901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG + Intronic
903005116 1:20293302-20293324 GTTACCAATGATGCGAATGCTGG + Intronic
903884434 1:26532620-26532642 GTGAGCAGGGCTGCCAATGCTGG + Intronic
906518622 1:46454147-46454169 ATGCACACTGCTGCTATTGCTGG + Intergenic
908042944 1:60134927-60134949 CTGAACAATTCTGGGAATGCAGG + Intergenic
908559847 1:65295292-65295314 GAGAACAATGCTGCTGAGGAGGG - Intronic
910905655 1:92175015-92175037 GTAATCAATGTTGTTAATGCTGG - Intronic
913548647 1:119895269-119895291 ATGAACAATACTGCCAATGTAGG - Exonic
915511124 1:156387700-156387722 GGGGACAATGCTGCTGAGGCAGG - Intergenic
916876324 1:168973384-168973406 GTGAACAATGCCTCTACTACTGG + Intergenic
917917376 1:179716104-179716126 GTGAATAATGCTGCAAATATGGG + Intergenic
1063164247 10:3445379-3445401 ATGAACAATGCTACCAGTGCAGG - Intergenic
1064136611 10:12756186-12756208 GGGAGCACTTCTGCTAATGCTGG - Intronic
1069698509 10:70405072-70405094 GTAAACAATGCTGTCAAAGCGGG - Intronic
1075783472 10:125032432-125032454 GTGAGCAATGCTCCTAATCAGGG + Intronic
1078473866 11:11613741-11613763 GTGGACCATGCTGTTTATGCTGG - Intronic
1082349271 11:51481555-51481577 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082351448 11:51512837-51512859 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082352795 11:51532396-51532418 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082386634 11:52024738-52024760 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082400506 11:52226348-52226370 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082403963 11:52276666-52276688 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082412915 11:52405722-52405744 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082447670 11:52908060-52908082 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082459127 11:53074684-53074706 GTGAACAATCCTGTTGATGGAGG + Intergenic
1082463957 11:53144384-53144406 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082467022 11:53188595-53188617 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082475374 11:53309526-53309548 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082520396 11:53959178-53959200 GTGAACAATCCTGCTGATGGAGG + Intergenic
1082543377 11:54291946-54291968 GTGAACAATCCTGCTGATGGAGG + Intergenic
1084395659 11:68908159-68908181 CTGTACGATGCTGCTAATGAGGG + Exonic
1087376807 11:97352902-97352924 GTGAACATTGCTGCCAATCTCGG + Intergenic
1091994935 12:4986122-4986144 GTGGACCATGCTGCTGATTCTGG - Intergenic
1093002448 12:14013049-14013071 GTGAACCATGCTGTAAATGCAGG + Intergenic
1099900631 12:88707046-88707068 GTAAACAATGATACTAACGCAGG - Intergenic
1100370570 12:93965489-93965511 GTGAACAATGATGATGATGATGG - Intergenic
1100416534 12:94383341-94383363 GTGAAAAATGCAGTTTATGCCGG + Intronic
1104845248 12:131843688-131843710 GTGAACAGTGCTGTGAAGGCTGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1110514004 13:76387063-76387085 GTCAAAGATGCTGCTGATGCTGG + Intergenic
1123980579 15:25598354-25598376 GTGAACACTGCTGCTAAGCATGG - Intergenic
1127831737 15:62757011-62757033 GTGAACTATGATGGTAATTCAGG - Intronic
1132863286 16:2081916-2081938 GAGAACAATGGTGCTGAGGCAGG - Intronic
1138235190 16:55376540-55376562 GTGAATGATGGTGCTAAAGCTGG + Intergenic
1138870248 16:60874602-60874624 AAGAATAATGCTGCAAATGCTGG - Intergenic
1139647935 16:68345612-68345634 ATGAGCAATGCTTCTAATCCAGG - Intronic
1140439113 16:74973261-74973283 ATGAACACTGCTGCCAAAGCTGG + Intronic
1144383119 17:14722685-14722707 GTGAACTATGCATCTAATGAAGG + Intergenic
1147174167 17:38641930-38641952 GAGAACTTTGCTGCTAATACTGG + Intergenic
1151283066 17:73090882-73090904 GTGATCAATGCTGCTCCTGTTGG - Intronic
1160213639 18:76906657-76906679 GTGACCAATGCTGTAATTGCGGG + Intronic
1168480819 19:56718326-56718348 GTGCAAAATGCTGGTAATACAGG - Intergenic
925420765 2:3709446-3709468 GTGAACAATGCTGGGGCTGCTGG - Intronic
927739230 2:25552551-25552573 GCGAGCATTGCTGCTAATGATGG - Intronic
930744937 2:54872651-54872673 GTTAAAAATGCTGCTAAGGAAGG - Intronic
933751865 2:85607853-85607875 GTGAACATTTTTTCTAATGCAGG - Exonic
935506274 2:103908060-103908082 GTGAAGGATGCTGATAATGGAGG - Intergenic
938771614 2:134505695-134505717 GGGAACAGTGGTGATAATGCCGG + Intronic
942838349 2:180328981-180329003 CTGCACCATGCTGCTACTGCTGG - Intergenic
944287345 2:197966593-197966615 TTGAACAATGCAGCTGCTGCAGG + Intronic
944470621 2:200049279-200049301 ATCAAGAATGCTGGTAATGCGGG - Intergenic
945082093 2:206096705-206096727 GTGGAGTCTGCTGCTAATGCTGG - Intergenic
946012208 2:216574304-216574326 CTGAGCAATCCTGCTAATGCAGG + Intronic
948755151 2:240155188-240155210 GTGAACAATGGATCTATTGCAGG - Intergenic
1169957399 20:11119841-11119863 GTGAACAATGTTGTCATTGCTGG - Intergenic
1172442148 20:34973373-34973395 GTGAATAATGCTTCTACAGCTGG - Intergenic
1174167702 20:48597042-48597064 GTGAACAATGCTTCCAACACAGG - Intergenic
1174669759 20:52296013-52296035 GTGAGCCATGGGGCTAATGCAGG - Intergenic
1181300116 22:21873906-21873928 GTGAATAATGCTGATGCTGCTGG - Intergenic
952285190 3:31961535-31961557 GTTAATAATGCTAATAATGCTGG + Intronic
953573541 3:44093568-44093590 ATGACCAATGCTGCCAATACAGG - Intergenic
957277879 3:78112515-78112537 GAGAACATTGCTGGAAATGCTGG - Intergenic
966553436 3:181230735-181230757 GTGAACAATACTGCTAAGCAGGG - Intergenic
966563872 3:181354111-181354133 GTGAATATTGCTGCTATTGTGGG - Intergenic
967990188 3:195124848-195124870 GTGAAAAACGCTGCCAGTGCCGG - Intronic
968639266 4:1703288-1703310 GTGCACAATGGTGTTACTGCTGG - Intronic
970557962 4:17254590-17254612 GTGCACAATGCTGCAACTGGGGG - Intergenic
971676840 4:29642364-29642386 GTGAACAATGCTACCAAATCTGG - Intergenic
977573784 4:98656972-98656994 GTAAACAATGCTCCAACTGCAGG - Intronic
978004053 4:103595174-103595196 CTGAACAATGGTACTAGTGCAGG + Intronic
979782548 4:124671247-124671269 GTGAACAAAGCTGATAATGAAGG - Exonic
981179738 4:141726433-141726455 ATGAACAAGGGTGATAATGCTGG + Intronic
982146877 4:152404224-152404246 GTGTATAATGCTCCTAATGGAGG - Intronic
984068529 4:175081952-175081974 GTGATAAATGCTGCTAGGGCTGG + Intergenic
987574425 5:19707173-19707195 TTGAGCAATGCTGCCAATGATGG - Intronic
989451513 5:41591957-41591979 GAGAACAAAGCTGCTAATGATGG - Intergenic
990039325 5:51360494-51360516 GTGAGCAAAGATGCTAATGAAGG - Intergenic
991184498 5:63791620-63791642 GTGAACACTGGTTCTAATCCAGG - Intergenic
995713969 5:115063507-115063529 GGGAACAATGCTGGTTAGGCTGG + Intergenic
995798735 5:115968640-115968662 GTGGACAGTCCTTCTAATGCAGG + Intronic
1000474332 5:161686503-161686525 TTGAACAAGGCTACTAATGGTGG - Intronic
1003772082 6:9316722-9316744 GTCAGCAATCCTGCAAATGCAGG - Intergenic
1004315743 6:14585822-14585844 GAGAACATTGCTGGTACTGCTGG - Intergenic
1004478212 6:15994021-15994043 GTGAAAAATGCTGAGAAGGCCGG + Intergenic
1006609656 6:35286538-35286560 GTGGGCAAGGCTGCTAATCCAGG - Intronic
1007105811 6:39282222-39282244 GGGCACAATGGTGCTAGTGCTGG + Intergenic
1009039375 6:58158509-58158531 GTGATAAATGCTGCTAAGACTGG + Intergenic
1009215271 6:60913352-60913374 GTGATAAATGCTGCTAAGACTGG + Intergenic
1013405256 6:109837661-109837683 GGGCACAAAGCTGCTAAGGCTGG + Intergenic
1017145341 6:151229718-151229740 GGTAACAATGCTGCTCAGGCTGG + Intergenic
1020911438 7:14136677-14136699 CTGAACAGAGCTGCTAATGAAGG - Intergenic
1021815423 7:24442574-24442596 CTGAACAATTCTGCTGATGTGGG - Intergenic
1030113877 7:106048889-106048911 GTGCACACTGTAGCTAATGCAGG + Intergenic
1031472314 7:122181885-122181907 CTGCACCATGCTGCCAATGCTGG - Intergenic
1031592033 7:123604927-123604949 GTTAACCAGGCAGCTAATGCAGG + Intronic
1040815892 8:51508384-51508406 TTGATCATTGCTGCTAAAGCTGG + Intronic
1043513532 8:80974873-80974895 GTGAACAAGTTTCCTAATGCTGG + Exonic
1049029845 8:140026285-140026307 GTGAACAGTGCTGCTATGGTTGG + Intronic
1052041458 9:23743616-23743638 CTGACCATTGCTGCTAATTCTGG + Intronic
1056212146 9:84374691-84374713 GATTAAAATGCTGCTAATGCTGG + Intergenic
1058902769 9:109456586-109456608 GGGAACAATGCTGGCAATGTTGG + Intronic
1186370512 X:8941939-8941961 GTAAATAATGCTGCTCCTGCTGG + Intergenic
1187083814 X:16020973-16020995 GTTGACAATGATGCTAATGATGG + Intergenic
1188715515 X:33455664-33455686 GTGCACCATGCTGCCAATGCCGG - Intergenic
1193981540 X:88187168-88187190 CTGCACCATGCTGCTACTGCTGG - Intergenic
1197068792 X:122267733-122267755 GTGCACCATGCTGCTCCTGCTGG + Intergenic
1197536016 X:127690187-127690209 CTGCACAATGCTGCCACTGCTGG + Intergenic
1200181035 X:154150860-154150882 GTTCACAATGCTGATAGTGCTGG - Exonic
1201487754 Y:14510215-14510237 GTGAACCATTCTGCTTCTGCTGG - Intergenic
1201624203 Y:15996226-15996248 GTGAATAATGTTGCTAATCAAGG - Intergenic