ID: 901522609

View in Genome Browser
Species Human (GRCh38)
Location 1:9796863-9796885
Sequence CAGAATGAACAGATGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901522606_901522609 9 Left 901522606 1:9796831-9796853 CCATTACATCAAATTTGAAAATA 0: 1
1: 0
2: 3
3: 71
4: 624
Right 901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG 0: 1
1: 0
2: 0
3: 44
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901522609 Original CRISPR CAGAATGAACAGATGGAATG TGG Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
902063691 1:13666301-13666323 CATAATGAAGAGCAGGAATGGGG + Intergenic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
903561320 1:24230223-24230245 AAGATTTAACACATGGAATGAGG + Intergenic
905318211 1:37097038-37097060 CAGGGAGAACAGATAGAATGTGG + Intergenic
905845727 1:41229840-41229862 CAGAATTAACAGAGTGACTGTGG + Intronic
906048984 1:42855164-42855186 AAGAAAGAGTAGATGGAATGAGG - Intergenic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
907582602 1:55585355-55585377 TAGGATGAACTGATAGAATGTGG - Intergenic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
909085376 1:71164514-71164536 CAGATTGCACACATGAAATGAGG - Intergenic
909559732 1:76996697-76996719 CAGTATGTACAGTTGGAAGGAGG + Intronic
909589516 1:77330122-77330144 AAAAATGAAGAGAGGGAATGAGG + Intronic
910165134 1:84319680-84319702 TAGAATGTACAGATAGAAAGAGG + Intronic
911095905 1:94054842-94054864 CAGAATGGACTGATGGGAGGTGG + Intronic
911109778 1:94170520-94170542 CAAAATCAGCAGATTGAATGTGG + Intronic
912440772 1:109695882-109695904 AAGAATGAACAAATGAACTGTGG + Intronic
912769025 1:112445342-112445364 AAGAATGAAGAGATTTAATGGGG - Intronic
913088920 1:115463106-115463128 CAGAAGGAAAAGATGGAAAGAGG + Intergenic
913218231 1:116638512-116638534 CAGACTGAGTAGGTGGAATGGGG - Intronic
914322520 1:146578870-146578892 AAGAGTGCACAGGTGGAATGTGG - Intergenic
915726183 1:158019335-158019357 CAGAAGGACCAGATGGATTCTGG + Intronic
915894250 1:159799083-159799105 TAGAATGGAGAGAGGGAATGAGG + Intergenic
917174713 1:172220715-172220737 CAGAATGACCAGGTGGAATTTGG + Intronic
917961496 1:180149170-180149192 CGGAATGAATAGGTGGAATACGG - Intergenic
919518032 1:198551063-198551085 CAGAGTGAAATGATGGTATGTGG + Intergenic
919969798 1:202567859-202567881 CAGAAAGAAGAGATGAAATGGGG - Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
920793517 1:209115497-209115519 CAGGATGATCAGATAGCATGGGG + Intergenic
923302517 1:232655093-232655115 CAGAATCAGCAGATGGGCTGGGG - Intergenic
1063209030 10:3862032-3862054 CACCATGCCCAGATGGAATGTGG - Intergenic
1063572031 10:7224356-7224378 CAGAATTTACACATGGAATCTGG + Intronic
1065278383 10:24109526-24109548 AAAAATGAACAGATGGAAACTGG + Intronic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1069005969 10:63317776-63317798 CAGATAGAATAGATGGGATGGGG - Intronic
1069010499 10:63366579-63366601 CTGAATGAAGAGAAAGAATGAGG + Intronic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1072856197 10:98949526-98949548 CAGAGTTTACAGATGGAATCAGG + Intronic
1073110323 10:101059507-101059529 CAGAATGATGAGCTGGAGTGTGG - Intergenic
1075157215 10:119988368-119988390 CAGTAGGAATAGAAGGAATGGGG + Intergenic
1075896785 10:126003044-126003066 GAGAATGGCCAGATGAAATGTGG - Intronic
1076001485 10:126916645-126916667 AAGAAAGGACAGAAGGAATGAGG - Intronic
1076676756 10:132151094-132151116 GAGAATGAATAGATGGATTATGG - Intronic
1079383209 11:19957130-19957152 CAGACTTAAAAGATGCAATGAGG + Intronic
1079897676 11:26142482-26142504 AAAGATGAACAGATGGAATGAGG + Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081325079 11:41734688-41734710 CAGGAAGCACAGCTGGAATGGGG + Intergenic
1082193405 11:49273772-49273794 GAGAATGAACAAATAGACTGGGG + Intergenic
1083122055 11:60522503-60522525 CACTTCGAACAGATGGAATGAGG + Intronic
1084906070 11:72348629-72348651 CAGAATTAACAGCTGTCATGGGG - Intronic
1085008739 11:73120016-73120038 CAGAAGGCAAAGAGGGAATGAGG + Intronic
1085303558 11:75472721-75472743 CTGAATGAACAACTGGAAGGAGG - Intronic
1086593841 11:88547619-88547641 CAGTCTGAAAAGATGGAATCAGG - Intronic
1087623211 11:100565966-100565988 CAGAATGAAGAGATAGAAAAAGG - Intergenic
1087990004 11:104737615-104737637 CAGAATGAACAAGTTGGATGTGG + Intergenic
1088790364 11:113220311-113220333 GAGAATGCACAGATGGTATGTGG - Intronic
1089568109 11:119383091-119383113 TAAAATGAAGTGATGGAATGAGG - Intergenic
1089826796 11:121284943-121284965 CTGAATGCAAAGATGGAACGAGG + Intergenic
1090491923 11:127171548-127171570 CAACATGAACAGATGAAGTGAGG - Intergenic
1090728982 11:129553486-129553508 CAGAGTGAAGTCATGGAATGGGG + Intergenic
1092019414 12:5188345-5188367 AAGAAAGAGCAGATGGGATGTGG - Intergenic
1092469452 12:8764959-8764981 CAGGAGGAGCAGGTGGAATGGGG - Intronic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1095172050 12:39047626-39047648 AAGAATGAGAGGATGGAATGGGG - Intergenic
1096739839 12:53684982-53685004 CAGAATGAACAGTTGTGGTGTGG + Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097080298 12:56425484-56425506 CAGAATAAGCAGATGCTATGAGG + Intronic
1097502063 12:60416107-60416129 CAGAAAGAACACATGGTATGGGG + Intergenic
1098631978 12:72734556-72734578 CTGAATGAAAATATGGACTGTGG - Intergenic
1098860603 12:75705849-75705871 CAGAATGGGGAAATGGAATGAGG - Intergenic
1099100295 12:78431556-78431578 CAGAATGAACTGATGGAAATGGG - Intergenic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1101356660 12:103984933-103984955 CAAAATGAATAAAAGGAATGAGG - Intronic
1102593552 12:113975294-113975316 CAGAAGGGACAGAAGGATTGGGG - Intergenic
1102952602 12:117040547-117040569 CAGAATGAAGAGCTAGAAGGTGG - Intronic
1103038218 12:117673441-117673463 AAGGATGGACAGATGGAAAGAGG + Intronic
1103862972 12:124028932-124028954 CAGAAGGAGCATATGGAATTTGG - Intronic
1104769291 12:131350942-131350964 CAGAAAGAAGATGTGGAATGTGG + Intergenic
1106170857 13:27286714-27286736 CAGAGAGAACAGACGGGATGAGG + Intergenic
1106182288 13:27380160-27380182 CACAATCATCAGAAGGAATGTGG - Intergenic
1106988315 13:35383380-35383402 GAGAGTGAACAGATGGAATAGGG + Intronic
1108331403 13:49388598-49388620 CAAAAAGATGAGATGGAATGAGG + Intronic
1108367313 13:49728814-49728836 CAGAATGAACAGAAACATTGTGG - Intronic
1109651544 13:65333783-65333805 CAGAAAGAACAGATTCAATAGGG + Intergenic
1109694510 13:65935639-65935661 CATAATGAATAAATGCAATGTGG + Intergenic
1110268289 13:73564691-73564713 GAGTATGAACAAATGGTATGAGG + Intergenic
1112403029 13:99092547-99092569 CAGAAAGAAGAGGAGGAATGGGG + Intergenic
1113265866 13:108617369-108617391 CAGAATGCATAGAAGGAATGAGG - Intronic
1114916827 14:27278554-27278576 CAGAACTAACAGAATGAATGAGG - Intergenic
1115384263 14:32777430-32777452 CTGCTTGAACATATGGAATGCGG - Intronic
1115515163 14:34177775-34177797 AAGGATGCAAAGATGGAATGTGG + Intronic
1116145687 14:41065328-41065350 TAAAATGAAAAAATGGAATGGGG - Intergenic
1118564562 14:67125204-67125226 TAGAATGCAGAGGTGGAATGTGG + Intronic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1120969448 14:90195188-90195210 GAGAATGAACAGATCGTATCTGG + Intergenic
1121602219 14:95213766-95213788 CAGGATGAGCAGAAGCAATGGGG - Intronic
1121637708 14:95465100-95465122 GAGAATGGACAGAGGGACTGGGG + Intronic
1121925703 14:97925505-97925527 CAGAATGAACAGATGGGTAATGG - Intergenic
1121926428 14:97931336-97931358 CTCAATGAACAGGTGGAATTTGG + Intronic
1122278878 14:100609824-100609846 CAGAAGGCACAGAGGGGATGAGG + Intergenic
1123100374 14:105793619-105793641 CAGAATGAGCAGATAAAAAGAGG + Intergenic
1123140366 14:106071681-106071703 ACGAATGAACAGATAAAATGTGG + Intergenic
1123158149 14:106250580-106250602 ATGAATGAACAGATAAAATGTGG + Intergenic
1125208444 15:37182322-37182344 GGGAATGAACAGAAGGGATGTGG + Intergenic
1126057757 15:44747780-44747802 GAGAATGTAGACATGGAATGAGG + Intronic
1126114028 15:45192695-45192717 CATAACAAACAGATGAAATGGGG - Intronic
1126182135 15:45795732-45795754 CAGAAGCAAGAGATGAAATGAGG + Intergenic
1127523874 15:59772994-59773016 CAGAATGAAGAGGTTGAATGAGG - Intergenic
1127709706 15:61584115-61584137 AAAAATCAACAGAGGGAATGTGG + Intergenic
1128512235 15:68320413-68320435 GAGACTGGGCAGATGGAATGAGG + Intronic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1128903702 15:71448985-71449007 GAGAATGAACAGAAGGCAAGGGG - Intronic
1129898436 15:79126334-79126356 CAGAATTAATAGGTGAAATGTGG - Intergenic
1131035228 15:89217759-89217781 CAGAGTGAAATGATGGAAAGAGG - Intronic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132022035 15:98371120-98371142 CAGAATGGGCAGTGGGAATGAGG - Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1135862171 16:26066551-26066573 GAGAATGAGTAGATGGAAAGAGG - Intronic
1136094258 16:27943343-27943365 TAGAATGAACAAATAGAAGGTGG + Intronic
1136869158 16:33788661-33788683 ATGAATGAACAGATAAAATGTGG - Intergenic
1138362051 16:56439063-56439085 GAGAATGAAGCGGTGGAATGAGG + Intronic
1138528290 16:57621136-57621158 CCTAATTAACAGAGGGAATGTGG - Intronic
1139179539 16:64729704-64729726 TAGAATGAACAGATGTCTTGAGG + Intergenic
1140011103 16:71132305-71132327 AAGAGTGCACAGGTGGAATGTGG + Intronic
1140340630 16:74156221-74156243 GAGAATGAAAACAGGGAATGGGG + Intergenic
1140786850 16:78350677-78350699 CTGAATGCATAGATGAAATGTGG - Intronic
1203103015 16_KI270728v1_random:1327407-1327429 ATGAATGAACAGATAAAATGTGG + Intergenic
1142942247 17:3390293-3390315 AAAAATGAGCAAATGGAATGTGG + Intergenic
1143396451 17:6602381-6602403 GAGAATGAACAAACAGAATGTGG + Intronic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1143967991 17:10770647-10770669 CAGAATGGAAAGATGGATTCGGG - Intergenic
1145828915 17:27899082-27899104 TAGAATGAACAGGTGGAAAGGGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1149557981 17:57587813-57587835 CATTATTAAGAGATGGAATGGGG + Intronic
1150709380 17:67517108-67517130 CATAATGAAAAGATGCCATGTGG + Intronic
1150768722 17:68023556-68023578 GAGAATGAATAGGTGGAATAAGG - Intergenic
1150920605 17:69478270-69478292 CTGAATGAGCTGAGGGAATGGGG - Intronic
1152401926 17:80071515-80071537 CAAAAAGAACGGATGGAATCTGG - Intronic
1153971420 18:10230410-10230432 CAGAATGGATAACTGGAATGGGG + Intergenic
1154144172 18:11852421-11852443 CAGAATGATCAGATTGAAGGTGG + Exonic
1155825644 18:30439341-30439363 AGGGAGGAACAGATGGAATGAGG - Intergenic
1160553622 18:79712166-79712188 CAGAATGATAGGATCGAATGGGG + Intronic
1162548743 19:11346613-11346635 GAGCATGAACAGGTGGTATGTGG + Exonic
1163945853 19:20533348-20533370 CAGAATAAAGACATTGAATGTGG - Intergenic
1164163222 19:22644602-22644624 CAGAATGGATAGATAAAATGTGG - Intronic
1164322958 19:24167204-24167226 CTGAATGAGAAGATGGAACGAGG - Intergenic
1165831298 19:38731813-38731835 GAGAATGAACACACAGAATGGGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165964026 19:39559492-39559514 CAGATGGAAATGATGGAATGAGG - Intergenic
1165995998 19:39844610-39844632 CAGAACCAACAGATTGTATGTGG - Intronic
1167024228 19:46903210-46903232 CAGAATGAAGAGAGGGTTTGGGG - Intergenic
925584306 2:5447976-5447998 CAAATTGCAGAGATGGAATGAGG - Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
929647169 2:43638831-43638853 CAGAATGAAATGAGGGAATCAGG + Intronic
931121375 2:59223966-59223988 CAGAATTCACAGATGGTAAGTGG - Intergenic
931710397 2:64985197-64985219 CAGACTCAATAGATGCAATGTGG + Intergenic
932609341 2:73187296-73187318 CAGCAAGGACAAATGGAATGAGG + Intergenic
932688694 2:73894476-73894498 CAGAATGAACAAGGGGAAAGAGG - Intronic
933291056 2:80438735-80438757 CTAAAGGAACAGATGGAATGAGG - Intronic
933308926 2:80636633-80636655 CAAAATGAATAGCTGGAATTTGG + Intronic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
938127402 2:128684555-128684577 CAGAATCAACACATAGAAAGGGG - Intergenic
938966128 2:136390155-136390177 CAAAAAGAACAGAAGAAATGAGG - Intergenic
938995269 2:136671812-136671834 CAGAATGAAGAGAAGTCATGGGG + Intergenic
940026195 2:149211043-149211065 CAGAAGGCAAAGAGGGAATGAGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941504276 2:166321600-166321622 AAGAAAGAAGAGTTGGAATGAGG + Intronic
941830738 2:169955897-169955919 TAGAATAAACACATGGACTGGGG - Intronic
942781932 2:179654074-179654096 CAGAATCAACGGATGGATTTAGG + Intronic
942927112 2:181447118-181447140 CAGATGGAAGAGTTGGAATGGGG - Intergenic
944477479 2:200122367-200122389 CAGAATCAAAAAATGGAATGAGG - Intergenic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945318173 2:208392829-208392851 CAGACTGAGCCGCTGGAATGGGG + Intronic
945856830 2:215079175-215079197 CAGGAAGAAAAGATGGTATGAGG - Intronic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
1169181464 20:3572404-3572426 CAGGATGAAAGGATGGAATTTGG + Intronic
1169833115 20:9847200-9847222 CAGAAGGAACGGAGTGAATGGGG - Intergenic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1169976423 20:11333688-11333710 GAGAAAGAGCAGAGGGAATGGGG + Intergenic
1170351260 20:15444281-15444303 CTGAATGAACAGACAAAATGTGG - Intronic
1171041756 20:21770640-21770662 CAGAGTGAACAGATGACATACGG - Intergenic
1171415327 20:24975377-24975399 AACAATGAACAAATGGAATTTGG + Intronic
1171960449 20:31490101-31490123 CAGAGTGGAAAGATGGAAAGAGG - Intergenic
1172780050 20:37431261-37431283 CAGGAAGAACAGATGGGCTGTGG - Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173094824 20:40015409-40015431 CAGTCTGAACAGATGAAAGGGGG + Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1174721764 20:52820331-52820353 CAGAAGAAACAGCAGGAATGGGG + Intergenic
1175376659 20:58531477-58531499 CAGAATGAGAAGACAGAATGAGG - Intergenic
1177209838 21:18057438-18057460 CAGAATGTTGATATGGAATGAGG - Intronic
1178333762 21:31725771-31725793 CTGAATGAAAAAGTGGAATGAGG + Intronic
1178831564 21:36060840-36060862 CAGAATGAAACGGTGGAATGGGG - Intronic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1182664777 22:31949648-31949670 AAGAATGTACACATGGAAGGTGG - Intronic
1182919699 22:34067916-34067938 CAGAATGAAAGGATAGAAAGCGG - Intergenic
1183160437 22:36109692-36109714 CAGAATGATCAGAAGGGACGTGG - Intergenic
1183887375 22:40895786-40895808 CAGAATTAACTCATGGGATGTGG - Intronic
949134971 3:553712-553734 AAGAATGAACTGATACAATGGGG - Intergenic
950099180 3:10346676-10346698 CAGAATGAACAAATGACATGTGG + Intronic
950246630 3:11425991-11426013 TAGAATGAACAAATGGATTGTGG - Intronic
950763387 3:15254993-15255015 CAGAATTAACAGTTTGAAAGAGG + Exonic
951079443 3:18434910-18434932 CAGATGTAACAGATGGAATCTGG - Intronic
951152310 3:19305840-19305862 CAAAACGAAGAGATGGAAAGAGG + Intronic
951474906 3:23094478-23094500 CAGAATGAGGGGATGGGATGGGG + Intergenic
951819696 3:26794411-26794433 CAGAAAGGAAAGATGGAAGGAGG + Intergenic
952225807 3:31374596-31374618 CAGATTGAACAAATGCTATGAGG - Intergenic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
953476757 3:43211875-43211897 CAGAAGGTACAGGTGGAAGGCGG + Intergenic
953485316 3:43289112-43289134 CAGTACGAACAGATGAACTGTGG + Intronic
954388924 3:50258847-50258869 GAGAATGAGCAGGTGGACTGTGG - Exonic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
956558360 3:70545648-70545670 CACAATGAACAGACAGCATGAGG + Intergenic
957496635 3:81000066-81000088 CTGTATGAGCAGATTGAATGAGG - Intergenic
957731367 3:84141685-84141707 AAGAATGAATAGTAGGAATGAGG + Intergenic
958587667 3:96111255-96111277 ACGAATGAACACATGGAATGTGG - Intergenic
960163411 3:114375129-114375151 CAGAATGAACGGATAGCACGAGG + Intronic
960358179 3:116678775-116678797 CAGGATGGAGAGCTGGAATGGGG - Intronic
961725154 3:128923269-128923291 CTGAATGCGAAGATGGAATGAGG + Intronic
961802962 3:129466905-129466927 CTGGATGAACAGAGAGAATGAGG + Exonic
962926278 3:139996297-139996319 CAGAATGAACAAATAAAATGAGG - Intronic
963616440 3:147544331-147544353 CAGAAAGAACATCTGTAATGTGG + Intergenic
963965326 3:151362354-151362376 CACAATAAACAGAGGGAAAGGGG - Intronic
965865453 3:173199622-173199644 TAGATAGAACAGCTGGAATGTGG + Intergenic
965906577 3:173714981-173715003 CATAAAGAGCAGATGGAAGGAGG + Intronic
967124409 3:186411414-186411436 GAGAATTAATAGATGTAATGAGG + Intergenic
967945973 3:194804554-194804576 CGGAATGTAGAGATGGAAGGTGG + Intergenic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
972884739 4:43471624-43471646 CTGAATGCGAAGATGGAATGAGG + Intergenic
975483249 4:74905393-74905415 CAGAAGGAAGAGGAGGAATGGGG + Intergenic
976784055 4:88797731-88797753 CAGAAAGAACAGCTGAAATGAGG - Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
979785344 4:124710909-124710931 CAGAATTAACACTTGGAATCTGG - Exonic
980171355 4:129293986-129294008 AAGAATGAATATATGGAGTGTGG + Intergenic
980493035 4:133554054-133554076 AAGAATGTACAGATTGAAAGTGG - Intergenic
980773131 4:137404597-137404619 CACAATTAAGAGATGGAATTGGG - Intergenic
981763301 4:148217587-148217609 CAAAAAGAAAAGATGGAAAGAGG - Intronic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982650236 4:158079416-158079438 CATATTGAACATATGGAATATGG + Intergenic
984479856 4:180286240-180286262 CAAAATGAAGAGATCGAATTGGG - Intergenic
984835895 4:184020665-184020687 CATAATGAACATATGAAAGGGGG + Exonic
984938401 4:184909880-184909902 CTGAATGCAAAGAAGGAATGAGG - Intergenic
985822321 5:2168808-2168830 CATAAAGAACAGATGGAGTGTGG - Intergenic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
986821412 5:11470646-11470668 CAGGATGAATAAATGCAATGTGG - Intronic
987254518 5:16136814-16136836 CAGAAAGAAAGGATGGAAGGTGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
987543320 5:19283126-19283148 CAGAAGGCAAAGAGGGAATGAGG + Intergenic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
988933470 5:36059996-36060018 CTGAATGTGAAGATGGAATGAGG + Intronic
988943877 5:36174686-36174708 CAGAGTAACCAGATAGAATGTGG + Intronic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989645329 5:43625311-43625333 CAGAATCAACAGCTAGAATATGG + Intronic
990208388 5:53454722-53454744 AAGAATGAACAAATTGAATCTGG + Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
991897199 5:71416048-71416070 TAAAAGGAACAGATGGAGTGCGG + Intergenic
992307997 5:75463595-75463617 CAAAATTCACAGTTGGAATGTGG + Intronic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
995450139 5:112291320-112291342 CAGGAGGAACAGCTGGCATGGGG - Intronic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996795398 5:127341151-127341173 CAGAATGAACTGGTGAAGTGGGG - Intronic
997269651 5:132526129-132526151 CAGAATGAATGGATGGAGGGAGG - Intergenic
997662478 5:135600095-135600117 CAGCATGAAAAGCTGTAATGAGG - Intergenic
1001509459 5:172309114-172309136 GAGAATGAGCAGAAGGAATATGG + Intergenic
1002708179 5:181177385-181177407 CAGAATGAACTGCTGGCATTTGG - Intergenic
1003047644 6:2748622-2748644 AAGAACGAGCAGCTGGAATGGGG + Intronic
1004801219 6:19150586-19150608 CAGAATGGGGTGATGGAATGTGG + Intergenic
1005693910 6:28333900-28333922 GAGAATGAGCTGAGGGAATGAGG + Intronic
1006248188 6:32758395-32758417 CAGAAGGAAAAGAGGGAGTGAGG - Intronic
1006960962 6:37929578-37929600 CTGTATGAAAAGAGGGAATGTGG + Intronic
1010123160 6:72403219-72403241 CAGAAGAAAAAGATGGAAAGAGG - Intergenic
1011907656 6:92392306-92392328 CAGAATGTAGGGATGGAGTGGGG - Intergenic
1012006765 6:93722278-93722300 CAAAATCAAAAGATGTAATGAGG + Intergenic
1012865263 6:104611160-104611182 CACAATAAACAGATTGTATGTGG + Intergenic
1013902338 6:115172188-115172210 AAGAAAGAAGAGAGGGAATGGGG + Intergenic
1014906290 6:127032866-127032888 CAATATCAACGGATGGAATGGGG - Intergenic
1014953568 6:127588639-127588661 CCTAATGATCAGATAGAATGTGG - Intronic
1015037364 6:128672361-128672383 TAGAGTGGACAGATGGCATGGGG + Intergenic
1015243704 6:131054073-131054095 CTGAATGCGAAGATGGAATGAGG - Intronic
1015891922 6:137978047-137978069 CAGACCTCACAGATGGAATGAGG + Intergenic
1019230369 6:170555349-170555371 CAGTATGAACAGATCTAATTTGG - Intronic
1020873521 7:13664950-13664972 CAGAAGGGACAAAAGGAATGGGG - Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022048517 7:26643200-26643222 CAGCAGGAACAGACGGAGTGGGG - Intronic
1022144908 7:27527469-27527491 CAGAATGAACAAACGTCATGGGG + Intronic
1022322341 7:29298691-29298713 CAGAAGGAACAAAAGGGATGAGG - Intronic
1022454335 7:30545395-30545417 CTGAATGAGAAGATGGAACGAGG + Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023766359 7:43514593-43514615 AAGAATGAAGATATGAAATGTGG - Intronic
1026409900 7:70109421-70109443 CAGAATGAACAGATTGCATTTGG - Intronic
1028847764 7:95501478-95501500 TAAGATGAAAAGATGGAATGCGG - Intronic
1030333189 7:108295101-108295123 CAAAATCAACAGATTTAATGAGG - Intronic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1031102886 7:117504313-117504335 CAGAATCAACAGAAGGGATTTGG - Exonic
1031821528 7:126507940-126507962 CGAAATGAACAGAGGGGATGGGG - Intronic
1032176306 7:129630236-129630258 TAGAGTGAACAAATGGAATGTGG + Intronic
1032616496 7:133478007-133478029 CAGAATGCCCAGATGGAATCAGG + Intronic
1032896887 7:136261354-136261376 CTGAATGCAAAGATGGAACGAGG - Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1034431287 7:151042461-151042483 CAGACTGAACAGAAGAAATGGGG + Intronic
1036386352 8:8285180-8285202 CATGATGAAGAGAAGGAATGGGG - Intergenic
1037765986 8:21772584-21772606 CAGAGTCAACAGAGGCAATGAGG + Intronic
1038495816 8:28001549-28001571 CAGGATGAACAGAAAGATTGAGG + Intergenic
1038567124 8:28628995-28629017 CAGAATGAGAAGCTGGAAGGTGG + Intronic
1038896889 8:31793886-31793908 AAGAATGGAGAGATGGAAGGAGG - Intronic
1041878954 8:62724755-62724777 AAGAATGAATAAAGGGAATGTGG - Intronic
1042694307 8:71539478-71539500 CAGAATGGGCAGGTGGCATGAGG + Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1043375759 8:79647576-79647598 TAGTGTCAACAGATGGAATGGGG - Intronic
1043477588 8:80620217-80620239 CATAATAAACAAATGGAATTTGG - Intergenic
1044357749 8:91244385-91244407 AAGAATGAAAAGAGGGAAAGAGG - Intronic
1044666634 8:94639959-94639981 AAGCATGAGCAGAGGGAATGGGG + Intergenic
1044681712 8:94785667-94785689 CAGAAAGAACAGATTGAAGCAGG + Intronic
1045746554 8:105429577-105429599 CAGAATGCACAGATTAAATGAGG - Intronic
1047009077 8:120651670-120651692 CATAATGAACATATGGAAGGAGG + Intronic
1047019758 8:120762415-120762437 CAGAATGAAAAGCAGGACTGGGG + Intronic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048342123 8:133548316-133548338 TAGAAAGTACAGAGGGAATGGGG - Intronic
1048651728 8:136485557-136485579 CAGAAGGAAGCGATGGAAGGAGG + Intergenic
1051025444 9:12605110-12605132 CAGATTGAACAGGAGAAATGTGG + Intergenic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1051737558 9:20217082-20217104 TAGAATGAATAAATGGATTGTGG + Intergenic
1051960532 9:22756561-22756583 CAGATGGAAGAGATGGAAAGAGG - Intergenic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1053225360 9:36350502-36350524 GAGAATCAACAGATGGTCTGTGG - Intronic
1053401361 9:37826623-37826645 GAGAATGCACAGGTGAAATGTGG + Intronic
1053545111 9:39014694-39014716 CAGCATGAAGCGATTGAATGAGG + Intergenic
1053809510 9:41837887-41837909 CAGCATGAAGCGATTGAATGAGG + Intergenic
1054621082 9:67349541-67349563 CAGCATGAAGCGATTGAATGAGG - Intergenic
1056620450 9:88208351-88208373 CAGAATGAACAAGTGCATTGTGG + Intergenic
1057283528 9:93729436-93729458 CAGAATGAACTGATGGGACAGGG - Intergenic
1057332824 9:94131568-94131590 CAGAATGAATAAATGTAATGTGG + Intergenic
1058373277 9:104294454-104294476 GAAAAGGAACAAATGGAATGTGG + Intergenic
1058535852 9:105959212-105959234 CAAAATGAATAGATGAGATGTGG + Intergenic
1060004721 9:119989849-119989871 AAGAATGAACAGAAAGTATGAGG + Intergenic
1061911843 9:133729177-133729199 CATGATGAACGGATGGAAAGAGG + Intronic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062647831 9:137558459-137558481 GAGGATGAACAGACAGAATGTGG + Intronic
1185534139 X:846250-846272 CAGGATGAACTGCTTGAATGTGG - Intergenic
1187847895 X:23559930-23559952 CAGATTGAACATATCCAATGGGG - Intergenic
1188643453 X:32535284-32535306 CAGAAAGTACAGAAGAAATGTGG - Intronic
1189130581 X:38494080-38494102 CCTAATGAACAGATTAAATGTGG + Intronic
1189567972 X:42263307-42263329 CAGAATGAACACATATAAAGAGG - Intergenic
1190025017 X:46914025-46914047 CAGACTGAACACAGGGAATGAGG - Intronic
1190087582 X:47409241-47409263 CTGCATGAACAGCTGGGATGAGG - Intronic
1190597303 X:52062395-52062417 CAGAATGTACTGATGGTATCTGG + Exonic
1190611521 X:52191678-52191700 CAGAATGTACTGATGGTATCTGG - Exonic
1191707366 X:64107797-64107819 CTGGATAAACACATGGAATGTGG - Intergenic
1193289479 X:79754637-79754659 CAAAATGAACAAAAGGAAAGAGG - Intergenic
1194151819 X:90335119-90335141 CAGAAGCAACAGATGTATTGTGG + Intergenic
1194714969 X:97277541-97277563 CAGTCTGTACAGCTGGAATGTGG - Intronic
1197311847 X:124915057-124915079 CCAAATGAAGAGATGGAAAGGGG - Intronic
1197712311 X:129680155-129680177 CAGAGTGAACAGATTGGAGGGGG + Intergenic
1198054781 X:132983090-132983112 CAGACTGAGCTGATGGGATGTGG - Intergenic
1199051363 X:143240340-143240362 CAGAATGAACAACTGGATGGGGG - Intergenic
1200498175 Y:3911884-3911906 CAGAAGCAACAGATGTATTGTGG + Intergenic
1200707989 Y:6459030-6459052 CAGAATGAAGAGAGGCAATGGGG - Intergenic
1201026123 Y:9705678-9705700 CAGAATGAAGAGAGGCAATGGGG + Intergenic
1202182049 Y:22147982-22148004 CAGAATGAAGAGAGGCAGTGAGG - Intergenic
1202209311 Y:22438420-22438442 CAGAATGAAGAGAGGCAGTGAGG + Intergenic