ID: 901522938

View in Genome Browser
Species Human (GRCh38)
Location 1:9799262-9799284
Sequence CTCCATGGGAACCGGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 4, 2: 5, 3: 36, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901522938 Original CRISPR CTCCATGGGAACCGGTGCCA GGG Intronic
900387361 1:2416702-2416724 CTCCGTGGGAAACAGTGCCTGGG + Intergenic
900477162 1:2881451-2881473 CTCCATGGGCTCTGGGGCCAGGG + Intergenic
901522938 1:9799262-9799284 CTCCATGGGAACCGGTGCCAGGG + Intronic
902746278 1:18476607-18476629 CTCCATGGGCACAGGAGCCATGG + Intergenic
902936261 1:19766941-19766963 CCCAATGGGAGCAGGTGCCAGGG - Intronic
903130977 1:21279373-21279395 CTCCAAGGGAAGCGGGGCCCGGG - Intronic
903193051 1:21667512-21667534 CTCCATGGGAAGGGGTGGCAAGG + Intronic
904593156 1:31626582-31626604 CTCCTTGGGAACCCGCTCCAGGG + Intronic
904608364 1:31711295-31711317 CTCCAGGAGAACCTGTGCTATGG - Intergenic
904854410 1:33486346-33486368 CTCTGTGGGAACCAGTTCCAGGG - Intronic
905287768 1:36894652-36894674 CTCCATGGGAATCGGTGTGCAGG + Intronic
906237790 1:44222255-44222277 CTCCACAGGAACAGGTGCCCAGG - Intronic
906453199 1:45970335-45970357 CTCCATAGCAACCAGTGCCAGGG - Intronic
907271496 1:53294084-53294106 CACCCTGGGAACCAGAGCCAAGG - Intronic
907362275 1:53927677-53927699 CTCAAAGGCAACAGGTGCCATGG - Intronic
907457150 1:54583065-54583087 CGCCATGGTAACCACTGCCAAGG - Intronic
907912337 1:58837521-58837543 CTCCATGGGAATTGGAGCCCAGG - Intergenic
908744187 1:67359961-67359983 CTTCATGGGAACCAGTGCTGAGG + Intronic
909797143 1:79755631-79755653 CTCCATTGGAACAGCTGCCTAGG + Intergenic
910372946 1:86537366-86537388 CACCATGAGAACCAGTGCCAAGG - Intergenic
915040004 1:152960568-152960590 CCCCATTGGAACCAGTGCCTTGG - Intergenic
916603849 1:166321769-166321791 CTCTCTGGGAACCAGTGCCAGGG - Intergenic
916800308 1:168209759-168209781 CTCCGTGGGCACTAGTGCCAGGG + Intergenic
916865554 1:168853644-168853666 CTCCATGGGAACAAGTTCTAGGG + Intergenic
917065869 1:171092642-171092664 CCCCATGGTAACCTGTGCAAAGG - Exonic
917490431 1:175493744-175493766 AGCCATGGGAGCCGGTGCCTGGG + Intronic
919307133 1:195856235-195856257 CTGCATGGGCTCAGGTGCCAGGG - Intergenic
920521577 1:206631402-206631424 CTCCCTGGGAACAGCTGCAAAGG + Intergenic
921605239 1:217144580-217144602 CTCTGTAGGAACCAGTGCCAGGG + Intergenic
923623184 1:235594453-235594475 GTCCATGGGACTGGGTGCCATGG + Intronic
923623185 1:235594455-235594477 CTCCATGGCACCCAGTCCCATGG - Intronic
924929114 1:248711868-248711890 CTGCATGGGCTCAGGTGCCAGGG - Intergenic
1063300337 10:4844935-4844957 GTCTATGGGACCTGGTGCCATGG + Intronic
1066041677 10:31554448-31554470 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1066377582 10:34871624-34871646 CTGCATGGGAACCAGTGCTGGGG + Intergenic
1067298881 10:44992094-44992116 CTCCATGGGCACCAGTACCCTGG + Intronic
1070651776 10:78242638-78242660 CTCGTTGGGAACTGGTGCAAAGG + Intergenic
1075827840 10:125375282-125375304 TTCCATGGGAACAGGAGACAAGG + Intergenic
1077080915 11:724405-724427 CCCCAGGGGAACCAGAGCCAGGG - Intronic
1077553381 11:3214126-3214148 CTCCCAGGGAAACGGAGCCAAGG - Intergenic
1079708622 11:23653199-23653221 CTCGATGGGACCCCGTGCCGTGG + Intergenic
1081000435 11:37663838-37663860 CTTCATGGGAATCAGTGCCCAGG + Intergenic
1086199129 11:84179438-84179460 CTCTTTGGGAACCAGTGCCAGGG + Intronic
1087393266 11:97566717-97566739 TTCCATGGGAACCAGTGCTGGGG + Intergenic
1090551967 11:127829743-127829765 CACTATGGGAATCAGTGCCAGGG + Intergenic
1090682157 11:129072626-129072648 CTCTGTGGGAACCAGTGCTAGGG + Intronic
1090768734 11:129899424-129899446 CTCTATGAGAACCAGCGCCAGGG - Intergenic
1095566403 12:43628884-43628906 CTCTGAGGGAACCAGTGCCAGGG - Intergenic
1095777884 12:46029358-46029380 CTCCATGAGAACCAATGCCTGGG - Intergenic
1096406664 12:51348721-51348743 CTCCTTGGGAAGCTGTGGCAGGG + Intergenic
1099191449 12:79565293-79565315 GTCGATGGGACCAGGTGCCATGG - Intergenic
1104775874 12:131389831-131389853 TTCCATGGGAAGCAGAGCCAGGG - Intergenic
1107143577 13:37032548-37032570 CTCCTCAGGAACCAGTGCCAGGG + Intronic
1107765579 13:43730683-43730705 CTAGATGGGAACCTGTGCTAGGG - Intronic
1109383719 13:61599879-61599901 CACCATGGTAACTGTTGCCATGG + Intergenic
1109383720 13:61599881-61599903 CTCCATGGCAACAGTTACCATGG - Intergenic
1109597432 13:64574711-64574733 CTTCATGGGAACCAGTGCCAGGG - Intergenic
1110854150 13:80278675-80278697 GTCGATGGGACCGGGTGCCATGG + Intergenic
1111591442 13:90352758-90352780 CTCCATGGGACCCAGTGCTAGGG + Intergenic
1112768222 13:102769123-102769145 CTCCATGGAAACTGATGACAAGG + Intronic
1114920944 14:27327889-27327911 CACCATGGGGACCAGTGCCATGG - Intergenic
1115125509 14:29988503-29988525 TTCCATGGGAACTGGTGACTTGG + Intronic
1115914690 14:38298972-38298994 CTCTGTGGGAACTAGTGCCAGGG + Intergenic
1115990209 14:39142889-39142911 CTCCTTGGGAACTGGAGCAAAGG - Intergenic
1118841360 14:69515411-69515433 CTCCATGGGAACCAGTACTGGGG - Intronic
1120836846 14:89046602-89046624 CTCCATGGGAACCAGTGCTGGGG + Intergenic
1121145449 14:91578311-91578333 CTCCATGGCGCCCGGTTCCATGG + Intergenic
1124175052 15:27416695-27416717 CTCTGTGGGAACCAGTGCCAGGG - Intronic
1127791001 15:62398637-62398659 CTTCTTGGGAACTGGAGCCAAGG + Intronic
1127916174 15:63457585-63457607 CTCCATGGGAACCTCTTCCCTGG + Intergenic
1130581852 15:85144688-85144710 CACCATGGGAACCAGTGCCAGGG + Intergenic
1131919629 15:97310003-97310025 CTCCATGGGAACATGTGCCTGGG - Intergenic
1135323891 16:21513816-21513838 CCTCATGGGAGACGGTGCCAGGG - Intergenic
1135942200 16:26831843-26831865 CTTTATAGGAACCAGTGCCAGGG + Intergenic
1136335376 16:29607084-29607106 CCTCATGGGAGACGGTGCCAGGG - Intergenic
1138829586 16:60359910-60359932 GTCCAGGGGAACCGGTGGAAGGG - Intergenic
1138889817 16:61128776-61128798 GTCGATGGGACCCGGCGCCACGG + Intergenic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1142036103 16:87862925-87862947 CCTCATGGGAGACGGTGCCAGGG - Intronic
1142305279 16:89281019-89281041 CTCCGCGGGAACCGGGGGCAGGG + Exonic
1143265329 17:5632555-5632577 CTCCATGGAAACCCTTGTCAAGG + Intergenic
1144797274 17:17900696-17900718 CTCCATGGGGACTGGGCCCAAGG + Intronic
1144862170 17:18311940-18311962 CTCCATGACAACAGGGGCCAGGG - Intronic
1147448854 17:40491509-40491531 CTCCTTGGGAACCTGCTCCAAGG + Intronic
1147973119 17:44230588-44230610 CTCCACAGGAACCAGTGCCAGGG - Intergenic
1149727498 17:58911108-58911130 CTCCATAGGAACCAATTCCAGGG - Intronic
1150075024 17:62184936-62184958 CTCTATGGGAACTGGGGGCAAGG + Intergenic
1151608123 17:75153461-75153483 CTGCAAGGGAACCAGGGCCAGGG + Intronic
1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG + Intergenic
1156860229 18:41827687-41827709 GTCCATGGGATCTTGTGCCAGGG - Intergenic
1159373388 18:67559279-67559301 CTCCTTGGGAACTGGTGCTGGGG - Intergenic
1159516186 18:69461395-69461417 CACCATGGGAACAGCTGGCAGGG + Intronic
1160056088 18:75482344-75482366 CTCCATGGGAACCAGAGCCCAGG + Intergenic
1160994378 19:1875938-1875960 TTCCATGGTAAGCGGTGCTACGG - Intergenic
1164432604 19:28201231-28201253 GTCCAAGGGAACACGTGCCAGGG + Intergenic
928490330 2:31777408-31777430 CTCCAAGGGAACCAGTGCCAGGG + Intergenic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
932626090 2:73297050-73297072 TTCCATGGGAAAAGGTGCAAAGG + Intergenic
933354678 2:81196743-81196765 CTCCACGGGAACCGGGGGCAGGG + Intergenic
933917127 2:87006889-87006911 CTCCCTGGGATACAGTGCCAAGG + Intronic
934005869 2:87763025-87763047 CTCCCTGGGATACAGTGCCAAGG - Intronic
934588354 2:95525799-95525821 CCCCATGGGCACCGTTGCCTTGG + Intergenic
935768821 2:106397125-106397147 CTCCCTGGGATACAGTGCCAAGG - Intronic
937288785 2:120769381-120769403 CTCCATGGGTGCCGGGGCCTGGG + Intronic
937934910 2:127235628-127235650 CTTTATGGGAACCAGTACCAGGG + Intergenic
939236696 2:139503542-139503564 TTCCATGGGAACCAGTGTCAAGG + Intergenic
940083542 2:149832221-149832243 CTCCATGGGAACCAGTACTGGGG - Intergenic
943475811 2:188353874-188353896 CTCCCAGGGAACTGGTGCCTTGG + Intronic
945309535 2:208295060-208295082 CTCCATGGGAACCAGTAATAGGG - Intronic
945643455 2:212460497-212460519 CTTCTTGGGAACTGGAGCCAAGG + Intronic
945900589 2:215533490-215533512 CTTCTTGGGAACTGGAGCCAAGG + Intergenic
1168931391 20:1627167-1627189 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1168935558 20:1662211-1662233 CTCTGTGGGAACCAGTGCCGGGG + Intergenic
1170613878 20:17934176-17934198 GGCCATGGTCACCGGTGCCAGGG + Intergenic
1170637290 20:18118481-18118503 CTGCACTGGAACCAGTGCCAGGG - Intergenic
1172977498 20:38918023-38918045 CTCCCTGGGTATCGGGGCCAGGG - Intronic
1174029831 20:47614135-47614157 CTCCAAGAGAACTGGTACCACGG - Intronic
1174834793 20:53846772-53846794 CTCCGTGGGAACCGGTGCCAGGG - Intergenic
1175373342 20:58507638-58507660 CTCCATTGAAACCTGTGCAAGGG - Intronic
1175910132 20:62401311-62401333 CTCCACGGGAGCTGGTGTCAAGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176121172 20:63455259-63455281 CTCCTTGGCAACGGCTGCCAGGG - Intronic
1177282819 21:19006691-19006713 CTCCATGGGAAACAGTACCAGGG + Intergenic
1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG + Intronic
1180179147 21:46110170-46110192 CTCCCTGGGGGCCGCTGCCATGG - Intronic
1181052817 22:20245795-20245817 CTCCGTGAGAACTGGGGCCAGGG - Intronic
1181787592 22:25238230-25238252 CTCCCTGGCAACAGGTGACAAGG - Intergenic
1181851526 22:25753117-25753139 GTCCATGGGACGCGGTGCCGTGG - Intronic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1182718425 22:32378188-32378210 TACCATGGCAACTGGTGCCATGG + Intronic
1184129996 22:42512043-42512065 CTCCATGGGCCCCGGGGTCAGGG - Exonic
1184140174 22:42573861-42573883 CTCCATGGGCCCCGGGGTCAGGG - Intronic
1184338792 22:43873983-43874005 CTTCATGGGAACTGGAGCAAAGG + Intergenic
1184969023 22:48002121-48002143 CTCCATGGGATTCTGTCCCATGG - Intergenic
951415498 3:22417290-22417312 GTTGATGGGACCCGGTGCCATGG - Intergenic
954225341 3:49177521-49177543 CACCATGGGCACAAGTGCCATGG + Intergenic
956234862 3:67058491-67058513 TTCCATGGAAACCAGTGCCAGGG - Intergenic
957030504 3:75235492-75235514 CTTCTTGGGAACTGGAGCCAAGG + Intergenic
958549601 3:95595538-95595560 GTCGATGGGAAGGGGTGCCATGG + Intergenic
958553400 3:95644140-95644162 CTTCTTGGGAACCGGAGCAAAGG - Intergenic
959742643 3:109738043-109738065 CTTCTTGGGAACCGGAGCAAAGG - Intergenic
960297933 3:115967310-115967332 CTTCTTGGGAACTGGTGCAATGG - Intronic
963397947 3:144757235-144757257 GTCGATGGGACCAGGTGCCATGG - Intergenic
969575178 4:8032518-8032540 CACCATGGGGCCCGGGGCCACGG - Intronic
971515119 4:27475975-27475997 CTCCACAGGAACCAGTGTCAGGG + Intergenic
971577282 4:28291748-28291770 CTCCAAGGGAATCAGTGTCAGGG + Intergenic
972397545 4:38671005-38671027 GCCCATGGGAAGCAGTGCCAGGG - Intronic
973048631 4:45567393-45567415 GTCAATGGGACCAGGTGCCATGG - Intergenic
974110016 4:57514330-57514352 CTCCATGACAAACGCTGCCAGGG - Intergenic
976204549 4:82612151-82612173 CTCTATGGGAACAGTTGTCAAGG + Intergenic
977046288 4:92072167-92072189 CTTCTTGGGAACTGGTGCAAAGG - Intergenic
977606865 4:98993501-98993523 GTCCATGGGACCGGGTGCCCTGG + Intergenic
977606866 4:98993503-98993525 CTCCAGGGCACCCGGTCCCATGG - Intergenic
979647417 4:123087698-123087720 CTCCATGAGAGCCAGTGCCAGGG - Intronic
980442104 4:132862561-132862583 CTCCAGGGGAACCAATGCCAAGG + Intergenic
981571117 4:146151549-146151571 CTCCACAGGAACCAGTACCAGGG - Intergenic
981819383 4:148868274-148868296 CACCATGGAAACCGTGGCCATGG - Intergenic
982592059 4:157326024-157326046 CTCCATGGGACTGGGTGACAGGG - Intronic
984161637 4:176259876-176259898 CTCAGTGGGTACCGGTGGCATGG + Intronic
984321222 4:178198894-178198916 CTCTGTGGGAACCAGTGCCTTGG + Intergenic
985269356 4:188179300-188179322 GTCGATGGGACCCGGCGCCATGG - Intergenic
985324760 4:188754833-188754855 GTTGATGGGACCCGGTGCCATGG - Intergenic
985490890 5:178242-178264 CACCTTGGGAGCCAGTGCCAGGG - Intronic
985816457 5:2131637-2131659 CTCCTTGGGAACAAGGGCCAGGG - Intergenic
985908889 5:2863861-2863883 CTCGAAGGGAACCCGTGCCCAGG - Intergenic
986115606 5:4770882-4770904 CTCAATGGGAACCTGGGGCATGG - Intergenic
986287112 5:6367482-6367504 CAGGATGGTAACCGGTGCCAGGG + Intergenic
986569844 5:9153575-9153597 CTCCAGGGGAGCTGGTGCCAAGG + Intronic
987099244 5:14577589-14577611 GTCGATGGGACCCGGCGCCACGG - Intergenic
988201725 5:28077688-28077710 GTCCATGGGACTGGGTGCCATGG + Intergenic
988201726 5:28077690-28077712 CTCCATGGCACCCAGTCCCATGG - Intergenic
988409857 5:30873412-30873434 CTCAATGGGAAACTGTGCAAAGG - Intergenic
989471429 5:41823470-41823492 CTCCATGGGAACCAGTCCTGGGG - Intronic
989485676 5:41988605-41988627 CTCCATGAAACCCAGTGCCAGGG - Intergenic
991150127 5:63358066-63358088 CTCCATGGGAAACAGTGCTGAGG - Intergenic
993389221 5:87297894-87297916 TTCCTTGGGAACCAGTGCCAGGG - Intronic
994858213 5:105153332-105153354 CTCCCTGGCAACCAGTACCAGGG - Intergenic
995388278 5:111612171-111612193 GTCAATGGGACCAGGTGCCATGG + Intergenic
997184674 5:131869807-131869829 CTCCATGGGAACCATTGCCAGGG - Intronic
997375558 5:133394691-133394713 GTCAATGGGACCTGGTGCCACGG - Intronic
1001934015 5:175691934-175691956 CTCCAGGGGACCCGGCCCCAGGG + Intergenic
1003192570 6:3887477-3887499 TTCCCTGGGAACCTGGGCCACGG - Intergenic
1006394145 6:33776112-33776134 CTTCATGGGAAGGGGTGGCAGGG - Intronic
1006920409 6:37624205-37624227 CTCCATGGGAACAGGCTTCAGGG - Intergenic
1007819668 6:44551958-44551980 CCCCCTTGGAACCTGTGCCAGGG + Intergenic
1009477237 6:64108275-64108297 CTCCGTGAGAACCAGTCCCAGGG - Intronic
1009617174 6:66024610-66024632 CTCCATGGAAGCCAGTACCAGGG - Intergenic
1010282522 6:74037897-74037919 CTTCTTGGGAACCGGAGCAAAGG + Intergenic
1012131345 6:95497283-95497305 GTCGATGGGACCAGGTGCCATGG - Intergenic
1017336942 6:153272200-153272222 CTCCATGGGAACCAGTTCCCTGG - Intergenic
1017659427 6:156659282-156659304 CTCTATGGGAACCAGTACCAAGG + Intergenic
1018734165 6:166675089-166675111 CTCCTTGGGTTCCAGTGCCATGG + Intronic
1019445898 7:1071085-1071107 CTCCAGGGTAACAGGAGCCATGG + Intronic
1019987650 7:4669404-4669426 TTCCATGGGAACCAGTAGCAGGG + Intergenic
1020930680 7:14389495-14389517 ATCAATGGGAACAGGTACCATGG - Intronic
1021194802 7:17663206-17663228 CTCCATGGGAACAGGAACCTGGG - Intergenic
1021513747 7:21461217-21461239 GTCGATGGGACCGGGTGCCATGG + Intronic
1023012727 7:35938119-35938141 CTCCATGGAAACCACTGCCCAGG - Intergenic
1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1023425751 7:40034214-40034236 CTCCTTGGGAACCATTACCAAGG - Intronic
1024078403 7:45835728-45835750 CTCCATGGAAACCGCTGCCCAGG + Intergenic
1026236886 7:68535006-68535028 GTCCATGGGAAAGTGTGCCATGG + Intergenic
1028927205 7:96371207-96371229 TTCCATGGGAACCGGCACCATGG - Intergenic
1029014567 7:97302121-97302143 TTCCATGGGGAGGGGTGCCATGG + Intergenic
1029374446 7:100169476-100169498 CTCCTGGGGGACAGGTGCCAAGG + Intergenic
1029403069 7:100357321-100357343 CTGCATGGGAGCCCCTGCCAGGG + Intronic
1029405685 7:100373062-100373084 CTGCATGGGAGCCCCTGCCAGGG + Intronic
1029556990 7:101277161-101277183 CTCCATGGAAACCGCTGCCCAGG - Intergenic
1030459407 7:109812221-109812243 CTCTATGGGAACCAGTGCTTGGG - Intergenic
1032474899 7:132204948-132204970 CTCCCTGGCAACGCGTGCCAGGG + Intronic
1033982265 7:147179944-147179966 GTCCATAGGAACAGGTGTCAGGG + Intronic
1035463842 7:159063157-159063179 GTCCATGGGACCAGGTGCCGCGG + Intronic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1039731264 8:40281058-40281080 CTCCGTGGGAACCGGTACCAGGG - Intergenic
1040098191 8:43469263-43469285 CTTAATGGGAACCAGTGTCAAGG - Intergenic
1043412687 8:80015002-80015024 CTCTGTGGGAACCAGTGCCGAGG + Intronic
1044873366 8:96641820-96641842 CTCCAAGGCAACCTGTCCCAGGG + Intergenic
1045836482 8:106527288-106527310 CTCCATGAGAGCAGGTACCATGG - Intronic
1046251935 8:111643167-111643189 GTCGATGGGACCGGGTGCCATGG - Intergenic
1047672984 8:127169356-127169378 ATCCATTGGAACCAGTGCCAGGG - Intergenic
1051132245 9:13875583-13875605 CTCCATGGGTTCAAGTGCCAGGG + Intergenic
1052736944 9:32352385-32352407 CTCCATGGGAAGCAGTGACAGGG + Intergenic
1053283578 9:36836809-36836831 CTCCAGGGGTCCAGGTGCCAAGG - Exonic
1054851213 9:69848621-69848643 CTCCTTGGGGACTGATGCCAAGG - Intronic
1056378655 9:86037773-86037795 CACCACGGGAACTGGTGTCAGGG + Intronic
1056997245 9:91474416-91474438 CTTCATGGGAACTAGTGCCAGGG - Intergenic
1057211675 9:93204005-93204027 ATCCTTGGGAACGGGTGTCAGGG + Intronic
1059717234 9:116924461-116924483 CTCCATTGGCAGCGGTGGCATGG + Intronic
1061551433 9:131337027-131337049 CTCCATGGCCACCTGGGCCAGGG - Intergenic
1062019247 9:134308659-134308681 CACCATGGGAGCCAATGCCACGG + Intergenic
1062019289 9:134308837-134308859 CACCATGGGAGCCAATGCCACGG + Intergenic
1062034870 9:134378557-134378579 CTCCTTGGGGACAGGTGACAGGG - Intronic
1062264741 9:135681825-135681847 ACCCTTGGGAACCGGCGCCAGGG + Intergenic
1188350114 X:29119602-29119624 CTCCAAGGGAACTAGTTCCAGGG + Intronic
1190950536 X:55139151-55139173 CTCAATGGGAACTGGAGCAAAGG + Intronic
1193668098 X:84349118-84349140 CTCCATGGGAACCATTACCAAGG - Intronic
1195209487 X:102639230-102639252 CTCTTTGGGAACCAGTGCTAGGG - Intergenic
1195700216 X:107699475-107699497 CTCTGTGGGAACCAGTGCCAGGG - Intergenic
1199823283 X:151472015-151472037 CTTAATGGGAACTGGAGCCAAGG - Intergenic
1200135243 X:153871564-153871586 TACCTTGGGAACCGTTGCCATGG - Intronic
1201729254 Y:17187501-17187523 CTCCCTGGGAACCGGTCCCCAGG + Intergenic