ID: 901523463

View in Genome Browser
Species Human (GRCh38)
Location 1:9803846-9803868
Sequence CAATGACATCAGCCATTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901523462_901523463 28 Left 901523462 1:9803795-9803817 CCATCTTAAAAAAAATTAAATAA 0: 4
1: 42
2: 905
3: 8620
4: 112524
Right 901523463 1:9803846-9803868 CAATGACATCAGCCATTTAAAGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901523463 Original CRISPR CAATGACATCAGCCATTTAA AGG Intronic
901172395 1:7268889-7268911 AAATATCCTCAGCCATTTAAAGG + Intronic
901523463 1:9803846-9803868 CAATGACATCAGCCATTTAAAGG + Intronic
902683976 1:18063785-18063807 CCATGACATCAGCCCAATAATGG + Intergenic
904125871 1:28237993-28238015 CAATGACATGTGCCATTCTATGG - Exonic
905051339 1:35053593-35053615 CAATGACATCACCAAGTTAATGG + Intergenic
905307366 1:37028990-37029012 CAATGACAACAGCCATATGATGG - Intronic
908430508 1:64052030-64052052 CTATTTCATCAGCCAGTTAAAGG + Intronic
908540019 1:65113481-65113503 CAATGACATCAGCAACTTTTGGG - Intergenic
909259149 1:73464467-73464489 GAGTGACATCAGCAATATAATGG - Intergenic
909753784 1:79197145-79197167 CAGTGCAATCAGCCATTTAAAGG - Intergenic
911736535 1:101342834-101342856 AAATGACATCATCCATGTATTGG - Intergenic
912020590 1:105104565-105104587 CAATAACATAAGACATATAATGG + Intergenic
912344643 1:108953285-108953307 CAATGAAATTAGCCATTTATCGG + Intronic
914311933 1:146474473-146474495 CCATGCCTTCAGACATTTAAGGG + Intergenic
914502414 1:148258860-148258882 CCATGCCTTCAGACATTTAAGGG - Intergenic
915675974 1:157531353-157531375 CAATGCCACCAGCAATGTAAGGG - Intronic
915685860 1:157633157-157633179 CAATGCCACCAGCAATGTAAGGG - Intergenic
918305872 1:183245640-183245662 CAATCACATCTGCCATGCAAAGG + Intergenic
918864462 1:189876594-189876616 CATTGACATCTGCCATTTACAGG - Intergenic
922162981 1:223091894-223091916 CAATGACATCTTACATATAATGG + Intergenic
923258135 1:232239760-232239782 CTATGACTTCCGGCATTTAAAGG + Intergenic
923862297 1:237903924-237903946 TAATGAAACCAGCCATTAAATGG + Intergenic
1063110478 10:3032392-3032414 GAATGTTATCAGCCATTAAATGG + Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1067547649 10:47206068-47206090 CAATGGCCTCAGGCATTTGAAGG + Intergenic
1068237984 10:54263310-54263332 CCATGGCATCAGCCACTAAAAGG + Intronic
1068816555 10:61321832-61321854 TAATGACATGAGCAATATAATGG - Intergenic
1070247828 10:74748585-74748607 CAACAGCATCAGCCCTTTAAGGG + Intergenic
1074927846 10:118091975-118091997 CAATGACACCACACATGTAAAGG - Intergenic
1075936665 10:126348349-126348371 CAATGATATCAGGCTTTGAATGG + Intronic
1087180787 11:95140437-95140459 CACTGACATCAGCTGCTTAAAGG + Intergenic
1088565929 11:111173087-111173109 AAATGAGATCATCCATATAAAGG + Intergenic
1088811002 11:113392284-113392306 CAATGACATCTGCCATGGCATGG - Intronic
1091610330 12:2002141-2002163 GAATGACTTCAGCCTTTCAAAGG - Intronic
1095386376 12:41655253-41655275 CAAAAACATCAGCCATAAAAAGG + Intergenic
1097728133 12:63098093-63098115 CAATTACATAAGCCAATTAAAGG - Intergenic
1098994092 12:77098014-77098036 CAATGCCAGCAGCCATGTCAGGG + Intergenic
1100826885 12:98483188-98483210 TAATCACATGAGCCCTTTAAAGG + Intergenic
1104520934 12:129474364-129474386 CAATGACTTCACCCAGTTAATGG - Intronic
1104624712 12:130341768-130341790 CAATGTCATCAGGCTATTAAGGG - Intronic
1107005322 13:35603086-35603108 AAATGAAATCTGCCTTTTAAGGG - Intronic
1107375580 13:39800799-39800821 CAATGACATCAGCAGGTTAGTGG + Intergenic
1107814970 13:44236597-44236619 CCAGAACATCAGCCATTGAAGGG + Intergenic
1108117161 13:47141567-47141589 CAATGATATCATCCATGTCAAGG - Intergenic
1108505327 13:51107669-51107691 AAAAGACATCAGACTTTTAAAGG + Intergenic
1108733386 13:53257630-53257652 CAAAGACATCAGAAATATAAAGG - Intergenic
1109473620 13:62846868-62846890 CAATCACATCTGTCTTTTAAGGG + Intergenic
1110781898 13:79476023-79476045 TAATCACATTAGCCAGTTAAGGG + Intergenic
1111101220 13:83589552-83589574 CAATAACAACAGGCATTTGATGG + Intergenic
1112779861 13:102888297-102888319 CAATAACACCACCCATTTCAAGG - Intergenic
1113014573 13:105814041-105814063 TAATGAGATCAGCCCCTTAATGG - Intergenic
1114836367 14:26207366-26207388 AAAAAACATCAGCCATTTCAAGG - Intergenic
1118226212 14:63901954-63901976 CAATGACATAAGCTATTTGGGGG - Intronic
1118634997 14:67740238-67740260 CAATGACAGCAGTTACTTAAAGG + Intronic
1119459238 14:74785393-74785415 CAATGACATAAGCTAGTTAGGGG - Intronic
1124055685 15:26238887-26238909 CAATTACTGCAGCCATTTTACGG + Intergenic
1125325210 15:38529464-38529486 AAATGACATCAGTAATTCAAGGG - Intronic
1125419132 15:39486694-39486716 ATATCACATCTGCCATTTAAGGG - Intergenic
1127903271 15:63357000-63357022 AAATGAGATCAGCCTTTTTACGG - Intronic
1128097630 15:64970131-64970153 CAATGGCATCAGCCATCATAGGG + Exonic
1128467712 15:67926791-67926813 TAATGACATGTGGCATTTAAGGG + Intergenic
1129165989 15:73777902-73777924 TTATGACATGAGCCATGTAAAGG + Intergenic
1131506320 15:93022823-93022845 TAATGAAATGAGCCTTTTAACGG - Intronic
1136587073 16:31193587-31193609 CAATCACATATGCCATTTGAAGG - Exonic
1138756273 16:59489969-59489991 CAATTTCCTCACCCATTTAACGG - Intergenic
1141642162 16:85347641-85347663 CAGTGACCTCATCCATATAATGG + Intergenic
1142313744 16:89330111-89330133 GAATGACATTAAACATTTAAAGG + Intronic
1143881468 17:10033392-10033414 CAATGACATAAGGCATTTGGGGG - Intronic
1145392149 17:22463670-22463692 ACAGGACATCAGCCATTAAAGGG + Intergenic
1151401600 17:73859228-73859250 CAATGACATGAGCCATTCAGAGG - Intergenic
1151402138 17:73862745-73862767 CAATGACATGAGCCATTCAGAGG + Intergenic
1156608132 18:38693205-38693227 CAATGGCTTCAGGCATTTCAGGG - Intergenic
1157246639 18:46060649-46060671 CAAAGACTGCAGCCATTTAGAGG - Intronic
1158323021 18:56284024-56284046 CAATGAAATAATGCATTTAAAGG + Intergenic
1162173101 19:8806820-8806842 GAATGACATCTGACATATAAAGG - Exonic
1168638347 19:58013466-58013488 TAATGACACCAGCCATGTGAAGG + Intergenic
925196111 2:1927211-1927233 CCATGAGATCAGCCACTGAATGG - Intronic
928586364 2:32762473-32762495 CAAAGAAATCAACCCTTTAATGG - Intronic
929181033 2:39039683-39039705 CATTCACTTCACCCATTTAATGG + Intronic
929360722 2:41086468-41086490 CAATGACATAAGCCATTATGAGG - Intergenic
933315861 2:80714467-80714489 CAATGACAGCAGTCATTTTCAGG + Intergenic
935184866 2:100722901-100722923 CAAAGACACCATCCATGTAAAGG + Intergenic
935424647 2:102907238-102907260 TAATGACATGAGCCCTTAAAAGG + Intergenic
936435304 2:112500012-112500034 AAATGACTTCAGCCATAGAAAGG + Intronic
937825037 2:126359648-126359670 GAATGACAGCAGCCATTTGCAGG + Intergenic
939192843 2:138936858-138936880 CTATTAAATCAGCCATTAAATGG - Intergenic
940811191 2:158244665-158244687 TAATCACATGAGCCCTTTAAAGG - Intronic
942428186 2:175881286-175881308 TAATTACATCAGCCTTTAAAGGG - Intergenic
944871270 2:203914457-203914479 CAATAATATCAGCCTTTCAAAGG - Intergenic
946871418 2:224088955-224088977 CAATGGGATCAGCCTTTTGATGG + Intergenic
947262856 2:228243248-228243270 CAATCACATCAGCCATATCAAGG + Intergenic
947438120 2:230090908-230090930 CAGTGAAAACAGCCATTTCAGGG + Intergenic
947766058 2:232638250-232638272 CAATGAGGGCAGCCACTTAAAGG + Intronic
948029152 2:234802121-234802143 CAATAATATCAGCCTTTCAAGGG - Intergenic
1172660207 20:36562882-36562904 CAACGAAAGCAGCCATTAAATGG + Intergenic
1177574439 21:22932978-22933000 CAATGACATTAGTCATTAATAGG + Intergenic
1179635791 21:42707878-42707900 CAATGATAACAACCATTTACTGG - Intronic
1184110639 22:42392105-42392127 AAATGACATCACCCAGTGAAGGG + Intronic
949881970 3:8668542-8668564 CAAAGACATCATCAACTTAAGGG + Intronic
951253150 3:20417645-20417667 CAATCACATCAGCTATAAAACGG - Intergenic
956432848 3:69205128-69205150 CAATTACAGCAGCCATTTGCGGG + Intronic
960907341 3:122614653-122614675 CAATAACATCTGCCCTTTATTGG + Intronic
962102249 3:132355185-132355207 CAACCACGTCAGCCTTTTAAAGG + Intronic
963439154 3:145315148-145315170 AAATGCCATCAGCCAATGAATGG - Intergenic
963852266 3:150220820-150220842 TAATGGCATCAGTCACTTAAGGG + Intergenic
964558967 3:157972769-157972791 CAAGGACATCCGGCATTTTATGG - Intergenic
965405463 3:168262960-168262982 CATAGGCATCAGCCATTGAAAGG + Intergenic
966012181 3:175093907-175093929 CATGTACATCAGCAATTTAACGG - Intronic
969970191 4:11038960-11038982 AAATGAGATCATCCATATAAAGG - Intergenic
970331797 4:14994134-14994156 CAAAGACATGAGCCATTTTGTGG - Intergenic
973715992 4:53676872-53676894 CAATGCCATTAGCCATATGATGG - Intronic
973741033 4:53919671-53919693 CAAAGACTTCAGACATTTTAAGG - Intronic
973820992 4:54661191-54661213 CAATGACATCAGCCATTATTGGG - Intronic
974935045 4:68401541-68401563 CAATAAGATCATCTATTTAAAGG - Intergenic
977817083 4:101427245-101427267 AGATGACATCAGCAATTCAAGGG - Intronic
978861631 4:113457146-113457168 CAATCAGATCAGCCATTTGTGGG - Intronic
980655499 4:135778481-135778503 GAATGACATCAAGCATTTAGTGG + Intergenic
981118604 4:141021460-141021482 GAATGACATCAGAAATCTAAGGG + Intronic
981777176 4:148382636-148382658 CCATGACATCATACATTAAAAGG + Intronic
981872757 4:149506779-149506801 CAATAACATCAGCCATTGCCTGG + Intergenic
984493288 4:180463845-180463867 CAATGGCATCAGCAAACTAATGG - Intergenic
985597760 5:805079-805101 CAATGACAACAGCAATATAAAGG + Intronic
986934384 5:12865359-12865381 AAATGACAACAGTCATTTAATGG + Intergenic
988446705 5:31294237-31294259 CACCGACATCAGACATTTCAGGG - Exonic
989550716 5:42732835-42732857 AAATGACATCAGCAGTTAAAAGG + Intergenic
994575794 5:101577579-101577601 CAATCACATCAGTCATCTAACGG + Intergenic
995033100 5:107501978-107502000 CACTGACATCAGCTTTTAAAGGG - Intronic
995259259 5:110082724-110082746 CAATGGCACCAGCCAATTGAGGG - Intergenic
996458738 5:123716394-123716416 AAATGACATCACCCTTATAAAGG - Intergenic
996746702 5:126852352-126852374 TAATGAGATCAGCCCCTTAACGG + Intergenic
997354146 5:133251647-133251669 CAATGACATCAGCCTGGAAATGG - Intronic
998949551 5:147378963-147378985 GAATGCCAACAGTCATTTAATGG + Intronic
1002370929 5:178753762-178753784 AAATGACACCAGCCCTTTGAAGG - Intergenic
1004089268 6:12483548-12483570 GAATGACAGCAGTCTTTTAATGG + Intergenic
1005844428 6:29766370-29766392 AAATCACATGAGCCATTAAAAGG + Intergenic
1006335653 6:33419147-33419169 CAATGACCTCAGACCTTGAAGGG - Intergenic
1008178410 6:48297019-48297041 CAATGAAGTCAGCCATTCCAGGG + Intergenic
1010571720 6:77481276-77481298 CAATGACACCAGCAAATTTAAGG - Intergenic
1010866191 6:80979260-80979282 CAATAACATGAGCCAGTAAAGGG - Intergenic
1012125538 6:95423700-95423722 CATTGACATCAGAAATTTGAAGG + Intergenic
1012585703 6:100919503-100919525 TAATGACAATAGCCATCTAAAGG + Intergenic
1013158657 6:107520268-107520290 CAATAACACAATCCATTTAAAGG - Intronic
1014933001 6:127356131-127356153 CAACGACCTCAGCCAAGTAACGG - Intergenic
1019521033 7:1460563-1460585 CACTGACACCAGCCATGTGAGGG + Intergenic
1019938765 7:4273083-4273105 AATTGACATAAGCCATTAAAGGG - Intergenic
1021628470 7:22619453-22619475 CAATGACATCAGCTATCTTTTGG - Intronic
1022190163 7:28009821-28009843 CAGTGACAACATCAATTTAATGG - Intronic
1023110497 7:36806382-36806404 CAAAGACCTCAGCCATCTTATGG + Intergenic
1027482436 7:78715694-78715716 CAATGACTTCATTCATTTCATGG + Intronic
1029242081 7:99170175-99170197 CAAGGACATCAGACATCTGATGG + Intergenic
1030265291 7:107614855-107614877 CAATGAGGTCAGCAATTTTAGGG - Intronic
1032750443 7:134834730-134834752 CAATCAGATCAGCCATTTGTGGG - Intronic
1033326695 7:140385105-140385127 AAATGAAATAAGCCATTTTATGG - Intronic
1035890117 8:3334154-3334176 AAATGACATCAACCTTTTCAAGG + Intronic
1037017924 8:13931614-13931636 CAATGATATCACCCTTCTAATGG - Intergenic
1037450125 8:19008438-19008460 CGAAGACAGCAGCCATCTAATGG + Intronic
1039250552 8:35659747-35659769 CAATGACATCAGCAATACAGAGG - Intronic
1041133345 8:54727707-54727729 CTATAACATCTGACATTTAATGG - Intergenic
1042203604 8:66305929-66305951 CAATGAGGTCAGCCAATGAAAGG + Intergenic
1042738283 8:72013117-72013139 CAATGTATTCAGCTATTTAAAGG + Intronic
1043531950 8:81161000-81161022 CAATGAGAACAGTCAATTAAAGG + Intergenic
1044217350 8:89627740-89627762 CTTTCACATCAGTCATTTAATGG - Intergenic
1047141634 8:122147317-122147339 TAAAGACATAAGTCATTTAAGGG + Intergenic
1047484700 8:125318718-125318740 CATTGACATCAGGCATGGAAAGG + Intronic
1047860225 8:128957865-128957887 GAAGGACATCAACCATTTCACGG - Intergenic
1051709102 9:19911858-19911880 CACTAAAATCAGACATTTAAGGG + Intergenic
1058366449 9:104214900-104214922 CAATCAAAGCATCCATTTAATGG - Intergenic
1059236692 9:112766597-112766619 GAATGGCAGCAGTCATTTAATGG - Intronic
1059465789 9:114468000-114468022 CAATGAGATAACACATTTAAAGG - Intronic
1059576082 9:115490040-115490062 CAATGAGATCACCCATGTAAGGG - Intergenic
1059660470 9:116395129-116395151 CAATGAACTCATTCATTTAATGG - Intronic
1186459585 X:9737653-9737675 CACTGAAATGTGCCATTTAAAGG + Intronic
1188395051 X:29672074-29672096 CATTCACATCGGCCATTAAAAGG - Intronic
1190297660 X:49038099-49038121 CAATGACATCATCAATCTAGGGG + Exonic
1191229055 X:58079748-58079770 GAAAGACCTCAGCCATTTTAAGG + Intergenic
1191230644 X:58090895-58090917 CGATGACATCAGACATTCTAAGG + Intergenic
1191233774 X:58118078-58118100 GCATGACCTCAGCCATTTTAAGG + Intergenic
1193257883 X:79370844-79370866 AAATGACATAATCAATTTAAAGG - Intergenic
1196266161 X:113649117-113649139 CTATGTCATCAGCCATGTTATGG - Intergenic
1196462264 X:115943334-115943356 CATTGACATAAGCCACTAAAAGG + Intergenic
1198890438 X:141389244-141389266 CAATGACTGCAACCATTTAATGG - Intergenic
1201049772 Y:9920986-9921008 CAATTATATCAGCCTTATAATGG + Intergenic