ID: 901525990

View in Genome Browser
Species Human (GRCh38)
Location 1:9823775-9823797
Sequence AGAGCTCCGAGAGCTCCGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 70}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901525990_901526002 18 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526002 1:9823816-9823838 GGGCTAGCTGCTCCGCGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 87
901525990_901526008 30 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526008 1:9823828-9823850 CCGCGGCGCGGGGAGCTCCGGGG 0: 1
1: 1
2: 3
3: 15
4: 264
901525990_901525995 -10 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901525995 1:9823788-9823810 TCGGAGCTCTCGGGGCTCTAGGG 0: 1
1: 0
2: 2
3: 4
4: 51
901525990_901526005 28 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526005 1:9823826-9823848 CTCCGCGGCGCGGGGAGCTCCGG 0: 1
1: 0
2: 1
3: 18
4: 151
901525990_901526006 29 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526006 1:9823827-9823849 TCCGCGGCGCGGGGAGCTCCGGG 0: 1
1: 0
2: 2
3: 13
4: 168
901525990_901525998 -3 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901525998 1:9823795-9823817 TCTCGGGGCTCTAGGGGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 146
901525990_901525997 -4 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901525997 1:9823794-9823816 CTCTCGGGGCTCTAGGGGCCTGG 0: 1
1: 0
2: 2
3: 9
4: 146
901525990_901525996 -9 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901525996 1:9823789-9823811 CGGAGCTCTCGGGGCTCTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 64
901525990_901525999 -2 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901525999 1:9823796-9823818 CTCGGGGCTCTAGGGGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 222
901525990_901526000 13 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526000 1:9823811-9823833 GCCTGGGGCTAGCTGCTCCGCGG 0: 1
1: 0
2: 1
3: 21
4: 176
901525990_901526004 20 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526004 1:9823818-9823840 GCTAGCTGCTCCGCGGCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 58
901525990_901526003 19 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526003 1:9823817-9823839 GGCTAGCTGCTCCGCGGCGCGGG 0: 1
1: 0
2: 1
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901525990 Original CRISPR AGAGCTCCGAGAGCTCCGCT CGG (reversed) Exonic