ID: 901526001

View in Genome Browser
Species Human (GRCh38)
Location 1:9823812-9823834
Sequence GCCGCGGAGCAGCTAGCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901526001_901526011 4 Left 901526001 1:9823812-9823834 CCTGGGGCTAGCTGCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 901526011 1:9823839-9823861 GGAGCTCCGGGGGTCCAAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 199
901526001_901526005 -9 Left 901526001 1:9823812-9823834 CCTGGGGCTAGCTGCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 901526005 1:9823826-9823848 CTCCGCGGCGCGGGGAGCTCCGG 0: 1
1: 0
2: 1
3: 18
4: 151
901526001_901526009 -6 Left 901526001 1:9823812-9823834 CCTGGGGCTAGCTGCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 901526009 1:9823829-9823851 CGCGGCGCGGGGAGCTCCGGGGG 0: 1
1: 0
2: 3
3: 28
4: 227
901526001_901526010 1 Left 901526001 1:9823812-9823834 CCTGGGGCTAGCTGCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 901526010 1:9823836-9823858 CGGGGAGCTCCGGGGGTCCAAGG 0: 1
1: 0
2: 0
3: 24
4: 208
901526001_901526006 -8 Left 901526001 1:9823812-9823834 CCTGGGGCTAGCTGCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 901526006 1:9823827-9823849 TCCGCGGCGCGGGGAGCTCCGGG 0: 1
1: 0
2: 2
3: 13
4: 168
901526001_901526008 -7 Left 901526001 1:9823812-9823834 CCTGGGGCTAGCTGCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 901526008 1:9823828-9823850 CCGCGGCGCGGGGAGCTCCGGGG 0: 1
1: 1
2: 3
3: 15
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901526001 Original CRISPR GCCGCGGAGCAGCTAGCCCC AGG (reversed) Exonic