ID: 901526006

View in Genome Browser
Species Human (GRCh38)
Location 1:9823827-9823849
Sequence TCCGCGGCGCGGGGAGCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901526001_901526006 -8 Left 901526001 1:9823812-9823834 CCTGGGGCTAGCTGCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 901526006 1:9823827-9823849 TCCGCGGCGCGGGGAGCTCCGGG 0: 1
1: 0
2: 2
3: 13
4: 168
901525990_901526006 29 Left 901525990 1:9823775-9823797 CCGAGCGGAGCTCTCGGAGCTCT 0: 1
1: 0
2: 1
3: 3
4: 70
Right 901526006 1:9823827-9823849 TCCGCGGCGCGGGGAGCTCCGGG 0: 1
1: 0
2: 2
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901526006 Original CRISPR TCCGCGGCGCGGGGAGCTCC GGG Exonic